Team:UNITN-Trento/Notebook/Labposts/06/04

From 2013.igem.org

(Difference between revisions)
Line 1: Line 1:
{
{
-
"date" : "2013-06-12",
+
"date" : "2013-06-06",
-
"author" : "thomas-viola",
+
"author" : "thomas-emil",
-
"title" : "Transformation of four B.subtilis promoters",
+
"title" : "First SAMsynthase extraction attempt - FAILED ",
-
"content" : "Due to a too high concentration of Cloramphenicol in the plates, we have to re-transform the promoters previously extracted from the registry. We transformed and plated the following parts:- K323002- K143012- K323000- K323003'''Results:''' since we didn't obtain any colonies we failed the experiment.",
+
"content" : "We tried to amplify the SAMsynthase gene from an extract of E.coli genomic DNA (strain MG1655). In order to do that we exploited two primers previoursly designed and synthetized.'''Foward:''' GCCGCTTCTAGAGAAGGAGGAACTACTATGGCAAAACACCTTTTT'''Reverse:''' CTGCAGCGGCCGCTACTAGTATTATTACTTCAGACCGGCAGFor the protocol used see the <html><a href=\"https://2013.igem.org/Team:UNITN-Trento/Protocols#Phusion-PCR\">Phusion PCR protocol</a></html>..When the reaction finished, we tested the presence of the aplificate product througt an electrophoresis analisys (adding 2 µl of LD for 10 µl of DNA).<B>Results:</B>{{:Team:UNITN-Trento/Templates/Styles/Spoiler|Gel Image|<html><img id=\"post_img\" src=\"https://static.igem.org/mediawiki/2013/0/0a/Tn-20130605-gelschifo.jpg\" /></html>}}As you can see from our gel image, our product is not present.The next move will be to try to amplify using a TAQ polymerase and we hope that this will work!",
-
"tags" : "Pveg-PliaG-PlepA"
+
"tags" : "SAMsynthetase"
}
}

Revision as of 07:39, 3 October 2013

{ "date" : "2013-06-06", "author" : "thomas-emil", "title" : "First SAMsynthase extraction attempt - FAILED ", "content" : "We tried to amplify the SAMsynthase gene from an extract of E.coli genomic DNA (strain MG1655). In order to do that we exploited two primers previoursly designed and synthetized.Foward: GCCGCTTCTAGAGAAGGAGGAACTACTATGGCAAAACACCTTTTTReverse: CTGCAGCGGCCGCTACTAGTATTATTACTTCAGACCGGCAGFor the protocol used see the Phusion PCR protocol..When the reaction finished, we tested the presence of the aplificate product througt an electrophoresis analisys (adding 2 µl of LD for 10 µl of DNA).Results:

As you can see from our gel image, our product is not present.The next move will be to try to amplify using a TAQ polymerase and we hope that this will work!", "tags" : "SAMsynthetase" }