"
Team:Heidelberg/Templates/DelH overview11
From 2013.igem.org
(Difference between revisions)
| Line 1: | Line 1: | ||
| + | |||
=== Gibson Strategy=== | === Gibson Strategy=== | ||
* PCR amplification of entire 18 Kb DelH fragment G0, as well as sub fragments G1a and G1b | * PCR amplification of entire 18 Kb DelH fragment G0, as well as sub fragments G1a and G1b | ||
Revision as of 09:32, 2 October 2013
Gibson Strategy
- PCR amplification of entire 18 Kb DelH fragment G0, as well as sub fragments G1a and G1b
- PCR amplification of backbone pSB6A1-lacI-mRFP, simultaneously inserting Gibson
- Gibson assembly of construct DelH + backbone to DelH plasmid
- Electroporation of E. coli TOP10 with DelH plasmid
- Characterization of positive (red) colonies by colony PCR
Vector Map and Primers
File:Heidelberg FinalPlasmid.svg
Vector map of the pHM02:DelH-pSB6A1-AraC-lacZ Gibson-plasmid.
| Identifier | Order Date | Note | Sequence |
|---|---|---|---|
| HM02_DelH_Gib1.1_rev | 09-07-2013 | Gibson-Primer DelH | TGCTGCGCCTGCATACGGCCAAACA |
| HM03_DelH_Gib1.2_fw | 09-07-2013 | Gibson-Primer DelH | AGCGGCAGGGACGACGTGGT |
| HM04_DelH_Gib1.2_rev | 09-07-2013 | Gibson-Primer DelH | CATAGAGGTTGTAGAGA |
| HM05_DelH_Gib2.1_fw | 09-07-2013 | Gibson-Primer DelH | AGAACGCCGTCTTCAGGCTCCTG |
| HM06_DelH_Gib2.1_rev | 09-07-2013 | Gibson-Primer DelH | CAATGCTTTG CCGCTCGAA |
| HM07_DelH_Gib2.2_fw | 09-07-2013 | Gibson-Primer DelH | TCGCCACGGCAGCTGTTCGA |
| HM08_DelH_Gib2_end_rev | 09-07-2013 | Gibson-Primer DelH | TCAGTCCAGCGCGTACTCCAG |
| HM09_AraC_RBS_DelH_rev | 09-07-2013 | Gibson-Primer rev, introduces a new RBS and has the AraC promotor and the beginning of DelH | TTGCAAAGCGCTCGGCGATTTGGCGCAGGCGGCCACGGTCCAT ttaactTTCTCCTCTTTAATactttgagctagcccaaAaaaacggtatggagaa acagtagagagtt |
| HM10_RBS_lacZ | 09-07-2013 | Gibson-Primer fw for the pSB6A1 Backbone with the end of DelH, RBS(1) and the beginning of lacZ | TGGAGTACGCGCTGGACTGA TCTAGAG AAAGAGGAGAAA TACTAG ATGACCATGATTA |
