"
Team:Evry/Notebook/w7
From 2013.igem.org
Week 7: 29th July - 4th August
Construction of plasmid N°1
We make an electrophoresis with 5 µL of plamsid to check the plasmid purification made on the last friday.
Mettre l'image légendée ici
There is not the 3 bandes that we sould see, so to check another time, we make a digestion with Pst I and EcoR I:
- NEB Buffer 10X 5 µL
- BSA 10X 5 µL
- DNA 2 µg
- PstI 2 µL
- EcoRI 2 µL
- Water 50 µL
Construction of plasmid N°2
Our plasmid N°2 is building with a synthetic promote sequence which is composed of:
- Andersen's promotor
- Fur Binding Site (15 different)
- RBS
- sfGFP
- Terminator
Golden Gate
In order to associate these sequences we performed a golden gate, using for each sample :
- 80 ng of Andersen's promotor
- 80 ng of Fur Binding Site
- 80 ng of RBS
- 80 ng of sfGFP
- 80 ng of Terminator
- 1.5 µL of T4 buffer (10X)
- 15 Unit of T4 ligase
- 2.5 Unit of Bsa I
The Golden Gate products are chemically transformed into E. coli Top 10 strains. After the transformation process, bacteria are plated into LB medium with carbenicillin and icubated overnigth at 37°C.
Golden Gates plates are composed at 98% of red colonies. The problem was probably on the equimolarity ratio between our different part which were not totally respected. We isolated white colonies (4 maximum by each sample) on LB medium with carbenicillin and we incubated them overnight at 37°c.
We made pre culture (V = 10 mL), using bacterial colonies isolated from our plates of Golden Gate transformation. Then minipreps and glycerol conservation were made using these pre cultures.
| Fur Binding Site | Sequence | Clone | Concentration |
|---|---|---|---|
|
Fur BS 1 |
ATTATTGATAACTATTTG |
Clone n°1 |
80.8 ng/µL |
|
Clone n°2 |
83.8 ng/µL |
||
|
Clone n°4 |
90.3 ng/µL |
||
|
Fur BS 2 |
GATAACTATTTGCATTTGCA |
Clone n°1 |
68.6 ng/µL |
|
Clone n°2 |
77.4 ng/µL |
||
|
Clone n°3 |
68.0 ng/µL |
||
|
Fur BS 3 |
CAAATGCAAATAGTTATCCA |
Clone n°1 |
79.4 ng/µL |
|
Clone n°2 |
110.5 ng/µL |
||
|
Clone n°3 |
457.4 ng/µL |
||
|
Fur BS 4 |
CAAATAGTTATCAATAATCA |
Clone n°1 |
73.2 ng/µL |
|
Clone n°2 |
66.2 ng/µL |
||
|
Fur BS 5 |
GTAAATTAATATTATTTACA |
Clone n°1 |
57.2 ng/µL |
|
Fur BS 6 |
AATAATGCTTCTCATTTTCA |
Clone n°1 |
63.8 ng/µL |
|
Fur BS 7 |
ATAAATGATAATCATTATCA |
Clone n°1 |
70.6 ng/µL |
|
Fur BS 8 |
GAAAATAATTCTTATTTCCA |
Clone n°1 |
75.6 ng/µL |
|
Clone n°2 |
87.2 ng/µL |
||
|
Clone n°3 |
48.8 ng/µL |
||
|
Clone n°4 |
57.8 ng/µL |
||
|
Fur BS 9 |
AGCACTTATTATTATTTTCA |
Clone n°1 |
58.6 ng/µL |
|
Fur BS 10 |
GATAATTGTTATCGTTTGCA |
No Clone |
- |
|
Fur BS 11 |
GATAATGCTTATCAAAATCA |
Clone n°2 |
75.6 ng/µL |
|
Clone n°3 |
398.0 ng/µL |
||
|
Clone n°4 |
57.4 ng/µL |
||
|
Fur BS 12 |
CAAAATTATTATCACTTTCA |
Clone n°1 |
50.0 ng/µL |
|
Fur BS 13 |
AATAATGATTACCATTCCCA |
Clone n°2 |
70.7 ng/µL |
|
Fur BS 14 |
GAAATTGTTTTTGATTTTCA |
Clone n°1 |
42.7 ng/µL |
|
Clone n°2 |
32.8 ng/µL |
||
|
Clone n°3 |
37.8 ng/µL |
||
|
Clone n°4 |
45.7 ng/µL |
||
|
Fur BS 15 |
GTTAATTGTAATGATTTTCA |
Clone n°1 |
37.0 ng/µL |
|
Clone n°2 |
53.2 ng/µL |
||
|
Clone n°3 |
196.0 ng/µL |
Construction of plasmid N°3
29/07/13 We received the primers ordered on friday the 26th of July and started to dilute them into TrisCL at 10 mM. Secondly, we diluted the previous stock solution at a rate of 1/20th to obtain a final concentration of 5 µM for our intermediate solution. Then, for our plasmid three construction, we need to first extract the 6 enterobactin gene (EntA, EntB, EntC, EntD, EntE and EntF). The ordered primers from friday will theoretically extract them in the appropriate Golden Gate format with their own RBS upstream (designed from Salis RBS). This will allow us to construct our two N°3 plasmids, one containing EntA, EntD and EntF, and the other one EntB, EntC and EntE. The genes are spread like this to obtain two equivalent plasmids xxx We proceeded to a genomic extraction of the 6 genes of interest and migrated to PCR products on a 1% gel. We successfully extracted 5 out of the 6. 30/07/13 We annealled the oligonucleotides of the PL-LacO part in the golden gate format. Also, we extracted the sfGFP with the RBS upstream which will allow us to construct the control positive plasmid 3 for future TECAN experiments. 31/07/13 We started by purifying our 6 succesful PCR extraction from the 29/07 and 30/07. So we managed to extract EntA, EntB, EntC, EntD and EntF from E. coli's genomic DNA and sfGFP in the golden gate format with a RBS (plasmid 3 construction) from plasmidic DNA. Additionnaly, we optimized our PCR to extract our missing gene, EntE. We obtained a smear +/- a double band. As a consequence, we adjusted the annealing temperature with a range from 54°C to 66°C. This will allow us to try extracting the missing gene (EntE) in the appropriate conditions. 01/08/13
We made a PCR for the EntE gene with a gradient of temperature to know at which temperature the PCR result were the best.
We made 8 (ou mettre 6 ?) tubes with the same composition:
- Water
- Taq Buffer 5
- dNTPs
- Rev EntE 2,5
- For EntE 2,5
- DNA 0,5
- Taq polymerase 0,5
After electrophoresis, we obtain the best band at .. °C.
However our experiment have been made with Taq polymerase (and Taq Buffer) instead of Q5 (and Q5 buffer) that we use usually. Then, we have to repeat this experiment with Q5 and Q5 buffer.
The did a gradient PCR and migrated on a gel our samples. On the gel, we notice that both the smear and the double band disappear when the annealing temperature increases. So to conclude, we run tonight a PCR with Q5 polymerase with increasing temperature starting from 56 degrees. The absolute annealing temperature will be determined for the Q5 (not extrapolable from a OneTaq PCR). Also, we made a golden gate for the construction of plasmid 3. For analysis purposes, only a GFP was added downstream of the PL LacO promoter. Also, the EntE gene is still to be extracted from the genome. Also, we runned 3 extras golden gate for the construction of plasmid 2. In fact, we corrected our calculations because we initially we used mass concentrations instead of molar concentrations. 02/08/13
The transformations of the golden gate 2 and 3 are successful and we managed to invert the rate of red colonies versus white colonies (red = false positive with mRFP, white = positive), thus meaning we have a lot of white ones! We conserved the plates for future isolation on coming monday. Additionnaly, we migrated the PCR products of 01/08. The gel is empty, but the positive controls are there, meaning we made a mistake in the primers (the master mix is the one used for the positive control).
