"
Team:Heidelberg/Templates/DelH overview13
From 2013.igem.org
(Difference between revisions)
Fanny (Talk | contribs)
(Created page with "===Vector Map and Primers=== pHM03:DelH-pSB6A1-lacZ-mRFP Gibson plasmid.]] {| class="wikit...")
Newer edit →
(Created page with "===Vector Map and Primers=== pHM03:DelH-pSB6A1-lacZ-mRFP Gibson plasmid.]] {| class="wikit...")
Newer edit →
Revision as of 22:52, 1 October 2013
Vector Map and Primers
File:Construct-plasmid.svg
Vector map of the File:PSB6A1+DelH.gb.
| Identifier | Order date | Note | Sequence |
|---|---|---|---|
| HM_11:lacI_RBS(1)_DelH_rev | 22-07-2013 | Amplification of Backbone pSb6A1-lacZ-mRFP | TCGGCGATTTGGCGCAGGCGGCCACGGTCCAT ctagtatttctcctctttctctagtatgtgtg |
| HM_12:DelH_RBS(1.2)_mRFP_fw | 22-07-2013 | Amplification of Backbone pSb6A1-lacZ-mRFP | ATTGGCGCTGGAGTACGCGCTGGACTGA tcaaagtATTAAAGAGGAGAAagttaaat ggcttcctccgaagacgttatcaAagag |
