Reporter genes

One of the most fundamental parts required in a new chassi is a reporter gene. Unfortunately, some fluorescent proteins do not work well in Lactobacillus, possibly due to lower levels of internal pH in the cytosol.

One popular fluorescent protein that do work is mCherry. We have created a biobricked version of mCherry codon optimized for Lactobacillus reuteri, however it should work well in most species in the Lactobacillus genus. The gene has been modified in accordance with the Freiburgh fusion standard 25.

Prefix

gaattccgcggccgcttctagatggccggc...

Suffix

... accggttaatactagtagcggccgctgcag

Chromoproteins in Lactobacillus

There are many things we take for granted when working with bacteria such as E. coli. An initial problem when learning to work with Lactobacillus is to simply be able to do successful transformations of plasmids, some that is far more difficult and cumbersome to do compared to E. coli. To see if you have been able to master a transformation with Lactobacillus some basic reporter genes that are visibly coloured to the naked eye makes the validation process a lot easier.

Above is a picture of one of our chromo proteins and RBS fused together with two of our synthetic promoters, CP11(lank ) and CP29(lank). These are characterised and has been shown to work both in E. coli and Lactobacillus. We wanted to see if our chromo proteins could work as visual reporters. The construct has been shown to work fine with our shuttle vector in E. coli as can clearly be seen in the picture with blue bacterial colonies. We have however not yet been able to transform it into Lactobacillus.