"
Team:Heidelberg/Templates/DelH overview1
From 2013.igem.org
(Difference between revisions)
(→Restriction Digest and Ligation Strategy) |
(→Restriction Digest and Ligation Strategy) |
||
| Line 1: | Line 1: | ||
=== Restriction Digest and Ligation Strategy === | === Restriction Digest and Ligation Strategy === | ||
| - | [[File: | + | [[File:Heidelberg_Del Cluster.png|300px|right|thumb|Schematic representation of DelH cluster and structure of delftibactin.]] |
* PCR amplification of the 18 Kb DelH fragment as sub fragments F1 (10 Kb) and F2 (8 Kb) | * PCR amplification of the 18 Kb DelH fragment as sub fragments F1 (10 Kb) and F2 (8 Kb) | ||
* Assembly of backbone pSB6A1-Arac-lacZ by PCR amplification of fragments from BioBricks | * Assembly of backbone pSB6A1-Arac-lacZ by PCR amplification of fragments from BioBricks | ||
Revision as of 09:05, 2 October 2013
Restriction Digest and Ligation Strategy
- PCR amplification of the 18 Kb DelH fragment as sub fragments F1 (10 Kb) and F2 (8 Kb)
- Assembly of backbone pSB6A1-Arac-lacZ by PCR amplification of fragments from BioBricks
- Ligation of the construct DelH F1 + DelH F2 + backbone pSB6A1-Arac-lacZ
- Transformation of E. coli TOP10 with DelH plasmid
- Characterization of positive (blue) colonies by colony PCR
Vector Maps, Primers and BioBricks
File:Res-DelH-finalplasmid.svg
Vector map of the pHM01:DelH plasmid.
| Backbone | Part | Distribution | Plate | Well | Usage | Resistance |
|---|---|---|---|---|---|---|
| pSB4K5 | J04450 | Spring 2012 | 1 | 5G | Backbone for DelA-G,OP,L | Kanamycin |
| pSB1AK3 | I732019 | Spring 2012 | 4 | 12G | lacZ reporter gene | Kanamycin, Ampicillin |
| pSB2K3 | I0500 | Spring 2012 | 1 | 14N | AraC promoter | Kanamycin |
| pSB6A1 | J04450 | Spring 2012 | 1 | 1K | Backbone for DelH | Ampicillin |
| pSB1C3 | J04450 | Spring 2012 | 1 | 3A | Backbone for Indigoidine | Chloramphenicol |
| Identifier | Order date | Note | Sequence |
|---|---|---|---|
| DN01:DelH_f1_PacI_fw | 03-05-2013 | Amplification of DelH F1, with RBS and adding PacI restriction site | tttt ttaattaa tcacacaggaaagtactag ATGGACCGTGGCCGCCTGC GCCAAATCG |
| DN02:DelH_f1_SalI_rev | 03-05-2013 | Amplification of DelH F1 until SalI | tttt GTCGACCAACACCTGTGCCTGC |
| DN03:DelH_f2_SalI_fw | 03-05-2013 | Amplification of DelH F2 starting SalI | tttt GTCGACTGGATGGAGCCTGGTGAAAG |
| DN04:DelH_f2_KpnI_rev | 03-05-2013 | Amplification of DelH F2, adding KpnII restriction site | tttt ggtacc TCAGTCCAGCGCGTACTCCAG |
| DN05:AraCbb_KpnI_fw | 03-05-2013 | Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site | tttt ggtacc aaagaggagaaatactagatgaccatg |
| DN08:AraCbb_PacI_rev | 03-05-2013 | Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site | tttt ttaattaa gctagcccaaaaaaacgggtatg |
