From 2013.igem.org
(Difference between revisions)
|
|
| Line 1: |
Line 1: |
| | { | | { |
| - | "date" : "2013-07-10", | + | "date" : "2013-07-25", |
| - | "author" : "gabriele-viola", | + | "author" : "gabriele", |
| - | "title" : "Reboot: starting from the beginning", | + | "title" : "Screening - GOT IT! F**k yeah!", |
| - | "content" : "<html> Since the new forward primer (with the entire prefix) arrived, I started again from the beginning.< br/ ><br/ ><h3>SAM synthetase extraction</ h3>The new primer forward has just the EcoRI restriction site added at its beginning (complete prefix): <br/> GAATTCGCGGCCGCTTCTAGAGAAGGAGGAACTACTATGGCAAAACACCTTTTT< br/ >It has a Tm = 68.7°C.<br/> <br/>Then I performed two Phusion PCR (one GC and one HF) and one Phusion/RBC PCR to identify the best protocol for SAM synthetase extraction with the new primer.</ html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler|Phusion PCRs|<html><center><table class=\"tn-sp-table\"><tr><th colspan=\"3\"> PCR Mixes</th ></tr><tr><td style=\"border:none;\"></td><th> Mix HF (1)</th><th>Mix GC (2)</th></tr><tr><td> Phusion Buffer HF</td><td >10µl</td><td>0</td></tr><tr><td>Phusion Buffer GC</td><td>0</td><td>10µl</td></tr><tr><td>dNTPs</td><td colspan=\" 2\"> 1µl</td></tr><tr><td> template</td><td colspan=\" 2\"> 1µl</td></tr><tr><td> Primer Fw</td><td colspan=\"2\" rowspan=\"2\"> 2. 5µl</td></tr><tr><td> Primer Rv</td ></tr><tr><td> Phusion pol</ td><td colspan=\"2\">0.5µl</td></tr><tr><td> Water</td><td colspan=\" 2\"> 33.5µl</td></tr>< /table>< br/>< br/>< table class=\" tn- sp-table\"> <tr><th colspan=\"4\">Phusion Settings</ th></tr><tr><th>Step</th><th>Temperature</th><th>Time</th><th>Go to</th></tr><tr><td>1 </td><td>98°C</td><td>30 sec</td><td></td></tr><tr><td>2</td><td>98°C</td><td>10 sec</td><td></td></tr><tr><td>3</td><td> 72°C</ td><td>35 sec</td><td>step #2, 30 times</td></tr><tr><td>4</td><td>72& deg; C</td><td>10 min</td><td></td></tr> <tr><td>5</ td> <td>4°C</ td>< td> pause< /td><td></ td>< /tr></ table>< /center></html>}}<html></html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler| Phusion/RBC PCR|<html><center><table class=\"tn-sp-table\" ><tr><th colspan=\"2\">PCR Mix</th></tr><tr><td style=\"border:none;\"></td>< td> Mix RBC (3)</ td>< /tr> <tr><td>Template</ td>< td> 1µl</ td></tr><tr><td> dNTPs</td><td >0.5µl</td></tr><tr><td>Primer Fw</td><td rowspan=\"2\"> 1µl</td ></tr><tr><td> Primer Rv</td></tr><tr><td>Buffer RBC</td><td>5µl</td></tr><tr><td> Phusion pol</td><td> 0.3µl</td></tr><tr><td> RBC</td><td>0.25µl</td></tr><tr><td> Water</td><td >40.95µl</td></tr></table><br/><br/><table class=\" tn-sp-table\" ><tr><th colspan=\" 4\"> PCR Settings</th></tr><tr><th>Step</th><th>Temperature</th><th>Time</th><th>Go to</th></tr><tr><td>1</td><td>94& deg; C</td><td>2 min</td><td></td></tr><tr><td> 2</td><td>94°C</td><td>1 min</td><td></td></tr><tr><td> 3</td><td> 62. 5°C</td><td>1 min</td><td></td></tr><tr><td>4 </td><td>72& deg; C</td><td> 1 min 9 sec</td><td>step #2, 30 times</td></tr><tr><td>5</td><td>72& deg; C</td><td>7 min</td><td></td></tr> <tr><td>6</ td> <td>4°C</ td><td>pause</td><td></td></tr></table></html>}}<html ><br/>The products of these three PCRs were then loaded on a 1% agarose gel.</html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler|Gel|<html><center><table class=\"tn-sp-table\"><tr><th colspan=\"4\">Loading scheme</th></tr><tr><td>1kb ladder</td><td> GC(2)</td><td> HF(1)</td><td> RBC(3)</td></tr></table><img src=\"https://static.igem.org/mediawiki/2013/ 8/ 82/Tn- 20130710- GG_SAMsynthetase_newPrimers_chosePCR.jpg\" alt=\"Gel\" width=\"450px\"></center></html>}}<html>As showed by the gel , only the Phusion/RBC PCR was successful.<br/><br/><hr><h3>Purifications</h3>Then, I purified the EX-SAMsynthetase-SP sample produced today with the Phusion/RBC PCR, and the 5 R0010 PCR insert that were amplified on <a href=\"https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/Notebook#tn-post-2013-07-02-gabriele\">tuesday 02/07</a>.<center><table class=\"tn-sp-table\"><tr><th>Sample</th><th>Type</th><th>Quantity</th></tr><tr><td>RBC(3)</td><td>EX-SAMsynthetase-SP</td><td>103.6ng/µl</td></tr><tr><td>HF1</td><td>R0010 insert</td><td>17.5ng/µl</td></tr><tr><td>HF2</td><td>R0010 insert</td><td>19.5ng/µl</td></tr><tr><td>HF3</td><td>R0010 insert</td><td>15.9ng/µl</td></tr><tr><td>G1</td><td>R0010 insert</td><td>17.8ng/µl</td></tr><tr><td>G2</td><td>R0010 insert</td><td>16.3ng/µl</td></tr></table></center><br><hr><h3>OverNight Purification</h3>Then, Viola was so polite to prepare the O/N digestion mixes ( <a href=\"https://2013.igem.org/Team:UNITN-Trento/Protocols#Digestion\">with the usual protocol</a>) and incubate them at 37°C. An EX-SAMsynthetase -SP sample (RBC#3 from today, 103.6ng/µl) and a linear pSB1C3 sample (G3A from <a href=\"https://2013. igem.org/wiki/index.php?title=Team:UNITN-Trento/Notebook#tn-post-2013-07-01-Gabriele\">01/07</a>, 44.8ng/µl) were restricted with XbaI and PstI (Nebuffer2).</html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler|Digestion mixes|<html><center><table class=\"tn-sp-table\"><tr><td style=\"border:none;\"></td><th>RBC#3</th><th>G3A</th></tr><tr><td>Template</td><td>40µl</td><td>50µl</td></tr><tr><td>XbaI</td><td rowspan=\"2\">2.5µl</td><td rowspan=\"2\">1.5µl</td></tr><tr><td>PstI</td></tr><tr><td>NEBuffer 2</td><td>10µl</td><td>5µl</td></tr><tr><td>BSA</td><td>10µl</td><td>5µl</td></tr><tr><td>Water</td><td>35µl</td><td>0</td></tr></table></center></html>}}<html></html>", | + | "content" : "<html>I checked < a href=\"https:// 2013.igem.org/ wiki/index.php?title=Team: UNITN-Trento/ Notebook#tn-post-2013-07-24-gabriele\"> yesterday</a> 's inocula and , surprisingly and sadly, 4 out of 7 were red!!! I must admit that I don't get how it is possible to have red inocula when I treated the linearized-by-PCR pSB1C3 with the DpnI enzyme. .. that's crazy... anyway the quantification results are the following:< br/><center><table class=\"tn-sp-table\"><tr><th> Inocula</th><th> Quantity</th></tr><tr><td> ON 1:1 A</td><td style=\" font-color:red\"> RED</td></tr><tr><td> ON 1:1 B</td><td style=\" font-color:red\"> RED</td></tr><tr><td> ON 1:1 C</td><td> 216. 4ng/µl</td></tr><tr><td> ON 1:1 D</td><td> 215.5ng/µl</td></tr><tr><td> ON 1:1 E</td><td style=\" font-color:red\"> RED</td></tr>< tr>< td> Short 1:1</ td>< td style=\" font- color:red\"> RED</ td></tr><tr><td> Short 1 :3</td><td> 315.5ng/& micro; l</td></tr></ table></ center>< br>< h3> Screening digestion</ h3> Screening was performed with BamHI-HF and PstI-HF. While PstI-HF cuts at the suffix (the end of the insert), BamHI-HF is able to cut only SAMsynthetase at 102th base position. So, the screening digestion will show one band at nearly 3100bp if pSB1C3 contains Plac+RFP, at nearly 2000bp if an '< i> empty</ i> ' pSB1C3 is present and two bands (one at nearly 2200bp and the other at nearly 1000bp) if we have pSB1C3 with SAMsynthetase.< br></html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler| Digestion mixes|<html><center><table class=\"tn-sp-table\"><tr><td style=\"border:none;\"></td>< th> 11C</ th>< th> 11D</ th>< th> 13S</ th></tr><tr><td> template</td><td colspan=\"2\"> 4.6µl</td><td> 3.17µl</td></tr><tr><td> PstI-HF</td><td colspan=\"3\" rowspan=\"2\"> 1µl</td></tr><tr><td> BamHI-HF</td></tr><tr><td> NEBuffer 4</td><td colspan=\" 3\" rowspan=\" 2\"> 2& micro; l</td></tr><tr><td> BSA</td></tr><tr><td> Water</td><td colspan=\"2\"> 9.4& micro; l</td><td> 10.83& micro; l</td></tr></ table></ center></html>}}<html>The screening digestions were incubated at 37°C for 1 hour and the run on a 1% agarose gel. <br/></html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler|Gel|<html><center><table class=\"tn-sp-table\"><tr><th colspan=\"4\">Loading scheme</th></tr><tr><td>1kb ladder</td><td> 11C</td><td> 11D</td><td> 13S</td></tr></table><img src=\"https://static.igem.org/mediawiki/2013/ 4/ 4c/Tn- 20130725- GG_SAMsynthetase_GOTIT.jpg\" alt =\"Gel\" title=\"Gel\" width=\"450px\" /></center></html>}}<html>As you can see, the gel shows a band at nearly 2kbp and one at nearly 1kbp at the 13S lane, so that sample should contain the desired construct ( pSB1C3+SAMsynthetase).</html>", |
| | "tags" : "SAMsynthetase" | | "tags" : "SAMsynthetase" |
| | } | | } |
Revision as of 08:43, 3 October 2013
{
"date" : "2013-07-25",
"author" : "gabriele",
"title" : "Screening - GOT IT! F**k yeah!",
"content" : "I checked yesterday's inocula and, surprisingly and sadly, 4 out of 7 were red!!! I must admit that I don't get how it is possible to have red inocula when I treated the linearized-by-PCR pSB1C3 with the DpnI enzyme... that's crazy... anyway the quantification results are the following:
| Inocula | Quantity |
|---|
| ON 1:1 A | RED |
| ON 1:1 B | RED |
| ON 1:1 C | 216.4ng/µl |
| ON 1:1 D | 215.5ng/µl |
| ON 1:1 E | RED |
| Short 1:1 | RED |
| Short 1:3 | 315.5ng/µl |
Screening digestion
Screening was performed with BamHI-HF and PstI-HF. While PstI-HF cuts at the suffix (the end of the insert), BamHI-HF is able to cut only SAMsynthetase at 102th base position. So, the screening digestion will show one band at nearly 3100bp if pSB1C3 contains Plac+RFP, at nearly 2000bp if an '
empty' pSB1C3 is present and two bands (one at nearly 2200bp and the other at nearly 1000bp) if we have pSB1C3 with SAMsynthetase.
Digestion mixes | 11C | 11D | 13S |
|---|
| template | 4.6µl | 3.17µl |
| PstI-HF | 1µl |
| BamHI-HF |
| NEBuffer 4 | 2µl |
| BSA |
| Water | 9.4µl | 10.83µl |
The screening digestions were incubated at 37°C for 1 hour and the run on a 1% agarose gel.
Gel| Loading scheme |
|---|
| 1kb ladder | 11C | 11D | 13S |
![\"Gel\"](\"https://static.igem.org/mediawiki/2013/4/4c/Tn-20130725-GG_SAMsynthetase_GOTIT.jpg\" "\\"Gel\\"")
As you can see, the gel shows a band at nearly 2kbp and one at nearly 1kbp at the 13S lane, so that sample should contain the desired construct (pSB1C3+SAMsynthetase).",
"tags" : "SAMsynthetase"
}
"
