"
Team:NTNU-Trondheim/Experiments and Results
From 2013.igem.org
There were essentially four DNA pieces that we wanted to combine together to make a construct: The tat signal sequence followed by GFP, a small linker region and RFP put into a plasmid backbone. As our cloning techniques rely on overlapping DNA fragments we used mostly primers with overhengs in the PCR reactions. As templates we used the biobricks
Table: Primers applied in creating the tat_GFP_l_RFP construct. Lowercase letters indicate DNA that anneal to the template whereas the uppercase letters indicate DNA that serves as an overhang.
| Amplifing | Primer | Sequence |
|---|---|---|
| tat | F_pl.b_tat | AGAGAAAGAGGAGAAATACTAGatggccaataacgatctctttcaggcatcacg |
| tat | R_tat | cgcttgcgccgcagtcgcacgtcg |
| GFP | F_tat_GFP | CGACGTGCGACTGCGGCGCAAGCGatgcgtaaaggagaagaac |
| GFP | R_l_GFP | ACTACCACCGGATCCACCTGATCCACCGGATCCACCtttgtatagttcatccatgcc |
| RFP | F_l_RFP | GGTGGATCCGGTGGATCAGGTGGATCCGGTGGTAGTatggcttcctccgaagacg |
| RFP | R_pl.b_RFP | GCCTTTCGTTTTATTTGATGCCTGGgcgatctacactagcactatcagcg |
| Plasmid backbone | F_pl.b | ccaggcatcaaataaaacgaaagg |
| Plasmid backbone | R_pl.b | ctagtatttctcctctttctctagtagtgc |
The linker region is going to be only 36 bp long and will therefore be created by overlapping overhengs on the reverse primer of GFP and forward primer of RFP. The primers for the plasmid backbone is designed to include the TetR repressible promoter (BBa_R0040), RBS (BBa_R0034) and two terminators (BBa_R0010) and (BBa_R0012) in the PCR product. All of the PCR products were treated with the enzyme DpnI that digests methylated DNA and purified by the QIAquick PCR Purification kit.
Our overlapping DNA fragments; tat, GFP, RFP and plasmid backbone was cloned together by Gibson Assembly and transformed into ‘’E.coli’’ strain ER2566 cells. The photograph below shows two of the resulting colonies (named ER1 and ER2) from this transformation.
Figure: Two of the transformed colonies with the tat_GFP_l_RFP construct. Hereby named ER1 and ER2.
The plasmid from the ER1 samples was isolated by the Promega Wizard Plus SV Minipreps DNA Purification System A1460 and sequenced. Figure below shows the alignment of the sequencing results with the reference DNA sequence.
Figure: Aligment of tat_GFP_l_RFP (ER1) with reference DNA.
The sequence align almost perfectly. There seems to be some sort of extra insert at the linker region, but this insert is dividable by 3, so the reading frame is maintained. This is supported by the fact that the colonies with this construct is red (see figure above).
Red ER1-cells in liquid media was immobilized in agar and then viewed in a confocal microscope for seeing if RFP was localized in the periplasm. The results can be seen in the two figures below:
Figure:
Figure:
There is no indication that the red fluorescence is more concentrated in the periplasm, as we should expect due to the transport through the tat transport pathway. We performed a excitation and emission scan of the ER1 bacterias together with ''E-coli'' strain ER2566 cells that were transformed to produce single RFP. The samples were centrifuged and the pallets were resuspended in DPBSS buffer. These solutions were den studied in a fluorometer(see figures below):
Figure:Excitation scan of ER1, ER2 and the referance sample with RFP
Figure:Emission scan of ER1, ER2 and the referance sample with RFP
There are no significant differance between the referance sample and the ER samples. It seems that GFP is not present or doesn't fold properly. All of the samples had an excitation/emission at 584/607 which is the same as for singel RFP (BBa_1010).
Vesicles were isolated from ER1 cells and wildtype ‘’E.coli’’ strain ER2566 cells by the Figure:Ladder applied is Precision Plus ProteinTM Unstained Standards. WT stands for wildtype and is the unstransformed ER2566 samples.
There are no additional bands in the ER1 samples compared to the unstransformed ER2566 sample, indicating that there is no GFP-RFP in the vesicles. There was run an excitation scan of the undiluted vesicle ER1 sample that was compared to a same scan on vesicles from wildtype bacteria. The results were as shown in the two figures below.
Figure:Fluorescence excitation scan of vesicles from the ER1 cells (left) and wildtype ER2566 (right).
Figure:Fluorescence excitation scan of vesicles from the ER1 cells (left) and wildtype ER2566 (right).
There is no real difference between the samples other than strength of the signals. Both samples have peaks at 504, 540 and 582 nm. It is likely that there is no detectable GFP-RFP dimer in the vesicles.
