From 2013.igem.org
Part 1
Toll like receptor 8 transfection in HEK 293 cell line
Plasmid information :
| pcDNA3-TLR8-YFP |
| Gene/insert name: |
Toll-Like Receptor 8 |
| Alt name: |
TLR8 |
| Insert size: |
3177 |
| Species: |
H. sapiens (human) |
| GenBank ID: |
NM_016610 |
| Entrez Gene: |
TLR8 (CD288, MGC119599, MGC119600) |
| Fusion protein or tag: |
YFP |
| Terminal: |
C terminal on backbone |
| Vector backbone: |
pcDNA3-YFP |
| Vector type: |
Mammalian Expression |
| Backbone size w/o insert (bp): |
6100 |
| Cloning site 5': |
BamHI |
| Site destroyed during cloning: |
No |
| Cloning site 3': |
XhoI |
| Site destroyed during cloning: |
No |
| 5' sequencing primer: |
T7 |
| 3' sequencing primer: |
GTCTTGTAGTTGCCGTCGTC |
| Bacterial resistance(s) |
Ampicillin |
| Growth strain(s) |
DH5alpha |
Growth temperature (℃): |
37 |
| High or low copy: |
High Copy |
| Selectable markers: |
Neomycin |
The HEK 293 cell line was transfected with the pcDNA3-TLR8-YFP plasmid. For the evocation of Interferon type 1 production the siRNA would act as ligand for the Toll like receptor 8. Although TLR8 is phylogenetically related to TLR7 and
is activated by structurally similar ligands, the cellular expression
patterns of these two receptors are distinct.
TLR8 is constitutively expressed by myeloid
DC (mDC), monocytes, and macrophages in humans.
It is the cellular expression
patterns, rather than the nature of the TLRs themselves,
that is likely responsible for the differing cytokine profiles
evoked by TLR7 and TLR8 (predominantly pDC-derived
IFNα for TLR7 and mDC-derived proinflammatory cytokines
for TLR8). Murine TLR8 does not
respond to conventional TLR7/8 ligands and, until recently
, was considered to be nonfunctional in
mice. These interspecies variations are an important consideration
when comparing RNA-mediated immune activation
in murine and human model systems. The precise nature of the RNA motifs recognized by
TLR7/8 remains obscure. We originally described siRNA
duplexes with GU-rich sequences as being highly immunostimulatory
and identified 5′-UGU-3′ motifs within particular
siRNAs that apparently confer this activity. Substitution of the uridine groups in this motif significantly reduced immunostimulatory capacity of the duplex,
whereas introduction of the 5′-UGU-3′ motif into an
siRNA duplex had the opposite effect. By inserting GU-rich
sequences, we have shown that it is possible to select functional
siRNA duplexes with inherently high immunostimulatory
capacity. Thus for the proper activation of TLR-8 the GU rich sequence was prepared and was used as siRNA fragment of 21ntd.
"
