Team:UChicago/Plan

From 2013.igem.org

(Difference between revisions)
(Construct pUB110 backbone)
(Construct pUB110 backbone)
Line 41: Line 41:
-
In the image, M-O represents the origin replication that is recognized by B. subtilis, while ori+ is the origin of replication used by S. aureus.
+
In the image, M-O represents the origin replication that is recognized by B. subtilis, while ori+ is the origin of replication used by S. aureus. Because this vector includes EcoRI and XbaI sites, we had to find a way to remove them before we turned the vector into a BioBrick backbone. We chose to digest pUB110 with NdeI and AflII, which would remove the Pre gene along with the EcoRI and XbaI sites from the vector. However, this gene is not essential for replication in B. subtilis. We then ran the digest in a gel and did a gel extraction to isolate the part of the vector that we needed.
 +
In order to add in the BioBrick prefix and suffix to the vector, we designed a linker that was synthesized as two separate oligos. The DNA sequence of the two oligos are as follows:
-
-Digest pUB110 w/ NdeI and AflII--> gel purify-->nanodrop for concentration
+
5' attcgtcttaaggaattcgcggccgcttctagagtactagtagcggccgctgcagcatatgtcatac 3'
 +
5' gtatgacatatgctgcagcggccgctactagtactctagaagcggccgcgaattccttaagacgaat 3'
-
-Digest pUB110 linker w/ NdeI and AflII
+
We annealed the two oligos in duplex buffer (recipe from IDT) to use the duplex as a linker. Once the oligos were annealed, the linker was digested with NdeI and AflII. We then set up an overnight ligation of the digested, gel purified pUB110 and digested pUB110 linker, which would ideally lead to the formation of a backbone compatible with BioBricks. Nonetheless, when we were unable to get any transformants with our modified vector. To make sure that we weren't doing anything wrong with the transformation procedure of B. subtilis, we tried to  transform the original pUB110. The transformation was successful, which led us to think that the problem may be with our modified vector. The failure of transformations could have been attributed to incomplete digestions, too little DNA retrieved from the gel extraction, or incomplete ligation. We attempted to address these potential problems by using new AflII and NdeI restriction enzymes with varying incubation times, different kits for gel extractions, and overnight ligations. Despite all our attempts, we did not successfully transformed B. subtilis with our modified backbone.
-
 
+
If our transformation of the modified pUB110 vector had worked, we would have picked transformants, grown them overnight to amplify the quantity of backbone DNA, and then  done a miniprep.
-
Linker sequence:
+
-
 
+
-
 
+
-
attcgtcttaaggaattcgcggccgcttctagagtactagtagcggccgctgcagcatatgtcatac
+
-
 
+
-
 
+
-
-Set up overnight ligation of digested, gel purified pUB110 and digested pUB110 linker = generates pUB110 backbone
+
-
 
+
-
 
+
-
-Transform into B. subtilis to amplify
+

Revision as of 21:33, 27 September 2013


Contents

Summer Plan

Construct pUB110 backbone

In order to express kerA in B. subtilis in high amounts, we need to use a high copy number plasmid. Since high copy number plasmids for B. subtilis are not available form the iGEM HQ, we decided to design our own. We derived our design from pUB110 because it has been widely used in B. subtilis. Pub110 b.jpg



Source: Boe, L. A. R. S., Gros, M. F., te Riele, H. E. I. N., Ehrlich, S. D., & Gruss, A. (1989). Replication origins of single-stranded-DNA plasmid pUB110. Journal of bacteriology, 171(6), 3366-3372.


In the image, M-O represents the origin replication that is recognized by B. subtilis, while ori+ is the origin of replication used by S. aureus. Because this vector includes EcoRI and XbaI sites, we had to find a way to remove them before we turned the vector into a BioBrick backbone. We chose to digest pUB110 with NdeI and AflII, which would remove the Pre gene along with the EcoRI and XbaI sites from the vector. However, this gene is not essential for replication in B. subtilis. We then ran the digest in a gel and did a gel extraction to isolate the part of the vector that we needed.

In order to add in the BioBrick prefix and suffix to the vector, we designed a linker that was synthesized as two separate oligos. The DNA sequence of the two oligos are as follows:


5' attcgtcttaaggaattcgcggccgcttctagagtactagtagcggccgctgcagcatatgtcatac 3' 5' gtatgacatatgctgcagcggccgctactagtactctagaagcggccgcgaattccttaagacgaat 3'


We annealed the two oligos in duplex buffer (recipe from IDT) to use the duplex as a linker. Once the oligos were annealed, the linker was digested with NdeI and AflII. We then set up an overnight ligation of the digested, gel purified pUB110 and digested pUB110 linker, which would ideally lead to the formation of a backbone compatible with BioBricks. Nonetheless, when we were unable to get any transformants with our modified vector. To make sure that we weren't doing anything wrong with the transformation procedure of B. subtilis, we tried to transform the original pUB110. The transformation was successful, which led us to think that the problem may be with our modified vector. The failure of transformations could have been attributed to incomplete digestions, too little DNA retrieved from the gel extraction, or incomplete ligation. We attempted to address these potential problems by using new AflII and NdeI restriction enzymes with varying incubation times, different kits for gel extractions, and overnight ligations. Despite all our attempts, we did not successfully transformed B. subtilis with our modified backbone.

If our transformation of the modified pUB110 vector had worked, we would have picked transformants, grown them overnight to amplify the quantity of backbone DNA, and then done a miniprep.


-Set up O. N. cultures


-Do B. subtilis miniprep


-Digest our pUB110 BioBrick


To test pUB110 backbone, which is kanamycin resistant, send for sequencing


-Put an upstream BioBrick (in vector with chloramphenicol resistance) + RFP BioBrick in an amp resistant backbone by doing 3 step assembly


-RFP expression from our modified pUB110 backbone would test if the backbone has all components needed for expression in B. subtilis


-Do transformation in B. subtilis


-Choose transformants--> if transformants express RFP, we could conclude our modified pUB110 backbone works--> submit pUB110 backbone to iGEM HQ

Construct kerA BioBrick

-Do Gibson assembly to put together the two kerA gBlocks from IDT


-Put our kerA biobrick into a backbone w/ amp resistance (so we can use the 3 step assembly) and transform into DH5-a


-Since promoter/upstream biobrick will be in chloramphenicol resistant vector and our puB110 vector will use kanamycin resistance, we will put the kerA biobrick in an amp resistant backbone


Orange: prefix


Green: suffix


Purple: kerA signal peptide


KerA variant A.jpg

KerA variant B.jpg

KerA variant C.jpg


Do the following 3 step assemblies:

For E. coli BL21-De3


- Constitutive expression cassette (BBa_K314100: plate 1, well 1G chloramphenicol res vector) + KerA variant C (in amp res vector) + kan res biobrick backbone


- Lac induced expression cassette (BBa_K314103: plate 1, well 4D chloramphenicol res vector) + KerA variant C (in amp res vector) + kan res biobrick backbone



For B. subtilis


- Constitutive promoter Pveg +RBS spoVG + SacB (BBa_K541501:


plate 1, well 11E chloramphenicol res vector) + KerA variant C (in amp res vector) + kan res biobrick backbone


- Constitutive promoter Pveg + RBS spoVG (BBa_K143053: 2012 plate 3, well 20A kan and amp res vector) + KerA variant B (in chloramphenicol res vector) + kan res biobrick backbone


Pick transformants of each, do miniprep and send them for sequencing


Test keratinase expression and activity in E. coli BL21-De3 kerA transformants

Purchase commercially available keratinase A to compare activity to our keratinase Potential sources from which to purchase (since Sigma is backordered): http://www.biocat.com/products/PBL01.1.02-PR http://www.interchim.eu/reponse_cch.php?ref=520&manufacturer=0&search=keratinase&search2= http://www.interchim.fr/ft/J/JV4050.pdf http://www.proteosbiotech.com/pdfs/pure_keratinase_100_en.pdf http://www.proteosbiotech.com/index.php/en/reactivos-de-laboratorio-en/keratinasa/pure-100-keratinase-detail


Or purchase B. licheniformis PWD-1 strain.


Detect keratinase expression in cell lysate of E. coli BL21-De3 kerA transformants (constitutive and inducible) by western blot with antibody against his tag.


If expression is successful, do a cell lysis of E. coli BL21-De3 kerA transformants and test keratin azure assay.


Also, KerA could be isolated with nickel column (because kerA is his tagged).


Test keratinase expression and activity in B. subtilis kerA transformants

Grow B. subtilis kerA transformants on keratin plates (made with LB agar [nutrient rich] + keratin from DMSO dissolved feathers). Grow WT/non-transformed B. subtilis on keratin plate. Determine if there is any non-specific protease activity. If there is a clearing around the non-transformed B. subtilis controls, this is not a good way to determine keratinase expression. Compare the clearing of keratin plate accomplished by kerA transformants and WT/non-transformants. If possible, compare activity to B. licheniformis PWD-1 strain.


Grow B. subtilis kerA transformants and from a cell lysis, do western blot to detect kerA his tag expression. After growing B. subtilis kerA transformants O. N. (unsure for how long) in liquid medium (LB broth plus antibiotic), spin down cells and store supernatant/media. Do western blot on media to detect kerA-his secretion.


Also, test keratin azure assay on supernatant from O. N. culture to determine keratinase activity.


Improve KerA activity by mutagenesis

Use Taq polymerase to introduce mutations in kerA. Transform mutated kerA into B. subtilis and plate on keratin plates. Detect clearing area around transformants. Do keratin azure assay.