"
Team:Heidelberg/Templates/DelH overview18
From 2013.igem.org
(Difference between revisions)
(Created page with "===Vector Map, Primers and BioBricks=== [[File:PHM05-DelH-tetR-pSB6A1.png|300px|left|thumb|Vector map of the [[:File:PHM05-DelH-tetR-pSB6A1.gb|PHM05-DelH-tetR-pSB6A1 Gibson plasm...") |
|||
| Line 1: | Line 1: | ||
===Vector Map, Primers and BioBricks=== | ===Vector Map, Primers and BioBricks=== | ||
| - | [[File: | + | [[File:Heidelberg_PHM05-DelH-tetR-pSB6A1.png|300px|left|thumb|Vector map of the [[:File:Heidelberg_PHM05-DelH-tetR-pSB6A1.gb|PHM05-DelH-tetR-pSB6A1 Gibson plasmid]].]] |
{| class="wikitable" | {| class="wikitable" | ||
|- | |- | ||
Revision as of 09:37, 2 October 2013
Vector Map, Primers and BioBricks
| Backbone | Part | Distribution | Plate | Well | Usage | Resistance |
|---|---|---|---|---|---|---|
| pSB1T3 | J04450 | Spring 2013 | 2 | 2B | Backbone to amplify the tetracycline-resistance | Tetracycline |
| pSB6A1 | J04450 | Spring 2012 | 1 | 1K | Backbone for DelH | Ampicillin |
| Identifier | Order date | Note | Sequence |
|---|---|---|---|
| HM14:DelH_tetR_fw | 2013-08-16 | Gibson-Primer DelH-tetR: amplifies the tetracycline resistance from the pSB1T3 Backbone and creates an overlap to the end of DelH | ATTGGCGCTGGAGTACGCGCTGGACTGA atgaagttttaaatcaatctaaag |
| HM15:tetR_stop_BB_rev | 2013-08-16 | Gibson-Primer tetR-pSB6A1: amplifies the tetracycline resistance and creates an overlap with the Terminator of the Backbone pSB6A1 | Cgactgagcctttcgttttatttgatgcctggc ctcgtgatacgcctatttttatagg |
| HM16:tetR_pSB6A1_fw | 2013-08-16 | Gibson-Primer DelH, amplifies the Backbone pSB6A1 creating an overlap with the tetracycline resistance | Aaaaataggcgtatcacgag gccaggcatcaaataaaacgaaaggctcag |
| FS_66: DelH_rv | 2013-08-26 | Amplification of DelH from Delftia acidovorans Gibson Primer | TGGGCATTCACCGCATCGATC |
| FS_67: DelH_fw | 2013-08-26 | Amplification of DelH from Delftia acidovorans Gibson Primer | CTTCACGTTGATTGCGCATG |
| FS_68: DelH_rv | 2013-08-26 | Amplification of DelH from Delftia acidovorans Gibson Primer | CAGAAGAACTCCCAGACCGAC |
| FS_69: DelH_fw | 2013-08-26 | Amplification of DelH from Delftia acidovorans Gibson Primer | GACACCGTTCAGCTTCGATG |
| FS_70: DelH_rv | 2013-08-26 | Amplification of DelH from Delftia acidovorans Gibson Primer | GAAGCTGCTCCGCTGATAGAT |
| FS_71: DelH_fw | 2013-08-26 | Amplification of DelH from Delftia acidovorans Gibson Primer | ATGTGCTGTCGCTCAAGATG |
| FS_72_SR_02_fw | 2013-08-30 | Screening of pHM04 | ATGTGCTGTCGCTCAAGATG |
| FS_73_SR_03_fw | 2013-08-30 | Screening of pHM04 | GTGCTGTTTGGCCGTATG |
| FS_74_SR_04_fw | 2013-08-30 | Screening of pHM04 | ATCAGGTGCTGAGCTACGAC |
| FS_75_SR_05_fw | 2013-08-30 | Screening of pHM04 | CTGTTCATCAACACCTTGCC |
| FS_76_SR_06_rv | 2013-08-30 | Screening of pHM04 | GAAGACAGTCATAAGTGCGGC |
