Team:UChicago/Plan

pUB110 BioBrick -Digest pUB110 w/ NdeI and AflII--> gel purify-->nanodrop for concentration -Digest pUB110 linker w/ NdeI and AflII linker: attcgtcttaaggaattcgcggccgcttctagagtactagtagcggccgctgcagcatatgtcatac gtatgacatatgctgcagcggccgctactagtactctagaagcggccgcgaattccttaagacgaat -Set up overnight ligation of digested, gel purified pUB110 and digested pUB110 linker = generates pUB110 BioBrick -Transform into B. subtilis to amplify -Set up O. N. cultures -Do B. subtilis miniprep -Digest our pUB110 BioBrick To test pUB110 Biobrick (kanamycin resistant) construction (send for sequencing) -Put a promoter/upstream BioBrick (in vector with chloramphenicol resistance) + RFP BioBrick from amp resistant vector => do 3 step assembly -Do transformation in B. subtilis -Choose transformants--> if transformants express RFP, we could conclude our pUB110 BioBrick works--> submit pUB110 BioBrick kerA BioBrick -Put our kerA biobrick into an empty vector w/ amp resistance (so we can use the 3 step assembly) and transform into DH5-a -Since promoter/upstream biobrick will be in chloramphenicol resistant vector -And our puB110 vector will use kanamycin resistance -So that leaves our kerA biobrick the vector that is amp resistant Orange: prefix Green: suffix Purple: kerA Sac signal peptide