"

From 2013.igem.org

Results

Colonies	Alignment File	Sequence
I C5	Sequencing of clone I C5 with DN_07	Amino Acid Substitution
I C7	sequencing insufficient	-
I C12	sequencing insufficient	-

Vector Maps and Primers

As pointed out before, we ordered new shorter and HPLC purified primers for the assembly of pHM04 as well as for the mutagenesis.

Identifier	Order date	Note	Sequence
HM_20:BB_HPLC_rev	11-09-2013	HPLC version of HM11 Gibson-Primer rev, amplify the Backbone with overlap with the RBS and the lacI-promotor and it creates and overlap to the start of DelH	GATTTGGCGCAGGCGGCCACGGTCCATctagtatttctcctctttc
FS_77:BB_HPLC_rev	11-09-2013	Gibson-Primer rev, amplify the Backbone with overlap with the RBS and the lacI-promotor and it creates and overlap to the start of DelH	GCGATTTGGCGCAGGCGGCCACGGTCCATCTAGTATTTCTCCTCTTTC
HM21:fw_lacI_BbsI_Xba	2013-09-15	Forward primer for cutting out mutated fragment for mutagenesis	TTTTGAAGACAA CTAGGCAATACGCAA
HM22:rev_RBS	2013-09-15	Reverse Primer in RBS for mutagenesis	TTTTGAAGACAA CTCTTTCTCTAGTATGTGTGAAATTG
HM23:fw_RBS	2013-09-15	Forward Primer in RBS for mutagenesis	TTTTGAAGACAA AGAGGAGAAATACTAGATGGACCGTGGC
HM24:rev_BbsI_MfeI	2013-09-15	Reverse primer for cutting out mutated fragment for mutagenesis	TTTTGAAGACAA AATTGGACAGCGCGGCATGCCGGTTG