Team:Heidelberg/Templates/DelH overview11

From 2013.igem.org

(Difference between revisions)
Line 1: Line 1:
-
 
=== Gibson Strategy===
=== Gibson Strategy===
* PCR amplification of entire 18 Kb DelH fragment G0, as well as sub fragments G1a and G1b  
* PCR amplification of entire 18 Kb DelH fragment G0, as well as sub fragments G1a and G1b  
Line 8: Line 7:
<br/>
<br/>
===Vector Map and Primers===
===Vector Map and Primers===
-
[[File:Heidelberg_FinalPlasmid.svg|300px|left|thumb|Vector map of the [[:File:Heidelberg_DelH-BB(Gibson-pSB6A1-AraC-lacZ).gb|pHM02:DelH-pSB6A1-AraC-lacZ Gibson-plasmid]].]]
+
[[File:Heidelberg_FinalPlasmid.svg.png|300px|left|thumb|Vector map of the [[:File:Heidelberg_DelH-BB(Gibson-pSB6A1-AraC-lacZ).gb|pHM02:DelH-pSB6A1-AraC-lacZ Gibson-plasmid]].]]
{| class="wikitable" style="float"
{| class="wikitable" style="float"
|-
|-

Revision as of 23:00, 3 October 2013

Gibson Strategy

  • PCR amplification of entire 18 Kb DelH fragment G0, as well as sub fragments G1a and G1b
  • PCR amplification of backbone pSB6A1-lacI-mRFP, simultaneously inserting Gibson
  • Gibson assembly of construct DelH + backbone to DelH plasmid
  • Electroporation of E. coli TOP10 with DelH plasmid
  • Characterization of positive (red) colonies by colony PCR


Vector Map and Primers

Identifier Order Date Note Sequence
HM02_DelH_Gib1.1_rev 09-07-2013 Gibson-Primer DelH TGCTGCGCCTGCATACGGCCAAACA
HM03_DelH_Gib1.2_fw09-07-2013 Gibson-Primer DelH AGCGGCAGGGACGACGTGGT
HM04_DelH_Gib1.2_rev09-07-2013 Gibson-Primer DelH CATAGAGGTTGTAGAGA
HM05_DelH_Gib2.1_fw09-07-2013 Gibson-Primer DelH AGAACGCCGTCTTCAGGCTCCTG
HM06_DelH_Gib2.1_rev09-07-2013 Gibson-Primer DelH CAATGCTTTG CCGCTCGAA
HM07_DelH_Gib2.2_fw09-07-2013 Gibson-Primer DelH TCGCCACGGCAGCTGTTCGA
HM08_DelH_Gib2_end_rev09-07-2013 Gibson-Primer DelH TCAGTCCAGCGCGTACTCCAG
HM09_AraC_RBS_DelH_rev09-07-2013Gibson-Primer rev, introduces a
new RBS and has the AraC promotor
and the beginning of DelH
TTGCAAAGCGCTCGGCGATTTGGCGCAGGCGGCCACGGTCCAT
ttaactTTCTCCTCTTTAATactttgagctagcccaaAaaaacggtatggagaa
acagtagagagtt
HM10_RBS_lacZ09-07-2013 Gibson-Primer fw for the pSB6A1
Backbone with the end of DelH,
RBS(1) and the beginning of lacZ
TGGAGTACGCGCTGGACTGA TCTAGAG AAAGAGGAGAAA TACTAG ATGACCATGATTA