Mixed waste is one of the major challenges facing waste management as the materials cannot be recovered by recycling processes dedicated to individual materials. As a result the resources in the many products made of mixed materials and others that are mixed during disposal are not properly utilised. We wanted to create a way to recover these materials and produce something useful and valuable from them. We have designed this module to leverage the ability for organisms to work together to carry out complex tasks; in this case breaking down a common mixed waste to release the valuable platform chemical ethylene glycol and turn the remaining material into the bioplastic poly-3-hydroxybutyrate.

The mixed waste we have chosen is produced in recycling centres as a byproduct of the separation of valuable items from commercial and industrial waste. It is currently disposed of by incineration, causing harm to the environment and human health. It also wastes the resources present, many of which are non-renewable. We are upcycling this waste into new commodities.

To do this we will break down the petrochemical polyurethane to recoup the valuable and finite feedstocks which produced it. We have chosen to break down polyurethane as we want to expand the range of major petrochemical plastics that can be broken down by the parts registry so that novel functions which require these abilities can be pursued with biobricks.

In order to do this we will secrete polyurethane degrading enzymes, often called PUR esterases, which have the ability to break polyurethane down. These genes are found naturally in organisms which must degrade tough substrates, particularly lignin. This makes them useful in breaking down plastics as these too are resistant polymers. We have tested five of these PUR esterases to find the most effective. The product of polyurethane breakdown, ethylene glycol is toxic and we have modeled the maximum rate of degradation which will still allow E.coli MG1655 to survive and continue to produce esterases. This is significant for whether this technique could be used to produce industrially relevant levels. Our bacteria have expressed an active PUR esterase, EstCS2 and we are working on having it secreted.

After the oil derived plastics are removed from the mixed waste there is energy rich organic matter left over. This is what the bacteria will feed on to produce the bioplastic P3HB. P3HB is produced inside the cells of bacteria containing the phaCAB operon which is found in Ralstonis eutropha and other soil living bacteria. The ability of some bacteria to produce poly hydroxyalkanoates (the family of polyesters of which P3HB is a member) has been known since the 1920's. P3HB is produced industrially inside bacteria grown with sucrose and other sugars from crops such as corn. Life cycle analyses of P3HB indicate it has superior environmental qualities compared to petrochemical plastics(1,2). Using the organic component in waste from mixed recycling facilities has been theoretically analysed and indicates an energy and carbon cost half that of producing P3HB from biomass(3)

We transformed E.coli with phaCAB and produced P3HB when grown on mixed waste. P3HB is currently expensive in comparison to oil derive plastics with the choice of substrate having a large impact upon the cost. Another important factor is the yield of P3HB which can be produced with higher yields making the process more economically feasible. The model we produced suggested we could increase the level of P3HB by upregulating the limiting enzyme within the operon, phaB. We then implemented this in the lab by placing testing the operon with two strong constitutive promoters; one of our own design and also J23104 from the registry. This resulted in a ten fold increase in P3HB production when compared with the native operon and has vastly improved the part. We then used this data to improve the accuracy of model. This also allowed us to compare the amount of P3HB production to that currently produced industrially.

E.coli grow well on the mixed waste without any additional carbon source and produced P3HB while growing on it. We confirmed the identity of the P3HB we produced by incubating the material we produced with Phaz1, the extracellular P3HB depolymerase expressed in the next module. 3-HB was detected as the product of this with a 3-HB detection kit.

1. Harding KG, Dennis JS, von Blottnitz H, Harrison STL. Environmental analysis of plastic production processes: Comparing petroleum-based polypropylene and polyethylene with biologically-based poly-beta-hydroxybutyric acid using life cycle analysis. J Biotechnol 2007 MAY 31;130(1):57-66.
2. Kim S, Dale BE. Energy and Greenhouse Gas Profiles of Polyhydroxybutyrates Derived from Corn Grain: A Life Cycle Perspective. Environ Sci Technol 2008 OCT 15;42(20):7690-7695.
3. Kendall A. A life cycle assessment of biopolymer production from material recovery facility residuals. Resources, Conservation and Recycling 61 (2012) 69– 74
conomou A. Following the leader: bacterial protein export through the Sec pathway. Trends in microbiology 1999;7(8) 315-320.

Specification

1. The bacteria should survive and grow in mixed waste

In order for the bacteria to produce bioplastic from the mixed waste they first need to be able to use it as a carbon source

2. The bacteria should secrete a functional polyurethane esterase

To recover the resources from polyurethane in the mixed waste, the enzymes should secrete in an active form.

3. Our Bacteria should be able to tolerate mixed waste degradation products, such as Ethylene Glycol

The products of Polyurethane degradation are toxic and so any bacteria growing with them must be able to survive to a concentration which will allow economical production of ethylene glycol. We have chosen a strain of E.coli-MG1655, which is resistant to ethylene glycol toxicity.

4. The bacteria should produce P3HB

5. The bacteria should produce P3HB from the mixed waste

Design

Petrochemical Plastic degradation

It is known from previous research that some lignin degrading microbial enzymes to be so tough that they can even deal with more difficult polymers: plastics. Some previous iGEM teams have exploited this and worked on enzymatic degradation of various kinds of plastic. We would like to build on this work and extend the plastic degradation capabilities of the synthetic biology community by improving PUR degradation in particular as this has not been successfully achieved before. We have identified 5 PUR-esterase enzymes from the literature that are capable of catalyzing the below reaction.

BioBrick Designs

Bioplastic Synthesis

Poly-3-hydroxybutyrate(P3HB) is a bioplastic which is naturally produced inside bacteria such as Ralstonia eutropha, where it accumulates as globules inside the cell. In its native bacteria it is produced as an energy store(1) but it is as a plastic that it interests researchers and industrialists.

We have made P3HB in E.coli, transferring three genes, naturally found in Ralstonia eutropha into E.coli MG1655. These encode the three enzymes necessary for P3HB production; polyhydroxyalkanoate synthase(phaC), 3-ketothiolase(phaA) and acetoacetyl coenzyme A reductase(phaB). These are encoded by the phaCAB operon. We have altered the expression of these three genes to maximise the production of P3HB as high yields are required for it to be economically viable.

Secretion

E.coli is commonly used as a chassis in innovative iGEM project that aim to prove the concept and make the case for a novel function in a biologically engineered machine. In our case, we aim to degrade and synthesise plastic and the degradation part of our system needs to be extracellular. There are not only such biotechnological but also many other reasons for the extracellular targeting of a protein: It can be a product with a medical function, like the [http://www.2009.igem.org/Team:METU-Gene/EGF_Transportation EGF hormone in a previous iGEM project] or be important in bioremediation such as in Dundee Team’s toximop system and much more. There are many strategies for secretion. On the following page, you can read about these and find out why we chose the pelB tag for all our degradation enzymes and how we improved the ESTCS2 esterase by changing the phoA outer-membrane anchoring tag in the original Biobrick to pelB. Our story will help you to choose a secretion strategy best suited to your project and also give you guidance with the technical details of using it.

Alternative strategies for protein secretion in E.coli:

N terminal secretion-signal peptides are recognised by the sec pathway . The pathway transports to the periplasm and additional mechanism are usually necessary to further export the protein to the extracellular space. An approach for using this pathway is the addition of an N terminal signal peptide to the target protein which can obtain as high as 90% efficiency in secretion to the extracellular space. Such signals are pelB and phoA tags which are available as biobricks. PelB can get cleaved off by pelB peptidase in the periplasm but phoA will anchor your protein to this localisation.

Fusion partners are endogenous proteins that naturally get secreted in E.coli and can be fused to the target protein. Some such proteins were demonstrated to be a powerful carriers of medically relevant human proteins in E.coli. The yebF and ompF proteins exit the cell via the sec pathway and use additional mechanism for leaving the periplasm where they interact with outer-membrane porins for extracellular secretion. The osmY is available as a Biobrick and we have submitted ompF this year.

The porin proteins such as ompF and ompA, can be used as fusion partners too and anchor proteins to the outer surface of E.coli.

ABC transporters use ATP for transport of specific proteins across the bacterial membrane. The ABC transporter of Erwinia chrysanthemi can be expressed in E.coli and export proteins that contain the LARD1 domain as a C terminal fusion. The system is biobricked in two separate plasmids (transporter, LARD1) with different antibiotic resistance and it is important to use both at the same time.

The [http://parts.igem.org/Protein_domains/Localization page] in the registry that lists localisation tags] is incomplete and contains eukaryotic and prokaryotic localisation signals mixed together. We have therefore put together the tables below for you to help choose an E.coli secretion strategy that is suitable for your project. </p>

Extracellular Secretion in E.coli:

Outer Membrane Anchors and Periplasmic Expression in E.coli:

Our choice is to use the pelB secretion tag as it has been demonstrated to work in many cases with sometimes as high as 90% transport efficiency. The pelB has been used in iGEM project for many years and is part of 50+ constructs. The UC-Davis team last year used it to secrete LC-Cutinase, a PET plastic degrading enzyme ( BBa_K936013) successfully which is somewhat similar to our plastic degradation enzymes.

Assembly methods and toolkit:

An advantage of the pelB is that it is relatively short (only 66 BP) and we could get our gene synthesised with the tag. A problem with standard biobrick assembly is that the scar site contains a STOP codon and therefore [http://parts.igem.org/Protein_domains alternative strategies are needed]. One of the ways around this is to use Infusion/Gibson assembly which we also had a go with and you can find instructions under our protocols section. We have constructed a biobrick where LARD1 is after a constitutive promoter and RBS in order to facilitate quicker cloning with less assembly steps, [http://parts.igem.org/Part:BBa_K1149021 BBa_K1149021].

Unfortunately, the pelB tag did not prove to be the best strategy for secreting our degradation enzymes in the MG1655 strain. Therefore, we are changing the strategy to use osmY.

References

1. Economou A. Following the leader: bacterial protein export through the Sec pathway. Trends in microbiology 1999;7(8) 315-320.
2. Thanassi DG, Hultgren SJ. Multiple pathways allow protein secretion across the bacterial outer membrane. Current opinion in cell biology 2000;12(4) 420-430.
3. Sletta H, Tondervik A, Hakvag S, Aune TEV, Nedal A, Aune R, et al. The presence of N-terminal secretion signal sequences leads to strong stimulation of the total expression levels of three tested medically important proteins during high-cell-density cultivations of E.coli. Applied and Environmental Microbiology 2007;73(3) 906-912.
4. Qian Z, Xia X, Choi JH, Lee SY. Proteome-based identification of fusion partner for high-level extracellular production of recombinant proteins in E.coli. Biotechnology and bioengineering 2008;101(3) 587-601.
5. Prehna G, Zhang G, Gong X, Duszyk M, Okon M, McIntosh LP, et al. A Protein Export Pathway Involving Escherichia coil Porins. Structure 2012;20(7) 1154-1166.
6. Binet R, Letoffe S, Ghigo JM, Delepelaire P, Wandersman C. Protein secretion by Gram-negative bacterial ABC exporters - A review. Gene 1997;192(1) 7-11.
7. Chung CW, You J, Kim K, Moon Y, Kim H, Ahn JH. Export of recombinant proteins in E.coli using ABC transporter with an attached lipase ABC transporter recognition domain (LARD). Microbial Cell Factories 2009;8 11.
8. Francetic O, Pugsley AP. Towards the identification of type II secretion signals in a nonacylated variant of pullulanase from Klebsiella oxytoca. Journal of Bacteriology 2005;187(20) 7045-7055.
9. Fu LL, Xu ZR, Li WF, Shuai JB, Lu P, hu CXH. Protein secretion pathways in Bacillus subtilis: Implication for optimization of heterologous protein secretion. Biotechnology Advances 2007;25(1) 1-12.
10. Cho HY, Yukawa H, Inui M, Doi RH, Wong SL. Production of minicellulosomes from Clostridium cellulovorans in Bacillus subtilis WB800. Applied and Environmental Microbiology 2004;70(9) 5704-5707.
11. Zhang XZ, Cui ZL, Hong Q, Li SP. High-level expression and secretion of methyl parathion hydrolase in Bacillus subtilis WB800. Applied and Environmental Microbiology 2005;71(7) 4101-4103.

Tolerance to waste

We chose the MG1655 E.coli strain as chassis because it constitutively expresses genes that make it resistant to the potentially toxic molecule. The [http://parts.igem.org/Part:BBa_K892010 AldA] and [http://parts.igem.org/Part:BBa_K892009 FucO] genes have an important role in decreasing the toxic effects of Ethylene-glycol by converting it into Glycolaldehyde which is a link to the cell`s central metabloism. We have received these genes from the registry and future work could be to express these in Bacillus or cellulose degrading organisms to make them tolerant as well.

PHB synthesis Design

We will first use the phaCAB biobrick [http://parts.igem.org/Part:BBa_K934001 BBa_K934001] to produce P3HB. Our aim is the industrial production of P3HB and this require high yields to be economically viable. The results from the metabolic model suggest that to do this the amount of phaB should be increased. To do this we designed constructs with stronger promoters to upregulate the expression of the operon.

The operon was original under the native promoter from Ralstonia eutropha. We designed two promoters to increase transcription. The first uses the constitutive promoter [http://parts.igem.org/Part:BBa_J23104 J23104]. The second was designed as a hybrid promoter incorporating BBa_J23104 and the original promoter due to recent results of high expression from a hybrid promoter[http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0056321].

Safety

Bacteria strains

We used E. coli K-12 strains MG1655, NEB 10 beta, NEB 5 alpha and TOP10 (similar to E. coli K-12 DH 10 beta that fall under Risk Group 1 for the experiments, but eventually only MG1655 strain will be used in the bioreactors. This strain rarely survives outside laboratories, although minor symptoms may show if infected. Meanwhile, the parts we designed are specialised for degrading PUR and they should not harm human health.

Chemical reagents

Some of the reagents we used were slightly toxic to human. In order to reduce the risks of using toxic reagents, we always wear gloves and labcoats. For some toxic reagents, we performed in fume cupboard. Click on the reagents to see the MSDS.

1. [http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?country=GB&language=en&productNumber=W222305&brand=ALDRICH&PageToGoToURL=http%3A%2F%2Fwww.sigmaaldrich.com%2Fcatalog%2Fproduct%2Faldrich%2Fw222305%3Flang%3Den Tributyrin]

2. [http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?country=GB&language=en&productNumber=458392&brand=ALDRICH&PageToGoToURL=http%3A%2F%2Fwww.sigmaaldrich.com%2Fcatalog%2Fproduct%2Faldrich%2F458392%3Flang%3Den Poly(diethylene glycol adipate)].

3. [http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?country=GB&language=en&productNumber=19123&brand=SIGMA&PageToGoToURL=http%3A%2F%2Fwww.sigmaaldrich.com%2Fcatalog%2Fproduct%2Fsigma%2F19123%3Flang%3Den Nile red].

4. [http://www.sigmaaldrich.com/MSDS/MSDS/PleaseWaitMSDSPage.do?language=&country=GB&brand=SIGMA&productNumber=A3256&PageToGoToURL=http://www.sigmaaldrich.com/catalog/product/sigma/a3256?lang=en&region=GB Arabinose].

5. [http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?country=GB&language=en&productNumber=N9876&brand=SIGMA&PageToGoToURL=http%3A%2F%2Fwww.sigmaaldrich.com%2Fcatalog%2Fproduct%2Fsigma%2Fn9876%3Flang%3Den 4-Nitrophenyl butyrate].

6. [http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?country=GB&language=en&productNumber=N8130&brand=SIGMA&PageToGoToURL=http%3A%2F%2Fwww.sigmaaldrich.com%2Fcatalog%2Fproduct%2Fsigma%2Fn8130%3Flang%3Den 4-Nitrophenyl acetate].

7. [http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?country=GB&language=en&productNumber=S8511&brand=SIGMA&PageToGoToURL=http%3A%2F%2Fwww.sigmaaldrich.com%2Fcatalog%2Fproduct%2Fsigma%2Fs8511%3Flang%3Den N-Succinyl-Ala-Ala-Pro-Leu p-nitroanilide].

8. [http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?country=GB&language=en&productNumber=L3126&brand=SIGMA&PageToGoToURL=http%3A%2F%2Fwww.sigmaaldrich.com%2Fcatalog%2Fproduct%2Fsigma%2Fl3126%3Flang%3Den Lipase from porcine pancreas].

Bioreactor safety

We have come up with a few strategies to prevent release of our bacteria into the environment. Firstly, the bioreactor containing bacteria will have a kill switch that kills bacteria if the bioreactor is opened when operating. We also lyse the cells at the end of reactions to harvest our product P3HB, ensuring that no living bacteria escape the bioreactors.

1 P(3HB) synthesis

This section is about modelling the plastic-synthesising E.coli developed in our project. The plastic that this module synthesises is the bioplastic poly-3-hydroxybutyrate, also known as P(3HB). The content below shows the process of building, designing and optimisation of the model. Also, the considerations, assumptions and limitations will be discussed.

1.3 Ordinary Differential Equations

[click to expand]

Genetic regulations and expressions

BDH2 (3-hydroxybutyrate dehydrogenase)

Schematic of the gene expression of BDH2 as seen in the model diagram

PhaB (Acetoacetyl-CoA reductase)and PhaC (P(3HB) synthase)

Schematic of the gene expression of PhaB and PhaC as seen in the model diagram

1.6 Model-guided design and optimisation

[click to expand]

Sensitivity analysis: species concentrations

What is sensitivity analysis and why do it?

In order to look at how we could increase the production of P(3HB) we decided to run a sensitivity analysis (also in Simbiology) to identify what species in the model P(3HB) is sensitive to, given the specific conditions with which we set the model. In other words, we calculated the time-dependent sensitivity of P(3HB) with respect to the initial conditions of other species (species formed along the synthesis pathway and enzymes involved).[http://www.mathworks.co.uk/help/simbio/ug/calculating-sensitivities.html#brbumlr|ref]

For a species x, whose concentration depends on time, it can be expressed as x(t). To calculate the sensitivity of x(t) with respect to another species y(t), the sensitivity with normalisation relative to the numerator x(t) can be calculated as:

Therefore, the underlying algorithm for this sensitivity analysis of P(3HB) is:

Scan with different levels of PhaB

The plot below is to show that increasing PhaB concentration within the engineered organism would have a positive effect on the concentration of the P(3HB) synthesised. As so many parameters within the model were taken from different sources, it would be difficult to give a simulation plot that is accurate quantitatively. It was decided to show the single cell simulation for this because the scans were carried out up to the doubling time of 20mins, hence avoided the issue of scaling-up which would have otherwise subjected the simulation to more errors. Therefore, this plot should be interpreted from a qualitative perspective and the trend should be observed.

Difference between promoter expressions after optimisation

Assembling the optimised bioplastic producing operon

We made two new improved constructs by modifying the native operon:

The modellers in the drylab predicted that an increased level of phaB enzyme will increase the amount of PHB produced and therefore we decided to change the native Ralstonia eutropha promoter and RBS to a strong constitutive E.coli promoter (J23104) and RBS (0034) in front of the operon. We have succeeded with the swap and built the new biobrick [http://parts.igem.org/Part:BBa_K1149052 BBa_K1149052] which we refer to as constitutive phaCAB. In parallel, we have also assembled a different configuration of transcription initiation region: the "hybrid". Surprisingly, our results show that our "hybrid" phaCAB construct [http://parts.igem.org/Part:BBa_K1149051 BBa_K1149051] significantly increased bioplastic production compared to native phaCAB. Please read on to discover more.

We tested the promoter and RBS we were going to use by cloning them in front of amilCP blue chromoprotein ([http://parts.igem.org/Part:BBa_K1149020 BBa_K1149020]). It was bright blue and we had some fun playing around with it as part of our communication work "E.coli_Art E.coliArt".

In order to change the promoter, we designed a forward primer that binds to the beginning of the first gene in the operon and contains a Xba restriction site: Pha_Fw (cgcttctagagatggctactgggaaaggagccg). We used pha_Fw and the suffix primer G1005 primer pain to amplify the insert out of the backbone. The new promoter and RBS were J23104 and B0034 from the biobrick [http://parts.igem.org/Part:BBa_K608002 BBa_K608002] We digested the pSB1C3 backbone with this biobrick with SpeI and PstI.

Summary diagram of construction steps:

We performed DpnI digest on the gel purified PCR product (insert) in order to get rid of any contamination from the original plasmid. We did Alkaline Phosphatase treatment of the backbone to remove terminal phosphates in order to decrease self-ligation of plasmid. We transformed the ligation into NEB5 cells and we grew overnight cultures from single cell colonies. The next day, we purified the plasmids and digested 200 ng of them with Xba and PstI to screen for the right clones:

Colony #8 had the expected 4.2kB insert and therefore we sent this plasmid for sequencing. After having the sequenced it, we submitted the new part to registry as [http://parts.igem.org/Part:BBa_K1149051 BBa_K1149051]. At the sequencing step, we realised that it has double P+RBS since the native P+RBS stayed there in between the new P+RBS and the operon. Anyhow, this hybrid configuration should increase the amount of protein products from the genes in the operon and we are in the process characterizing and testing our new construct. We have identified a clone (from colony #6) that contains the new constitutive promoter and submitted it as [http://parts.igem.org/Part:BBa_K1149052 BBa_K1149052] biobrick. We are testing both the hybrid and normal constitutive constructs for PHB bioplastic production.

Partial sequence of the constitutive phaCAB construct ([http://parts.igem.org/Part:BBa_K1149052 BBa_K1149052]):

Partial sequence of the hybrid phaCAB construct ([http://parts.igem.org/Part:BBa_K1149051 BBa_K1149051]):