Team:IIT Delhi/Biobrick

---

BBa_K1170000

Acid Shock Response (asr) promoter is an acid-inducible promoter sequence, present in the genome of E. coli K12 bacteria.



Fig 1: Position of acid shock response (asr) gene in the genome of E. coli K12. +1 site denotes the Transcriptional Start Site of the asr gene, -10 denotes the TATA box and the “Pho Box” denotes the TF site that is regulated by “Pho operon” in E. coli.


When performed in LPM (Low Phosphate Minimal) media, induction due to asr promoter is almost 100 times at it’s most optimal pH, i.e. 4.8, as compared to pH 7.0 [1].



Fig 2: Northern Blot Analysis of the RNA isolated from E. coli K12 strain induction at two different pH at multiple time intervals, indicates significant production of mRNA transcribed under the P-asr promoter.


We identified a minimal promoter region of 178bp, just before the ORF of the asr gene, that included the observable regulatory regions for acid induction.

CGATCAAGACTACTATTATTGGTAGCTAAATTTCCCTTAAGTCACAATACGTTATTATCAACGCTGTAATTTATTCAGCGTTTGTACATAT
CGTTACACGCTGAAACCAACCACTCACGGAAGTCTGCCATTCCCAGGGATATAGTTATTTCAACGGCCCCGCAGTGGGGTTAAATGA

We designed the following primers for this sequence and PCR amplified the fragment from E. coli K12 genome (these are not in Standard Biobrick configuration as, initially, we used pUC19 as our vector for cloning):

FP: GTCGAATTCCGATCAAGACTACTATTATTGGTAGCT (36) (EcoRI site)
RP: GTAGGATCCTCATTTAACCCCACTGCGGGGCCGTTGAAATAAC (43) (BamHI site)