Team:Virginia/Results

FtsZ Quantification and Its Importance

A critical step towards fully understanding FtsZ’s role in the expression of the minicell phenotype is to develop a quantitative relationship between the production of FtsZ protein and the formation of minicells. For our biobrick in particular, the production of FtsZ protein is controlled by the concentration of IPTG added. Therefore, in order to characterize the efficiency of our biobrick, we must map the connection between these three factors.

The IPTG concentration can be varied when inducing minicell production in our E.coli cells and their minicell count can be determined through our purification and quantification protocols. This, however, excludes FtsZ production from the equation. In order to determine the quantity of FtsZ protein produced, we plan to take our generated minicell samples after purification, after the E.coli have stopped producing additional FtsZ, and run them through a detailed Western blot protocol that will be able to properly quantify the amount of FtsZ protein produced from our given samples (produced under varying IPTG concentrations) through Li-cor imaging.

In order to make FtsZ protein that can be detected through Western blotting. We are in the process of developing two additional biobricks. These biobricks will include the IPTG-inducible promoter, RBS, FtsZ protein with an HA tag inserted into either the N or C terminus (one biobrick for each HA tag in the two given locations), and a terminator. This biobrick is similar to our final construct with the exceptions of the added HA tag to FtsZ and the exclusion of GFP. The protocol for using these biobricks to induce minicell formation is not expected to differ from the protocol used with the original construct. However, these new biobricks have the added benefit of detectability by an Anti-HA primary antibody through Western blotting and will allow us to better analyze the relationship between promoter, protein, and minicells.

We have made some progress towards the development of these HA tagged FtsZ biobricks. So far, we have isolated FtsZ genes using primers with HA tags through PCR amplification. This process created genes with HA tagged sequences 5’ TATCCGTATGATGTGCCGGATTATGCG 3’ inserted into either the N or C termini (Fwd HA and Rev HA) of the FtsZ sequence. These PCR products will later be digested and ligated onto BBa_K215000 and BBa_B0015, in order to form two new functional biobricks.