94℃　　　2min
↓
98℃　　　10sec
49℃　　　30sec	35cycles
72℃　　　2min
↓
72℃　　　2min

TA cloning of CelC

16℃ 30min incubate

Ligation of CelC/pMD20 and Transformation in JM109.

Cells were stored on ice for 30min.

After 42℃ 30sec heat shock, cells were stored on ice for 2min.

Then cells were pre-cultured at 37℃ for 1hr, plated to Ampicillin plate.

6/1 Liquid clluture

CelC/pMD20 22 samples at 37°C, for overnight.

6/2 MiniPrep of CelC

Front

Fw1 Primer:

TATATATTCTAGATGAAGAGCGGGATTTCG

Rv2 Primer:

CATTATATCCGAACTCCGGCTG

Rear

Fw2 Primer:

AGCCGGAGTTCGGATATAATGC

Rv1 Primer:

CAGCACGAACTAGTATTATTATCATCGGC

7/19 Gel Purification of CelC gene’s Front Fragment and Rear Fragment

Front Fragment DNA and Rear Fragment DNA that 765bp and 347bp band performed Gel Purification by illustra GFX PCR Purification Kit.

7/21 CelC gene’s Front Fragment and Rear Fragment Overlap PCR

No.6,7,8,9,14 each fragment Overlap PCR completed.

I selected No.8.

7/22 Gel Purification of CelC gene No.8

No.8 DNA that about 1ooo bp band performed Gel Purification by illustra GFX PCR Purification Kit.

8/1 Adapter PCR of CelC gene No.8 (BioBrick Part)

Fw Primer:GTTTCTTCGAATTCGCGGCCGCTTCTAGATG

Rv Primer:GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTATC

8/11 BioBrick of CelC Restrict Enzyme ,EcoRI.

I confirmed BioBrick of CelC non-Restriction Enzyme ,EcoRI.

9/5 Brick Part of CelC and pSB1C3 Restrict Enzyme,EcoRI and PstI.

9/5 Ligation of CelC/pSB1C3 and Transformation in JM109.

9/7 Colony PCR of CelC/pSB1C3

CelC/pSB1C3 DNA(VR-VF2) :1370bp. So,No.5 and No.12 probably picked up CelC/pSB1C3

9/8 Miniprep of CelC/pSB1C3

Linear CelC/pSB1C3 DNA :3126bp. This CelC/pSB1C3 sample is cccDNA. So,No.5 and No.12 probably picked up CelC/pSB1C3.

9/15. Sequence of CelC Brick Part sequence.

Result of NCBI BLAST

CrdS

Cloning of CrdS and Restriction Enzyme

By Koki Tsutsumi

CrdS gene had produced clone from Agrobacterium tumefaciens C58, but I confirmed whether it’s true or not. CrdS gene has restriction enzyme sites,EcoRI and PstI.

Inverse PCR

CrdS_Fw: AGTACGATCCGCTATTTTCCCG

CrdS_Rv: CAGACCAAGATTTCGCGAACTC

---

94℃ 2min

↓

98℃ 10sec

48℃ 30sec    35cycles

72℃ 2min

↓

72℃ 2min

---

TA cloning of CrdS

16℃ 30min incubate

Ligation of CrdS/pMD20 and Transformation in JM109

↓Cells were stored on ice for 30min.

↓After 42℃ 30sec heat shock, cells were stored on ice for 2min.

↓Then cells were pre-cultured at 37℃ for 1hr, plated to Ampicillin plate.

Liquid culluture

CrdS/pMD20 21 samples at 37℃,for overnight

MiniPrep of CrdS/pMD20

Linear CrdS/pMD20 DNA :4995bp. This CrdS/pMD20 sample is cccDNA. So, probably picked up CrdS/pMD20.

Restriction Enzyme of CrdS/pMD20

CrdS gene had produced clone from Agrobacterium tumefaciens C58, I confirmed whether it’s true or not. CrdS/pMD20 gene has 2 restriction enzyme sites,EcoRI.

I comfirmed the direction of CrdS gene.

Sequence of CrdS/pMD20

PointMutation of CrdS

CrdS gene had Restriction Enzyme Site,EcoRI. We removed the EcoRI site.

---

94℃ 2min

↓

98℃ 10sec

55℃ 5sec      35cycles

72℃ 70sec

↓

4℃ ∞

---

Gel Purification of CrdS gene’s Front Fragment and Rear Fragment

Front Fragment DNA and Rear Fragment DNA ,Middle Fragment DNA that 223 bp and 1037 bp ,782 bp band performed Gel Purification by illustra GFX PCR Purification Kit.

CrdS gene’s Front Fragment and Rear Fragment Overlap PCR

N, No.6, No.15 each fragment Overlap PCR completed.

Gel Purification of CrdS

No.8 DNA that about 2ooo bp band performed Gel Purification by illustra GFX PCR Purification Kit.

Adapter PCR of CrdS gene (BioBrick Part)

Fw Primer: GTTTCTTCGAATTCGCGGCCGCTTCTAGATG

Rv Primer: GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTATC

Brick Part of CrdS Restrict Enzyme,EcoRI and PstI.

N,No.6,No.15 of CrdS was cut on EcoRI site. Point Mutation of CrdS is unsuccessful.