Reporter genes

One of the most fundamental parts required in a new chassi is a reporter gene. Unfortunately, some fluorescent proteins do not work well in Lactobacillus, possibly due to lower levels of internal pH in the cytosol.

One popular fluorescent protein that does work is mCherry. We have created a biobricked version of mCherry, BBa_K1033250 codon optimized for Lactobacillus reuteri, however it should work well in most species in the Lactobacillus genus. The gene has been modified in accordance with the Freiburgh fusion standard 25. Because of time constraints we have not yet had time to characterise it but it has been used in non-biobrick format by other researchers with positive results

Prefix

gaattccgcggccgcttctagatggccggc...

Suffix

... accggttaatactagtagcggccgctgcag

Chromoproteins in Lactobacillus

There are many things we take for granted when working with bacteria such as E. coli. An initial problem when learning to work with Lactobacillus is to simply be able to do successful transformations of plasmids, something that is more difficult and cumbersome to do compared to E. coli. To see if you have been able to master a transformation with Lactobacillus some basic reporter genes that reflects visible light makes the validation process a lot easier.

Above is a picture of one of our chromo proteins and RBS fused together with two of our synthetic promoters, CP11 and CP29 . These promoters have been characterised and has been shown to work both in E. coli and Lactobacillus. We wanted to see if our chromoproteins could work as visual reporters. The construct has been shown to work fine with our shuttle vector in E. coli as can clearly be seen in the picture below with blue bacterial colonies. We have however not yet been able to transform it into Lactobacillus. Below in the picture is a plate with our shuttle vector BBa_K1033206 containing the chromoprotein amilCP fused with the synthetic promoter CP29 from our promoter collection. The colonies are clearly blue efter 24 hours in E. coli, we have not yet been able to transform the construct to Lactobacillus.

Biobricks

BBa_K1033250 - mCherry fusion protein codon optimised for Lactobacillus reuteri
BBa_K1033280 - aeBlue blue chromoprotein with strong promoter
BBa_K1033281 - amilCP blue chromoprotein with medium strength promoter
BBa_K1033282 - amilCP blue chromoprotein with strong promoter