Team:Virginia/Results

Setup

After the Biobrick plasmids had all been made, their efficacy and functioning was tested. The first step in that process was to determine the relative growth rate of the XL1-Blue cells that all the plasmid constructs were tested in. The growth curve and its associated data can be seen below and the relative growth was approximately as anticipated for this strain of E.coli.

Data Collection: Characterizing the Functionality of the IPTG Inducible Promoter

In order to characterize the functionality of the IPTG inducible promoter and its control over the expression of GFP and overexpression of GFP, XL1-Blue cells with the plasmid construct were grown up in LB media with a wide array of IPTG concentrations. This was achieved by adding the appropriate amount of stock 100mg/mL solution to the cells in 7mL of LB media after their measured optical densities were 0.1 Absorbance units at a wavelength of 600nm. The absorbance values were measured using a standard spectrophotometer using plain LB media as the blank. After the cells had been exposed to the IPTG for 30 minutes, an initial image using a 400x fluorescence microscope was taken of a section of 20 µL slide sample. This served as evidence for the immediate effects of the added IPTG. A second image was then taken after 14 hours of IPTG exposure and this served evidence for the long-term effects of the added IPTG on the cells. This approximate imaging relies on the assumption that the cells were roughly evenly distributed in the growth medium. Though it is simply a rough estimate, it was determined to be the most time and cost effective method of characterizing the IPTG inducible promoter. The solutions concentrations were determined using simple dilution stoichiometric chemistry.

These cells were then analyzed by manipulating the images and then using the analyze particles function to count the number of cells (of any variety) that were present in the image. This process is outlined in Figures 2-4 below. All of the cells examined fluoresced and showed signs of potential minicell formation. This indicated a certain leakiness in the promoter before data analysis had even begun. It should also be noted that some of the cells appear larger than they are due to the glare that occurs due to the light scattering from the fluorescent molecules present.

Conclusions:

A range of IPTG concentrations were tested in order to find an optimal dosage for the IPTG-induced expression of FtsZ. The range of concentrations we tested was informed by both expert opinion and through computer modeling. In the 1-hour samples graph, it can be observed that after one hour of IPTG addition, the gene is already active within the first cell cycle. There is some leakiness observed in the promoter without any addition of IPTG, but all concentrations between 20-150 µM produce the same relative amount of minicells observed, within the first or second division cycle after IPTG addition.

The data collected from the images of the cell cultures after 14 hours of IPTG exposure appears to validate the hypotheses of there being a threshold concentration of IPTG at which the formation of spherical minicells is no longer likely to occur. Around 40 µM IPTG the processed image appears to indicate a maximal number of total cells, but also a near maximal number of minicells. Between 0 and 100 µM IPTG, there seem to be the most viable spherical minicells present in the 14-hour samples. Above 100 µM IPTG the presence of the tubular rod cells becomes prevalent and they begin to dominate the spectrum of cells present in the images at higher concentrations of IPTG.

It is unclear why the number of cells observed for the sample without added IPTG in the 1-hour samples was so much lower than the other 1-hour samples. It has been suggested that this could be due to minicell production being able to occur faster than normal cell division due to a lesser mass accumulation needing to occur or because of some other altered division mechanism.

All the 1-hour samples appeared to show evidence for minicells being present and in the samples with IPTG having been added to the cell culture, both the total cell count observed and the apparent minicell cell count seemed to be relatively high. This indicates that optimal duration of IPTG exposure for minicell formation with the plasmid may be on the shorter side. If minicells were going to be produced to be loaded with pharmaceuticals or other chemicals, then this minimal exposure time would be optimal. For industrial purposes, shortening the length of a phase of production leads to not only quicker production of a potential product, but also saving money if the process is being done under conditions that would require more energy to maintain phase conditions. These results also suggest that finding a minimum value for the concentration of IPTG needed for the same approximate yield of minicells would likely be possible (this is indicated by the leveling out that can be seen in the graph in Figure 9).

The 14-hour samples yielded results that are supported by previous modeling and hypotheses made after expert consultation. The undesirable rod cells are the most common cell type at the higher IPTG concentration. The mechanism by which this occurs is not completely understood though. Some have suggested that because the protein degradation rate of the GFP is negligible and the protein degradation rate of FtsZ is greatly exceeded by the protein production rate in the presence of the activated plasmid, that there is an accumulated increasing concentration of these proteins in later cell generations. Others suggest that the IPTG levels inside the cells are not able to reach their highest levels until many hours have passed and previous generations of cell have passed down more IPTG saturated cell contents. The diffusivity of the IPTG across the cellular membrane was not modeled and should be considered in future models and experimentation. In order to gain a better understanding of the mechanism causing the rod formation, HA tagged FtsZ is currently being made in order to allow for FtsZ quantification by Western Blotting. Regardless of the mechanism by which these events occurred, both rods and the desired spherical fluorescent minicells were obtained from these samples after the 14 hour experimentation period. These were then purified by centrifugation and treatment with antibiotic to result in the mix of dead parental cells and minicells that can be seen in Figure 10.

There were two methods tested for minicell purification, including a sucrose gradient protocol and a differential centrifugation and filtration protocol. Each method confers different advantages in cost and time. Although both protocols are very effective in achieving minicell purity, the differential centrifugation and filtration protocol typically yielded more minicells with greater overall purity, including the removal of cell debris and free endotoxins. Following differential centrifugation of our minicell culture for 10 minutes at 2000 xg, purity of the sample was increased from an average particle size of 1.449 µm to 1.241 µm. Therefore, 82% of the parent cells were removed. However, it should be noted that this is a conservative estimate based on the limitations of the Beckman Coulter Multisizer, which does not size particles under 0.4 µm.

FtsZ Quantification and Its Importance

A critical step towards fully understanding FtsZ’s role in the expression of the minicell phenotype is to develop a quantitative relationship between the production of FtsZ protein and the formation of minicells. For our biobrick in particular, the production of FtsZ protein is controlled by the concentration of IPTG added. Therefore, in order to characterize the efficiency of our biobrick, we must map the connection between these three factors.

The IPTG concentration can be varied when inducing minicell production in our E.coli cells and their minicell count can be determined through our purification and quantification protocols. This, however, excludes FtsZ production from the equation. In order to determine the quantity of FtsZ protein produced, we plan to take our generated minicell samples after purification, after the E.coli have stopped producing additional FtsZ, and run them through a detailed Western blot protocol that will be able to properly quantify the amount of FtsZ protein produced from our given samples (produced under varying IPTG concentrations) through Li-cor imaging.

In order to make FtsZ protein that can be detected through Western blotting. We are in the process of developing two additional biobricks. These biobricks will include the IPTG-inducible promoter, RBS, FtsZ protein with an HA tag inserted into either the N or C terminus (one biobrick for each HA tag in the two given locations), and a terminator. This biobrick is similar to our final construct with the exceptions of the added HA tag to FtsZ and the exclusion of GFP. The protocol for using these biobricks to induce minicell formation is not expected to differ from the protocol used with the original construct. However, these new biobricks have the added benefit of detectability by an Anti-HA primary antibody through Western blotting and will allow us to better analyze the relationship between promoter, protein, and minicells.

We have made some progress towards the development of these HA tagged FtsZ biobricks. So far, we have isolated FtsZ genes using primers with HA tags through PCR amplification. This process created genes with HA tagged sequences 5’ TATCCGTATGATGTGCCGGATTATGCG 3’ inserted into either the N or C termini (Fwd HA and Rev HA) of the FtsZ sequence. These PCR products will later be digested and ligated onto BBa_K215000 and BBa_B0015, in order to form two new functional biobricks.