Team:Manchester/LabBookText

From 2013.igem.org

(Difference between revisions)
Line 52: Line 52:
<p>3) Colony left overnight in incubator at 37 ºC </p>
<p>3) Colony left overnight in incubator at 37 ºC </p>
<br>
<br>
-
<p><b>25/06/2013 - Electrically Competent Cells For Electroporation (E.Coli BL21 DE3)</b></p>
+
<p><b>25/06/2013 - Electrically Competent Cells For Electroporation (<i>E.Coli</i> BL21 (DE3))</b></p>
<br>
<br>
<p><b>Change of method for transformation</b></p>
<p><b>Change of method for transformation</b></p>
-
<p>The pKD46 plasmid we are using has temperature sensitive replication. Heat shocking and incubating at 37 ºC is NOT an appropriate method for transformation. Electroporation will be used instead. The protocol for forming electrocompetent cells is as follows:</p>
+
<p>The pKD46 plasmid we are using has temperature sensitive replication. Heat shocking and incubating at 37 ºC is not an appropriate method for transformation. Electroporation will be used instead. The protocol for forming electrocompetent cells is as follows:</p>
<p><i>Preparation of stock</i></p>
<p><i>Preparation of stock</i></p>
<p>1.  Add 1 ml of the overnight culture to the eppendorf tube.</p>
<p>1.  Add 1 ml of the overnight culture to the eppendorf tube.</p>
<p>2. Centrifuge the culture at 5000g for 10 minutes , harvest the cells.</p>  
<p>2. Centrifuge the culture at 5000g for 10 minutes , harvest the cells.</p>  
<p>3. Resuspend the cells in 1 ml of 10% glycerol in LB .</p>
<p>3. Resuspend the cells in 1 ml of 10% glycerol in LB .</p>
-
<p>4. Store the cells at -80C.</p>
+
<p>4. Store the cells at -80 ºC.</p>
<p><i>Preparation of cells</i></p>
<p><i>Preparation of cells</i></p>
<p>At an OD of 0.6:</p>
<p>At an OD of 0.6:</p>
Line 66: Line 66:
<p>Centrifuge 2: harvest the cells by centrifuge at 2000g for 20 minutes at 4⁰C. Decant the supernatant and resuspend the cell pellet in 20 ml ice-cold sterilised water</p>
<p>Centrifuge 2: harvest the cells by centrifuge at 2000g for 20 minutes at 4⁰C. Decant the supernatant and resuspend the cell pellet in 20 ml ice-cold sterilised water</p>
<p>Centrifuge 3: harvest the cells by centrifuge at 2000g for 20 minutes at 4⁰C . Decant the supernatant and resuspend the cell pellet in 1-2 ml ice-cold 10% glycerol.  
<p>Centrifuge 3: harvest the cells by centrifuge at 2000g for 20 minutes at 4⁰C . Decant the supernatant and resuspend the cell pellet in 1-2 ml ice-cold 10% glycerol.  
-
Store the cells at -80⁰C.</p>   
+
Store the cells at -80 ⁰C.</p>   
<br>
<br>
-
<p><b>26/06/2013 - Electroporation of PKD46 in E.Coli BL21 DE3 from 25/06/2013</b></p>  
+
<p><b>26/06/2013 - Electroporation of pKD46 in E.Coli BL21 DE3 from 25/06/2013</b></p>  
<p>3 cuvettes prepared: each contained 50 µl of electrocompetent cells and either 1 µl of pKD46 plasmid, 5 µl of pKD46 plasmid or 5 µl of sterile H<sub>2</sub>O. The following protocol was followed:</p>
<p>3 cuvettes prepared: each contained 50 µl of electrocompetent cells and either 1 µl of pKD46 plasmid, 5 µl of pKD46 plasmid or 5 µl of sterile H<sub>2</sub>O. The following protocol was followed:</p>
<p>1) Place the cuvettes on ice and put the cells in them</p>
<p>1) Place the cuvettes on ice and put the cells in them</p>
Line 127: Line 127:
<p><i>VerR1</i></p>
<p><i>VerR1</i></p>
<p>5’ GGGTTGTGGTAATTCGCC 3’</p>
<p>5’ GGGTTGTGGTAATTCGCC 3’</p>
-
<br>
 
-
<p><b>03/07/2013</b></p>
 
-
<p><b><i>WHAT IS THIS????</i></b></p>
 
<br>
<br>
<p><b>04/07/2013 - Induction of Lambda Red Recombinase & Electro-Competency of transformed cells</b></p>
<p><b>04/07/2013 - Induction of Lambda Red Recombinase & Electro-Competency of transformed cells</b></p>
Line 150: Line 147:
</tr>
</tr>
<tr>
<tr>
-
<td>5x pfusion buffer</td>
+
<td>5x phusion buffer</td>
<td>20</td>
<td>20</td>
</tr>
</tr>
Line 170: Line 167:
</tr>
</tr>
<tr>
<tr>
-
<td>Pfusion polymerase</td>
+
<td>Phusion polymerase</td>
<td>1</td>
<td>1</td>
</tr>
</tr>
Line 251: Line 248:
<br>
<br>
<p><b>11/07/2013 - Received FAS Module - Plating up</b></p>
<p><b>11/07/2013 - Received FAS Module - Plating up</b></p>
 +
<p>2 vials of stab culture received from Prof Mattheos Koffas of the Rensselaer Polytechnic Institute, NY, USA (2x DH5α w/pETM6-CnFatB2-fabAH<sup>*</sup>GI in Amp80</p>
 +
<p>1 vial kept at 4 ºC and other vial plated on LB with Amp100</p>
 +
<p>Left on bench for 3 hours and then placed in a 30 ºC incubator</p>
 +
<p>Second plate, Amp 50µg/ml, plated w/DH5α w/pETM6-CnFatB2-fabAH<sup>*</sup>GI  and placed in 30 ºC incubator</p>
 +
<p>Both plates removed and left on bench overnight</p>
<br>
<br>
<p><b>12/07/2013 - FAS plate results</b></p>
<p><b>12/07/2013 - FAS plate results</b></p>
Line 258: Line 260:
<p><b>16/17 /07/2013 - DH5-Alpha cells grown up and FAS plasmid extraction using Qiagen MiniPrep Kit & Gel Electrophoresis of Product to verify</b></p>
<p><b>16/17 /07/2013 - DH5-Alpha cells grown up and FAS plasmid extraction using Qiagen MiniPrep Kit & Gel Electrophoresis of Product to verify</b></p>
<br>
<br>
-
<p><b>24/17 - Knockout Take II PCR of Chloromphenecol (New primers)</b></p>  
+
<p><b>24/17 - Knockout Take II PCR of Chloramphenicol (New primers)</b></p>  
<br>
<br>
<p><b>25/7 - PCR Of products - Worked</b></p>
<p><b>25/7 - PCR Of products - Worked</b></p>

Revision as of 14:54, 5 August 2013

14/06/2013 - Making media

1. Calculate amount of powder of LB agar or LB broth mix required in accordance with manufacturer's instructions

2. Add LB powder to distilled water (we used 10 g of LB-broth or LB agar to 400ml of water

3. Autoclave the flask ( Make sure you have the autoclave tape on with label)

4. Add any antibiotic if needed once the flask has sufficiently cooled (approx 50 degrees).


19/06/2013 - Preparation of Chemically competent Cells

1. Grow the specific strain (BL21(DE3))on the plate. Plates will be in the incubator.

2. Select a colony from the plate with inoculating loop

3. The colony is dispersed in 100 ml LB broth in a conical flask.

4. The culture is left overnight- vigorous shaking at 37°C


Taking the OD of the grown culture

Want an OD of 0.1 in a culture volume of 100ml

Calculation:

V1 x 3.2 = 100 x 0.1

V1= 3.1 ml

96.9 ml [LB broth] + 3.1 ml [culture] = 100 ml culture with OD of 0.1

5. Take original OD volume of the culture (at 600 nm). Use LB as a blank. N.B: You need an OD less than 1.5 to measure the density accurately

6. Diluted culture is transferred to sterile flask. This is placed in shaking incubator at 37°C. After an hour, the OD is measured 15 minutes until it reaches the range of 0.4- 0.6

7. Centrifuge at 6000 xg for 10 min or 5500 xg for 15 min in 2 x 50 ml tubes.

8. Remove the supernatant from the tubes. Combine both the pellets and suspend in ice cold 0.1M CaCl2

9. Leave the tube on ice for 30 min.

10. Spin cells at 6000 xg for 10 min or 5500 xg for 15 min and remove supernatant

11. Resuspend the pellet in 4 ml ice cold 0.1 CaCl2

12. Put on ice in cold room overnight

13. Add 1 ml sterile 100% glycerol

14. Make 50 µl aliquot and store at -80°C (after freezing with liquid nitrogen)


20/06/2013 - FadD Knock Out Part 1 (Transformation of Chemically Competent E.Coli)

1) Incubate 50-100µl of competent cells with either 0.5-1 µl of commercial plasmid (pKD46: (Lambda Red Recombinase Plasmid)) or the same volume of water/ligation mixture (control). ~1.2µl of plasmid to 50µl of cells

2) Leave on ice for 30 minutes

3) Heat shock: 42 ºC in water bath for 45 seconds OR 37ºC heat block for 2 mins

4) Leave on ice for 5 minutes

5) Recover cells by adding 500µl of LB broth

6) Incubate at 37 ºC for 1-2 hours

7) Plate dilutions on agar containing appropriate antibiotic


21/06/2013 - Continued

Yesterday’s transformation failed. Today we tried the experiment following the protocol of 20/06 although cells were heat shocked at 37 ºC on a heat block for 2 minutes instead of 42 ºC in a water bath for 45 seconds.

50 µg/ml ampicillin agar plates mate. 0.75g of ampicillin added to 15 ml of 50% ethanol to create 50 mg/ml stock to be kept in -20 ºC freezer. 0.4ml of this stock added to 400 ml of LB-agar:

50 mg/ml x V1 = 50 µg/ml x 400 ml

50000 µg x V1 = 50 µg/ml x 400ml

V1=0.4 ml (400 µl)


24/06/2013 - Growing Cells From 21/06/2013

1) Colony selected with inoculating loop

2) Colony added to 100 ml LB broth

3) Colony left overnight in incubator at 37 ºC


25/06/2013 - Electrically Competent Cells For Electroporation (E.Coli BL21 (DE3))


Change of method for transformation

The pKD46 plasmid we are using has temperature sensitive replication. Heat shocking and incubating at 37 ºC is not an appropriate method for transformation. Electroporation will be used instead. The protocol for forming electrocompetent cells is as follows:

Preparation of stock

1. Add 1 ml of the overnight culture to the eppendorf tube.

2. Centrifuge the culture at 5000g for 10 minutes , harvest the cells.

3. Resuspend the cells in 1 ml of 10% glycerol in LB .

4. Store the cells at -80 ºC.

Preparation of cells

At an OD of 0.6:

Centrifuge 1: transfer the cultures to ice-cold centrifuge bottles. Harvest the cells by centrifugation at 2000g for 20 minutes at 4 ⁰C. Decant the supernantant and resuspend the cell pellet in 50 ml of ice-cold sterilised water.

Centrifuge 2: harvest the cells by centrifuge at 2000g for 20 minutes at 4⁰C. Decant the supernatant and resuspend the cell pellet in 20 ml ice-cold sterilised water

Centrifuge 3: harvest the cells by centrifuge at 2000g for 20 minutes at 4⁰C . Decant the supernatant and resuspend the cell pellet in 1-2 ml ice-cold 10% glycerol. Store the cells at -80 ⁰C.


26/06/2013 - Electroporation of pKD46 in E.Coli BL21 DE3 from 25/06/2013

3 cuvettes prepared: each contained 50 µl of electrocompetent cells and either 1 µl of pKD46 plasmid, 5 µl of pKD46 plasmid or 5 µl of sterile H2O. The following protocol was followed:

1) Place the cuvettes on ice and put the cells in them

2) Add the plasmid/water to the cuvettes, tapping to remove any air bubbles

3) Electroporate using electroporation machine on bacteria setting

4) Add 750 µl of super optimal broth (SOB) to each cuvette and carefully transfer to sterile 1.5 ml eppendorf tube

5) Recover the cells at 30 ºC for 2 hours

Cells were then plated on 50 µg/ml ampicillin plates (100 µl or 600 µl of culture) and LB only plates (100 µl of culture) and incubated at 30 ºC overnight

27/06/2013 - Transformation Results

The following table shows the number of colony forming units (cfu) found on each plate. The number in brackets indicates number of colonies taken to be re-plated

Plate Load LB AMP-50 100µl LB AMP-50 600 µl LB 100 µl
E. coli BL21 (DE3) & 80 ng pKD46 33 (3) 69 (3) Lawn
E. coli BL21 (DE3) & 400 ng pKD46 2 (2) 3 (3) Lawn
E. coli BL21 (DE3) & 0 ng pKD46 0 0 Lawn



28/06/2013 - Further selection of Transformed cells and verification

Successful cultures from yesterday were re-plated


01/07/2013 - Continued

WHAT IS THIS MATHS????


02/07/2013 - Primer ordering

Order for primers put in today. They were as follows:

H1catF

5’CCGTACATATAGTAAACCCCAACGCTACTGCTGCTTGTGCGTAAAATCTCCACTTCTTTACCTCTTTTTTTAGTGACC 3’

H1catR

5’CTCTTTAGTGGGCGTCAAAAAAAACGCCGGATTAACCGGCGTCTGACGACTGACTTAACACTTTACGCCCCGCCCTGCC 3’

VerF1

5’ GGGTCGTCCACTAATACGGC 3’

VerfadR

5’ GGTGCCGCCGGTGTATTGTTGCAG 3’

VercatR

5’ GTGTAGAAACTGCCGGAAATCG 3’

VerR1

5’ GGGTTGTGGTAATTCGCC 3’


04/07/2013 - Induction of Lambda Red Recombinase & Electro-Competency of transformed cells

For each batch of cells, 2 batches were prepared. Some were electrically induced, and others were not

1) 70 ml of LB broth added to 700 µl of overnight culture of induced and uninduced cells

2) Grow cultures at 30 ºC for 1 hour

3) Check and record the OD until it is in a range of 0.1-0.3

4) Add 400 µl of arabinose to 10 ml of culture from step 1 to get a final concentration of 0.2%

5) Grow the culture at 30 ºC for a further 2 hours

6) Check and record the OD value until it lies in a range 0.6-0.9


09/07/2013 - PCR of Chloramphenicol and Homologous regions

Creation of a dNTP stock

dNTPs initially come at 100 mM concentration. Working stock requires 10 mM concentration. This was made by adding 10 µl each of dATP, dGTP, dCTP and dTTP to 60 µl of water

Creation of a Master Mix

Item Volume (µl)
5x phusion buffer 20
10 mM dNTPs 2
Primer 1 (10 mM stock) 2
Primer 2 (10 mM stock) 2
DNA/Water (Water control) 4
Phusion polymerase 1
DMSO 5
Water 64

PCR Thermocyler Settings

Temperature (ºC) Time Number of cycles
98 2 m 1
98 15s
55 30s 10
72 3.5 min
98 15s
55 30s 20
72 3.5 min + 5s per cycle


10/07/2013 - Agarose Gel Electrophoresis of PCR product from 09/07

Making The Gel

1% gel we require 1 g Agarose in 100 ml TAE. Therefore, 0.7% gel we require 0.7g agarose in 100 ml TAE

1. Microwave 1-3 min unless agarose is dissolved in TAE and rolling boil of mixture

2. Leave to cool 5 mins. Add 2 ul of Ethidium Bromide per 100 ml

3. Pour into casting plates with comb

4. Leave 10-15 mins at 4⁰C or 20 mins at room temperature

Result of PCR: FAILURE

INSERT PICTURE OF GEL HERE


11/07/2013 - Received FAS Module - Plating up

2 vials of stab culture received from Prof Mattheos Koffas of the Rensselaer Polytechnic Institute, NY, USA (2x DH5α w/pETM6-CnFatB2-fabAH*GI in Amp80

1 vial kept at 4 ºC and other vial plated on LB with Amp100

Left on bench for 3 hours and then placed in a 30 ºC incubator

Second plate, Amp 50µg/ml, plated w/DH5α w/pETM6-CnFatB2-fabAH*GI and placed in 30 ºC incubator

Both plates removed and left on bench overnight


12/07/2013 - FAS plate results


15/07/2013 - Stock of FAS cells for freezer


16/17 /07/2013 - DH5-Alpha cells grown up and FAS plasmid extraction using Qiagen MiniPrep Kit & Gel Electrophoresis of Product to verify


24/17 - Knockout Take II PCR of Chloramphenicol (New primers)


25/7 - PCR Of products - Worked


29/7 - Creating FAS Module Media


31/7 - Electroporation of cells with FAS