"

From 2013.igem.org

Contents 1 16-09 - 22-09-13 1.1 Generation of DelH Plasmid pHM04 15-09 1.1.1 Colony-PCR Conditions CP.W21.A 1.1.2 Result 1.1.3 Test Restriction Digest 1.1.4 Result 1.2 Amplification of Backbone 1.2.1 New Template 1.2.2 PCR Conditions BB.W21.A 1.2.3 Result 1.2.4 PCR Conditions BB.W21.A 1.2.5 Result 1.3 Generation of DelH Plasmid pHM04 18-09 1.3.1 Gibson Assembly 1.3.2 Electroporation 1.3.3 Colony-PCR CP.W21.A 1.3.4 Result 1.3.5 Colony-PCR CP.W21.B 1.3.6 Result 1.3.7 Test Restriction Digest 1.3.8 Result 1.3.9 Sequencing 1.3.10 Result 1.4 Amplification of Backbone 1.4.1 PCR Conditions BB.W21.B 1.4.2 Result 1.4.3 PCR Conditions BB.W21.C 1.4.4 Result 1.5 Generation of DelH Plasmid pHM04 20-09 1.5.1 Gibson Assembly 1.5.2 Electroporation 1.6 New HPLC Purified Primers 1.7 Mutagenesis of DelH clones I 6B and 15 1.7.1 Strategy 1.7.2 New Primers 1.7.3 Purification of Midiprep of Clone I6B 1.7.4 Result 1.7.5 Amplification of HM23 to HM24 1.7.6 Result 1.7.7 Amplification of HM21 to HM22 1.7.8 Result 1.7.9 Restriction Digest of pHM04 (I6B) with XbaI and MfeI 1.7.10 Result 1.7.11 Restriction Digest of pHM04 (I6B) with XbaI and MfeI 1.7.12 Result 1.7.13 Test for MfeI Cutting Site 1.7.14 Restriction Digest of Fragment HM21-HM22 (I6B) and HM23-HM24 (I6B) with BbsI 1.7.15 Ligation of Digested pHM04 (I6B), HM21-HM22 and HM23-HM24 1.7.16 Transformation of Ligation

16-09 - 22-09-13

Generation of DelH Plasmid pHM04 15-09

Colony-PCR Conditions CP.W21.A

Template	96x 1 picked colony
Expected length [bp]	663
Named	1A - 12H
Primer fw 10 µM	100x 2 µl VF2
Primer rev 10 µM	100x 2 µl DN07
iTaq Polymerase (2x)	100x 10 µl
ddH2O	96x 6 µl

Cycles	Temperature DelH [°C]	Time [s]
1	95	120
12	95	30
	68 (touchdown -0.5°C)	30
	72	45
18	95	30
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp

The following colonies seem positive, because they show the expected band at 663 bp.

Picture	Positive colonies
21.1	1B, 1C, 1E, 1F, 1H, 2A, 2B, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3F, 3G
21.2	4A, 4C, 4D, 4G, 5A, 5B, 5C, 5D, 5E, 6A, 6B, 6C, 6E, 6F
22.3	7A, 7B, 7C, 7D, 8A, 8B, 8C, 9A, 9E, 9F
22.4	11 A, 11E, 11G, 11H, 12D, 12E

Test Restriction Digest

24 of these positive screened colonies were minipreped and digested with PvuI

Sample	CutSmartBuffer	PvuI
8.5 µl of colonies	1 µl	0.5 µl

Another restriction digest was performed. Colony 7D was digested with EcoRI-HF

Sample	CutSmartBuffer	EcoRI-HF
8.5 µl of colony 7D	1 µl	0.5 µl

Result

Expected bands: 11,621, 8,690 and 2,685 bp (PvuI) and 17,801 and 5,105 bp (EcoRI)

None of the analyzed clones shows correct band pattern.

=> Clones are discarded.

Amplification of Backbone

New Template

Because the backbone amplification yield from pSB6A1 + BBa_J04450 from Spring distribution 2012 (plate 1, well K1) was so low and the screening did not result in positive restriction digests with PvuI or EcoRI, we go a step back and transform E.coli ToP10 with a new pSB6A1 part from the 2013 distribution. Therefore, we transform on the one hand with the part on plate 2 well 2L and on the other hand with the part from the plate 5 well 1K from the Spring 1023 diestricbution.
Aditionally we ran a PCR directly from the two wells with the backbone primers (HM20, HM17 & FS77).

PCR Conditions BB.W21.A

Amplification of pSB6A1 directly from the parts registry
1x PCR with HM_20 and 1x PCR with FS_77

Reagent	BB pSB6A1	BB pSB6A1	BB pSB6A1	BB pSB6A1
Expected length [Kb]	4.4	4.4	4.4	4.4
Template	1 µl pSB6A1 plate 5, well K1	1 µl pSB6A plate 2, well L2	1 µl pSB6A1 plate 5, well K1	1 µl pSB6A plate 2, well L2
Primer 10 µM fw	1 µl HM_17	1 µl HM_17	1 µl HM_17	1 µl HM_17
Primer 10 µM rev	1 µl FS_77	1 µl FS_77	1 µl HM_20	1 µl HM_20
Phusion Flash Master Mix (2x)	10	10	10	10
DMSO	1	1	1	1
ddH2O	6	6	6	6

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	58	5
	72	80
1	72	5:00 min
1	4	inf

Result

Expected band: 4. Kb

Amplification worked with the template pSB6A1 from the biobrick distribution 2013 plate 2, well L2.

=> The fragment was gel extracted with QIAquick gel extraction kit, digested with DpnI, and gel extracted again, resulting in final concentrations of 10.7 ng/µl for FS_77 and 4.8 ng/µL for HM_20

=> PCR will be repeated with several samples from the colonies transformed with pSB6A1 from the biobrick distribution 2013 plate 2, well L2

PCR Conditions BB.W21.A

Amplification of backbone fragment pSB6A1 from colonies of DH10ß, transformed with pSB6A1 from the biobrick distribution 2013 plate 2, well L2
4x PCR with HM_20 and 4x PCR with FS_77

Reagent	BB pSB6A1	BB pSB6A1
Expected length [Kb]	4.4	4.4
Template	colony of DH10B transformed with pSB6A1 plate 5, well K1	colony of DH10B transformed with pSB6A1 plate 5, well K1
Primer 10 µM fw	1 µl HM_17	1 µl HM_17
Primer 10 µM rev	1 µl FS_77	1 µl FS_77
Phusion Master Mix (2x)	10	10
DMSO	1	1
ddH2O	6	6

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	58	5
	72	80
1	72	5:00 min
1	4	inf

Result

Expected band: 4.4 Kb

Gel shows amplification of fragment.

=> Fragment was cut and gel extracted, then DpnI digested and gel purified again.

Generation of DelH Plasmid pHM04 18-09

Gibson Assembly

Fragment	Concentration [ng/µl]	Amount with BB16 (FS77) [µl]	Amount with BB16 (HM20) [µl]
DN11-FS66	172.5	1.77	1.84
FS67-FS68	120.7	2.15	2.24
FS69-FS70	211.3	2.12	2.21
FS71-HM08	146	1.24	1.30
BB16 amplified with FS77	43.1	2.72	-
BB16 amplified with HM20	35.8	-	2.42

• Incubate for 1 h at 50°C

Electroporation

• Afterwards 3 µl of each Gibson assembly were taken and 2 µl ddH₂O were added
• With 17 µl of the Gibson assembly, isopropanol purification was performed, DNA was eluted in 20 µl ddH₂O
• 6 different electroporations in E.coli BL21 DE3 were performed and grown at RT (see scheme below)

Electroporation name	Inserted amount of Gibson Assembly	Plated out on agar plates
HM20 1	3 µl (Gibson + ddH2O)	* 10 µl * rest
HM20 20	20 µl (isopropanol purified)	* 10 µl * rest
FS77 1	1 µl (Gibson + ddH2O)	* 10 µl * rest
FS77 20	20 µl (isopropanol purified)	* 10 µl * rest

Colony-PCR CP.W21.A

Template	96x 1 picked colony
Expected length [bp]	663
Named	1A - 12H DelH I
Primer fw 10 µM	100x 2 µl VF2
Primer rev 10 µM	100x 2 µl DN07
One-Taq Polymerase (2x)	100x 10 µl
ddH2O	96x 6 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	30
	68 (touchdown -0.5°C)	30
	72	45
18	95	30
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp

The following colonies seem positive, because they show the expected band at 663 bp

Picture	Positive colonies
21.12	-
21.13	C3, C5, C7, C11, C12, D1, D2, D3, D5, D6, D7, D8, D9, D12
21.14	E2, E9, F4, F11
21.15	G3, G6, G11, G12, H6, H8, H11

Colony-PCR CP.W21.B

Template	96x 1 picked colony
Expected length [bp]	663
Named	1A - 12H, DelH II
Primer fw 10 µM	100x 2 µl VF2
Primer rev 10 µM	100x 2 µl DN07
One-Taq Polymerase (2x)	100x 10 µl
ddH2O	96x 6 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	30
	68 (touchdown -0.5°C)	30
	72	45
18	95	30
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp

The following colonies seem positive, because they show the expected band at 663 bp

Picture	Positive colonies
21.16	A6, A7, A10, B2, B6
21.17	C2, C4, C6, C8, C9, C10, D2, D3, D8, D9
21.18	E7, E8, E9, E10, F6
21.19	G1, G3, G6, G7, G9, G10, H2, H3, H8, H11

Test Restriction Digest

The positive screened colonies were digested with PvuI.

Template DNA	CutSmart Buffer	PvuI	ddH2O	Total Volume
8.5 µl 1 µl	0.5 µl	-	10 µl

Result

Expected bands: 11,621, 8,628 & 2,685 bp

The following colonies show the correct pattern:

Colonies	Positive in Digest	Concentration in Midiprep [ng/µl]
I C5	+	454
I C7	+	1312
I C12	+	5995
I G11	+	3887
II A6	+	1017
II D2	+	926

Sequencing

Clones C5, C7, C12, G11, II A6 and II D2 were send for sequencing with VF2.

Result

Colonies	Alignment File
I C5	Sequencing of clone I C5 with DN_07
I C7	sequencing insufficient
I C12	sequencing insufficient
I G11	discarded
II A6	discarded
II D2	discarded

Amplification of Backbone

PCR Conditions BB.W21.B

Amplification of backbone parts registry well 2L, transformed 19-09 using HPLC purified HM11

Reagent	HM11
Template	1 µl of minipreped pSB6A1 (2L)
Primer fw 10 µM	2 µl HM11
Primer rev 10 µM	2 µl HM17
Phusion Flash Ready Mix	10 µl
ddH2O	5 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	68 (touchdown -0,5°C)	5
	72	90
18	98	1
	68	5
	72	90
1	72	5 min
1	4	inf

Result

Expected band: 4.4 Kb

Gel does not show amplified backbone fragment.

=> Further optimize PCR conditions.

PCR Conditions BB.W21.C

Reagent	HM11
Template	1 µl of minipreped pSB6A1 (2L)
Primer fw 10 µM	2 µl HM11
Primer rev 10 µM	2 µl HM17
Phusion Flash Ready Mix	10 µl
ddH2O	5 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	68	5
	72	90
1	72	5 min
1	4	inf

Result

Expected band: ~ 4.4 Kb

Gel shows strong and specific amplification of backbone.

=> Fragments were cut and gel isolated.

Generation of DelH Plasmid pHM04 20-09

Gibson Assembly

Fragment	Concentration [ng/µl]	Amount with BB16 (FS77) [µl]	Amount with BB16 (HM20) [µl]
DN11-FS66	172.5	1.77	1.84
FS67-FS68	120.7	2.15	2.24
FS69-FS70	211.3	2.12	2.21
FS71-HM08	146	1.24	1.30
BB16 amplified with FS77	43.1	2.72	-
BB16 amplified with HM20	35.8	-	2.42

• Incubate for 1 h at 50°C

Electroporation

• Afterwards 3 µl of each Gibson assembly were taken and 2 µl ddH₂O were added
• With 17 µl of the Gibson assembly, isopropanol purification was performed, DNA was eluted in 20 µl ddH₂O
• 6 different electroporations in E.coli DH10ß were performed and grown at RT (see scheme below)

Electroporation name	Inserted amount of Gibson Assembly	Plated out on agar plates
HM20 1	3 µl (Gibson + ddH2O)	* 10 µl * rest
HM20 20	20 µl (isopropanol purified)	* 10 µl * rest
FS77 1	1 µl (Gibson + ddH2O)	* 10 µl * rest
FS77 20	20 µl (isopropanol purified)	* 10 µl * rest

New HPLC Purified Primers

As pointed out before, we suspect DelH to be toxic for E. coli and therefore, only colinies containing mutated constructs survive. To avoid this, we ordered new shorter and HPLC purified primers for the assembly of pHM04.

Identifier	Order date	Note	Sequence
HM_20:BB_HPLC_rev	11-09-2013	HPLC version of HM11 Gibson-Primer rev, amplify the Backbone with overlap with the RBS and the lacI-promotor and it creates and overlap to the start of DelH	GATTTGGCGCAGGCGGCCACGGTCCATctagtatttctcctctttc
FS_77:BB_HPLC_rev	11-09-2013	Gibson-Primer rev, amplify the Backbone with overlap with the RBS and the lacI-promotor and it creates and overlap to the start of DelH	GCGATTTGGCGCAGGCGGCCACGGTCCATCTAGTATTTCTCCTCTTTC

Mutagenesis of DelH clones I 6B and 15

Strategy

As our clones which have the DelH construct keep on having mutations and deletions we decided to fix this problem by carrying out site-directed mutagenesis. The targeted mutations are the deletion of parts of the ribsome binding site in clone I6B and the deletion at the beginning of DelH in clone 15. For this we make use of two restriction enzymes (MfeI & XbaI) which both only cut in the construct once. By this we excise the fragment with the mutation. The larger fragment (17.3 kbp) without mutation is kept.
Furthermore we ordered four new primers. The smaller fragment is then PCR amplified with those primers in two fragments. Primer HM22 and HM23 cure the mutations. With those primers also recognitions sites for the restriction enzyme BbsI are introduced, which is needed for religation of the two fragments. BbsI cuts two basepair after its recognition site.

HM21 and HM24 are the corresponding primer. They introduce XbaI and MfeI sites as well as in each on BbsI recognition site. Those are needed for religation.

In the end the two fragments are both digested with BbsI. In the adjacent ligation the two fragments can ligate together due to the BbsI recognition sites. Furthermore BbsI opens the introduced MfeI and XbaI sites through which the two fragments can ligate with the digested 17.3 kb fragment.

However the XbaI site is not introduced correctly again. Therefore we can test if the mutagenesis had been successful by digesting with XbaI. If the site is not present anymore we successfully got rid of the mutations.

New Primers

Identifier	Order date	Note	Sequence
HM21_fw_lacI_BbsI_Xba	2013-09-15	Forward primer for cutting out mutated fragment for mutagenesis	TTTTGAAGACAA CTAGGCAATACGCAA
HM22_rev_RBS	2013-09-15	Reverse Primer in RBS for mutagenesis	TTTTGAAGACAA CTCTTTCTCTAGTATGTGTGAAATTG
HM23_fw_RBS	2013-09-15	Forward Primer in RBS for mutagenesis	TTTTGAAGACAA AGAGGAGAAATACTAGATGGACCGTGGC
HM24_rev_BbsI_MfeI	2013-09-15	Reverse primer for cutting out mutated fragment for mutagenesis	TTTTGAAGACAA AATTGGACAGCGCGGCATGCCGGTTG

Purification of Midiprep of Clone I6B

As can be seen in figure 21.23, the midi-prep of colony I 6B is contaminated. Thus, we tried to purify only the largest band by gel extraction with the QIAEX II Gel Extraction Kit (Qiagen). The procedure was as following:

• Application of 2 µl of midiprep on gel (4596.7 ng/µl --> ~10 µg)
• Excision of band at about 17.4 kb
• Gel extraction of DNA with QIAEX II Gel Extraction Kit (Qiagen)

Result

• The concentration of the purified fragment was only 4.7 ng/µl after extraction.
  

=> We are trying to elute again.

• The second elution did not work either

Amplification of HM23 to HM24

1x 20 µl for each colony

Template	0.2 µl of either midiprep colony I6B or 15
Expected length [kbp]	5.3
Named	I6B or 15 HM23-HM24
Primer fw 10µM	2 µl HM23
Primer rev 10 µM	2 µl HM24
Phusion Flash (2x)	10 µl
ddH2O	5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10 s
12	98	1
	68 (touchdown -0.5°C)	5
	72	1:50 min
18	98	1
	65	5
	72	1:50 min
1	72	7 min
1	12	inf

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	69	5
	72	1:50 min
1	72	7 min
1	12	inf

Template	0.2 µl of either midiprep colony I6B or 15
Expected length [kbp]	5.3
Named	I6B or 15 HM23-HM24
Primer fw 10µM	2 µl HM23
Primer rev 10 µM	2 µl HM24
Phusion Flash (2x)	10 µl
ddH2O	4 µl
DMSO	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	10 s
30	98	1 s
	72	1:40 min
1	72	7 min
1	12	inf

Result

Gels for amplification of HM23 to HM24

20130917 2log 16Bmut 15mut pSB6A1HM pSB6A1FS.png Fig.21.24	20130917 2log 16Bmut 15mut pSB6A1HM pSB6A1FS cut.png Fig.21.25	20130917 1kb pSB1C3 2log 6BVerd 15Verd 6BPCR 15PCR 1kb.png Fig.21.26	20130917 1KB PSB1C3 2LOG 6BVERD 15VERD 6BPCR 15PCR 1KB cut.png Fig.21.27
20130918 log2 I6b(23-24) I6b(23-24)DMSO 15(23-24) 15(23-24)DMSO.png Fig.21.28	20130918 log2 I6b(23-24) I6b(23-24)DMSO 15(23-24) 15(23-24)DMSOcut.png Fig.21.29

Amplification of HM21 to HM22

Template	0.2 µl of either midiprep colony I6B or 15
Expected length [kbp]	200 bp
Named	I6B or 15 HM21-HM22
Primer fw 10µM	2 µl HM21
Primer rev 10µM	2 µl HM22
Phusion Flash (2x)	10 µl
ddH2O	5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	63	5
	72	10
1	72	5 min
1	12	inf

Result

Gels for amplification of HM21 to HM22

20130918 2log 6BHM21-HM22 15HM21-HM22 midi6B maxi15 log2 pIK8.6 pSB1C3 log HM20 FS20.png Fig.21.30

20130918 2log 6BHM21-HM22 15HM21-HM22 midi6B maxi15 log2 pIK8.6 pSB1C3 log HM20 FS20cut.png Fig.21.31

Restriction Digest of pHM04 (I6B) with XbaI and MfeI

Reagent	Volume [µl]
Midiprep colony I6B or 15	0.5
Cutsmart buffer	2
XbaI	1.5
MfeI-HF	1.5
ddH2O	14.5

• Incubation for 2 h at 37°C

Result

• Expected band pattern: 17.3 kbp, 5.3 kbp

Gels for restriction Digest of pHM04 (I6B) with XbaI and MfeI

20130917 1kb pSB1C3 2log 6BVerd 15Verd 6BPCR 15PCR 1kb.png Fig.21.32

20130917 1KB PSB1C3 2LOG 6BVERD 15VERD 6BPCR 15PCR 1KB cut.png Fig.21.33

20130918 log2 2x15doubledig 2x6bdoubledig.png Fig.21.34

20130918 log2 2x15doubledig 2x6bdoubledigcut.png Fig.21.35

• The MfeI already expired in 2011

=> We will test digest the construct again with a new enzyme

Restriction Digest of pHM04 (I6B) with XbaI and MfeI

Reagent	Volume [µl]
Midiprep colony I6B or 15	0.5
Cutsmart buffer	5
XbaI	1.5
MfeI-HF	1.5
ddH2O	14.5
Incubation for 2 h at 37°C	Expected band pattern: 17.3 kbp, 5.3 kbp

Reagent	Volume [µl]
Midiprep colony I6B purified 1:10	1
Cutsmart buffer	2
XbaI	1
MfeI-HF	1
ddH2O	15
Incubation at room temperature, over night	Expected band pattern: 17.3 kbp, 5.3 kbp

Result

Due to the contamination in DelH it was not possible to decide whether the fragment really had been digested. Thus we have to test whether MfeI Cutting site is really present.

Test for MfeI Cutting Site

Reagent	Volume [µl]
Midiprep colony I6B	0.5
Cutsmart buffer	2
NotI-HF	1
ddH2O	16.5

Reagent	Volume [µl]
Midiprep colony I6B	0.5
Cutsmart buffer	2
NotI-HF	1
MfeI-HF	1
ddH2O	15.5

Incubation at room temperature over night.
--> As the upper band is lower for the digest with both enzymes the MfeI restriction site is apparently present. Therefore the mutagenesis is tried.

Restriction Digest of Fragment HM21-HM22 (I6B) and HM23-HM24 (I6B) with BbsI

PCR fragments: HM21-HM22 (36.6 ng/µl) and HM23-HM24 (32.4 ng/µl)

Reagent	Volume [µl]
PCR fragment	20
2.1 buffer	5
BbsI	1
ddH2O	24

Ligation of Digested pHM04 (I6B), HM21-HM22 and HM23-HM24

Reagent	Volume [µl]
digested and purified pHM04 (I6B)	3
digested HM21-HM22	0.5
digested HM23-HM24	0.5
T4 ligase buffer	2
T4 ligase	1
ddH2O	13

Transformation of Ligation

1 µl and 5 µl were transformed in 50 µl electrocompetent DH10β each by electroporation. The cells were recovered in 400 µl SOC media and plated on LB Amp.