"
Team:Heidelberg/Templates/DelH week7
From 2013.igem.org
Contents |
10-06 - 16-06-13
Characterization of DelH plasmid of 02-06
| Template | 15 x 1 µl of ligated plasmid |
|---|---|
| Expected length [bp] | 663 |
| Named | 1-15 |
| Primer fw 100 µM | 15 x 0.2 µl VF2 |
| Primer rev 100 µM | 15 x 0.2 µl DN07 |
| Dream-Taq Polymerase (2x) | 15 x 10 µl |
| ddH2O | 15 x 8.6 µl |
| Cycles | Temperature [°C] | Time [s] |
|---|---|---|
| 1 | 94 | 180 |
| 12 | 94 | 20 |
| 66 (touchdown -0.5°C) | 20 | |
| 72 | 45 | |
| 18 | 94 | 20 |
| 62 | 20 | |
| 72 | 45 | |
| 1 | 72 | 5 min |
| 1 | 4 | inf |
Re-PCR of DelH fragment F1a & F1b
Result
Expected band: 5 Kb.
File:20130610 2log F1a F1b-RE-PCRs.png
Fig.7.1 Gel of Re-PCR of DelH-F1a and DelH-F1b (loaded 20 µL)
l1 2 log ladder, l2F1a, l3 F1b
no specific band at expected 5 Kb
l1 2 log ladder, l2F1a, l3 F1b
no specific band at expected 5 Kb
There are no specific bands at 5 Kb.
- => We therefore failed to reamplify DelH F1a and F1b from the PCR product.
- => Additionally, in the elctroporated colonies, there is no fragment F1a and F1b.
- => We need to design new forward primers for DelH F1a & F1b.
Amplification of DelH F1a
New Primers
| Identifier | Order date | Note | Sequence |
|---|---|---|---|
| DN09:DelH_f1_fw_long | 2013-06-11 | Amplification of DelH F1a from the genome: doesn't work | ATGGACCGTGGCCGCCTGCGCCAAATCG |
| DN10:DelH_f1_fw_short | 2013-06-11 | Amplification of DelH F1a from the genome: doesn't work | ATGGACCGTGGCCGCCTGC |
| DN11:DelH_f1_fw_short2 | 2013-06-11 | Amplification of DelH F1a from the genome: works!!!! | GCCGCCTGCGCCAAATCG |
| DN12:DelH_f1_PacI_fw_short | 2013-06-11 | Amplification of DelH F1a from the genome: doesn't work | ttttttaattaatcacacaggaaagtactagATGGACCGTGGCCGCCTGC |
PCR Conditions F1a.W7.A
| Reagent | DelH_f1_fw_long | DelH_f1_fw_short | DelH_f1_fw_short2 | DelH_f1_PacI_fw_short |
|---|---|---|---|---|
| Expected length [bp] | 5 Kb | 5 Kb | 5 Kb | 5 Kb |
| Template | 1 µl D. acidovorans glycerol stock | 1 µl D. acidovorans glycerol stock | 1 µl D. acidovorans glycerol stock | 1 µl D. acidovorans glycerol stock |
| Primer 10 µM fw | 2.5 µl DelH_f1_fw_long | 2.5 µl DelH_f1_fw_short | 2.5 µl DelH_f1_fw_short2 | 2.5 µl DelH_f1_PacI_fw_short |
| Primer 10 µM rev | 1 µl DelH_EcoRI_rev | 1 µl DelH_EcoRI_rev | 1 µl DelH_EcoRI_rev | 1 µl DelH_EcoRI_rev |
| Phusion Master Mix (2x) | 25 µl | 25 µl | 25 µl | 25 µl |
| ddH2O | 19 µl | 19 µl | 19 µl | 19 µl |
Because the annealing temperature of DelH_f1_fw_long is 77,4°C and of the primer DelH_EcoRI_rev is 69,6°C, a 2-step PCR was performed.
| Cycles | Temperature DelH_f1_fw_long [°C] | Time [s] | Cycles | Temperature else [°C] | Time [s] | |
|---|---|---|---|---|---|---|
| 1 | 98 | 30 | 1 | 98 | 30 | |
| 30 | 98 | 5 | 30 | 98 | 5 | |
| - | - | 66 | 5 | |||
| 72 | 2:15 min | 72 | 2:15 min | |||
| 1 | 72 | 7 min | 1 | 72 | 7:00 min | |
| 1 | 4 | inf | 1 | 4 | inf |
- Using hot start at 98°C
Result
Expected band: 5 Kb
File:15.06.IGEM-DelH-fragment1a.png
Fig.7.2 Gel of amplified DelH-1a fragment with different fw primern (loaded 20 µL)
l1 2 log ladder, l2F1a, l3 F1a
l2 DelH-1a fragment shows a specific band ~ 5 Kb
l1 2 log ladder, l2F1a, l3 F1a
l2 DelH-1a fragment shows a specific band ~ 5 Kb
There is a specific band at 5 Kb for DN11. The other primers show only unspecific products.
- =>The DN11 primer will be used. Using PCR conditions F1a.W7.A and short2 primer, the PCR was repeated to produce more product.
