"

From 2013.igem.org

Contents 1 Strategy 1.1 Vector Map, Primers and BioBricks 2 Amplification of Del Genes from DSM-39 genome 2.1 Goals 2.2 Results

Strategy

Vector Map, Primers and BioBricks

In order to transfer the delftibactin NRPS cluster from D. acidovorans in E. coli for efficient production of delftibactin, we designed the plasmid pFSN. It comprises the above listed genes as inserts. Furthermore, it includes an IPTG-inducible promoter, an origin of replication, compatible to those of the plasmids pDelH and pIK8.6 (required for delftibactin expression in E. coli) expression plasmids as well as a kanamycin resistance marker. The choice of the ori was critical, as three plasmids PFSN, pDelH and PIK8.6 would have to be cotransformed in order to obtain the final E. coli delftibactin production strain and all three plasmids needed to be stabely propagated.

Additionally, mRFP was added as last cds behind the DelRest genes onto the pFSN construct in oder to have an easy control for expression of the DelRest genes located in front of mRFP.
In the Delftibactin cluster the genes DelA, DelB, DelC, DelD, DelE, DelF and DelG are encoded as a single polycistronic operon. However, it is most likely not possible to amplify the entire coding sequence of DelA to DelG in one single PCR amplicon, as its corresponding size of 22.8 kb in combination with the complex GC-rich sequence is most likely not suitable for commonly available polymerases and PCR protocols. Consequently, we will use various primer combinations to amplify the genes in different sub-fragments. These will be assemled again using Gibson cloning
DelO and DelP are encoded in reverse-complementary direction on the Delftibactin cluster. However, in our construct these two genes will be assembled in the same orientation as the other ones and thereby added to the DelA-G operon. As DelO and DelP are also located next to each other and they will therefor be amplified together as a single 2.7 kb amplicon
DelL is the somehow lonesome rider, not surrounded by any of our desired del genes and will thus also be amplified seperately (fragment size 1.4 kb).
As complications are most likely to occure for the very long PCR amplicons, we will start with the huge DelA-G region and optimize PCR conditions for the corresponding amplicons.
We decided to use the DSM-39 substrain of Delftia acidovorans as our genomic template since our reference paper from Johnston et al. (2013) showed the gold precipitation expreiments using this substrain. The only full-length genomic sequence available for D. acidovorans is, however, the SPH-1 substrain sequence. Nevertheless, as the abovementioned paper also based their analysis on the SPH-1 strain sequence, we also based our primer designs on the available SPH-1 substrain genomic sequence, hoping the Del cluster sequence would be highly conserved among different D. acidovorans strains.

We used the following plasmid backbone part from the partsregistry:

Backbone	Part	Distribution	Plate	Well	Usage	Resistance
pSB4K5	J04450	Spring 2012	1	5G	Backbone for DelA-G,OP,L	Kanamycin

The ordered gibson primer pairs are listed below, alongside with their corresponding sequences and usage:

Identifier	Order date	Note	Sequence
FS_01: pSB4K5_DelA_rv	20-13-06-28	Amplification of pSB4K5 from the iGEM Distribution. Gibson Primer with overhang to DelA introducing the RBS BBa_B0035	TCGCGGCGATCCGGTACTGCGCCTCTGTTGAACATCTGATATTCT CCTCTTTAATCGACAGATTGTGTGAAATTGTTATCCGCTCAC
FS_02: DelAG_1_fw	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	TTCAACAGAGGCGCAGTACCGGATC
FS_03: DelAG_1_rv	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	GTCGGAGACGATGTGGTGCATCAC
FS_04: DelAG_2_fw	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	CTGCAGGCCAATGAGCACATCCTG
FS_05: DelAG_2_rv	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	CACAGGTGGTAGATGGCGTC
FS_06: DelAG_3_fw	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	ATTGCGAGGACTTGCTCGATG
FS_07: DelAG_3_rv	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	TTTGCTGCAGCGCCAGCACATCGAG
FS_08: DelAG_4_fw	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	GTACGGCCTATCACATCAGCG
FS_09: DelAG_4_rv	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	GAAGCTCAGCAGGTTGGGCGAGACG
FS_10: DelAG_5_fw	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	GAATTTTGTTCCACCACCTGCTG
FS_11: DelAG_5_rv	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome. Gibson Primer with overhang to DelOP	CTTGAGCAGGCGCAGTACCTCGGAGGGCGGTCGGCTGGCGTTTTCCATGATTCAGG TTTCCTGTGTGAAGCTCATCTCAGATATCTCCCAGAGTTTCGAGAAAG
FS_11: DelAG_5_short_rv	2013-08-02	Amplification of DelA-G from Delftia acidovorans genome.	TCAGATATCTCCCAGAGTTTCGAGAAAG
FS_12: DelOP_fw	2013-06-28	Amplification of DelO-P from Delftia acidovorans genome.	GAATCATGGAAAACGCCAGCCGAC
FS_13: DelOP_rv	2013-06-28	Amplification of DelO-P from Delftia acidovorans genome. Gibson Primer with overhang to DelL	CAATGTTGGAGGGGCCGAAGCCGATGCCGATCAGCGGGTGGGTTTGCATGGAAGGT CCTTTCATTGGGTCGATGCGTCCAGTGTCACACCGTGGTGTCTGCAGGCG
FS_13: DelOP_short_rv	2013-06-28	Amplification of DelO-P from Delftia acidovorans genome. Gibson Primer with overhang to DelL	TCACACCGTGGTGTCTGCAGGCG
FS_14: DelL_fw	2013-06-28	Amplification of DelL from Delftia acidovorans genome.	CAAACCCACCCGCTGATCGGCATC
FS_15: DelL_mRFP_pSB4K5_rv	2013-06-28	Amplification of DelL from Delftia acidovorans genome. Gibson Primer with overhang to BBa_J04450	GAAACGCATGAACTCTTTGATAACGTCTTCGGAGGAAGCCATCTAGTATTTCTCCTC TTTCTCTAGTATCAGTCCTGCAGCGCCAGCTGTTCTGTG
FS_15: DelL_mRFP_pSB4K5__short_rv	2013-06-28	Amplification of DelL from Delftia acidovorans genome. Gibson Primer with overhang to BBa_J04450	TCAGTCCTGCAGCGCCAGCTGTTCTGTG
FS_16: mRFP_pSB4K5_fw (Del)	2013-06-28	Amplification of pSB4K5 from iGEM Distribution. Gibson Primer	GCTTCCTCCGAAGACGTTATC

Amplification of Del Genes from DSM-39 genome

Goals

This week primers FS_01 to FS_16 arrived. As the aim of this week is to amplify the backbone pSB4K5 with Gibson overlaps matching our initial and very last insert fragment, we will firstly use the pSB4K5 backbone including the mRFP cassette as template for this purpose. Furthermore amplification of the desired genes from the Del-cluster of D.acidovorans DSM-39 will be carried out in parallel.

Results

The following table summarizes the outcomes of this weeks PCRs.

PCRs from D.acidovorans DSM-39
Gene(s)	Fragment	Primer combination	Successful?
DelA DelB DelC DelD DelE DelF DelG	DelA-E	FS_02 and FS_03
	DelA-F	FS_02 and FS_05
	DelA-G	FS_02 and FS_07
	DelE-G	FS_04 and FS_07
	DelF-G	FS_06 and FS_07
		FS_06 and FS_09
		FS_06 and FS_11
	DelG	FS_08 and FS_11
DelO DelP DelL	DelO-P	FS_12 and FS_13
	DelL	FS_14 and FS_15
pSB4K5	pSB4K5	FS_01 and FS_16