Team:Heidelberg/Templates/DelH week7

From 2013.igem.org

(Difference between revisions)
Fanny (Talk | contribs)
(Created page with " == 10-06 - 16-06-13 == === Characterization of DelH plasmid of 02-06 === {| class="wikitable" style="float:left; margin-right:1em" |- ! Template !! 15 x 1 µl of ligated plasmid...")
Newer edit →

Revision as of 19:58, 1 October 2013

Contents

10-06 - 16-06-13

Characterization of DelH plasmid of 02-06

Template 15 x 1 µl of ligated plasmid
Expected length [bp] 663
Named 1-15
Primer fw 100 µM 15 x 0.2 µl VF2
Primer rev 100 µM 15 x 0.2 µl DN07
Dream-Taq Polymerase (2x) 15 x 10 µl
ddH2O 15 x 8.6 µl
Cycles Temperature [°C] Time [s]
1 94 180
12 94 20
66 (touchdown -0.5°C) 20
72 45
18 94 20
62 20
72 45
1 72 5 min
1 4 inf

Re-PCR of DelH fragment F1a & F1b

Result

Expected band: 5 Kb.

File:20130610 2log F1a F1b-RE-PCRs.png
Fig.7.1 Gel of Re-PCR of DelH-F1a and DelH-F1b (loaded 20 µL)
l1 2 log ladder, l2F1a, l3 F1b
no specific band at expected 5 Kb

There are no specific bands at 5 Kb.

=> We therefore failed to reamplify DelH F1a and F1b from the PCR product.
=> Additionally, in the elctroporated colonies, there is no fragment F1a and F1b.
=> We need to design new forward primers for DelH F1a & F1b.


Amplification of DelH F1a

New Primers

Identifier Order date Note Sequence
DN09:DelH_f1_fw_long 2013-06-11 Amplification of DelH F1a from the genome: doesn't work ATGGACCGTGGCCGCCTGCGCCAAATCG
DN10:DelH_f1_fw_short 2013-06-11 Amplification of DelH F1a from the genome: doesn't work ATGGACCGTGGCCGCCTGC
DN11:DelH_f1_fw_short2 2013-06-11 Amplification of DelH F1a from the genome: works!!!! GCCGCCTGCGCCAAATCG
DN12:DelH_f1_PacI_fw_short 2013-06-11 Amplification of DelH F1a from the genome: doesn't work ttttttaattaatcacacaggaaagtactagATGGACCGTGGCCGCCTGC


PCR Conditions F1a.W7.A

Reagent DelH_f1_fw_long DelH_f1_fw_short DelH_f1_fw_short2 DelH_f1_PacI_fw_short
Expected length [bp] 5 Kb 5 Kb 5 Kb 5 Kb
Template 1 µl D. acidovorans glycerol stock 1 µl D. acidovorans glycerol stock 1 µl D. acidovorans glycerol stock 1 µl D. acidovorans glycerol stock
Primer 10 µM fw 2.5 µl DelH_f1_fw_long 2.5 µl DelH_f1_fw_short 2.5 µl DelH_f1_fw_short2 2.5 µl DelH_f1_PacI_fw_short
Primer 10 µM rev 1 µl DelH_EcoRI_rev 1 µl DelH_EcoRI_rev 1 µl DelH_EcoRI_rev 1 µl DelH_EcoRI_rev
Phusion Master Mix (2x) 25 µl 25 µl 25 µl 25 µl
ddH2O 19 µl 19 µl 19 µl 19 µl

Because the annealing temperature of DelH_f1_fw_long is 77,4°C and of the primer DelH_EcoRI_rev is 69,6°C, a 2-step PCR was performed.

Cycles Temperature DelH_f1_fw_long [°C] Time [s] Cycles Temperature else [°C] Time [s]
1 98 30 1 98 30
30 98 5 30 98 5
- - 66 5
72 2:15 min 72 2:15 min
1 72 7 min 1 72 7:00 min
1 4 inf 1 4 inf
  • Using hot start at 98°C

Result

Expected band: 5 Kb

File:15.06.IGEM-DelH-fragment1a.png
Fig.7.2 Gel of amplified DelH-1a fragment with different fw primern (loaded 20 µL)
l1 2 log ladder, l2F1a, l3 F1a
l2 DelH-1a fragment shows a specific band ~ 5 Kb

There is a specific band at 5 Kb for DN11. The other primers show only unspecific products.

=>The DN11 primer will be used. Using PCR conditions F1a.W7.A and short2 primer, the PCR was repeated to produce more product.


Retrieved from "http://2013.igem.org/Team:Heidelberg/Templates/DelH_week7"