Team:Heidelberg/Templates/DelH overview11
From 2013.igem.org
Gibson Strategy
- PCR amplification of entire 18 Kb DelH fragment G0, as well as sub fragments G1a and G1b
- PCR amplification of backbone pSB6A1-lacI-mRFP, simultaneously inserting Gibson
- Gibson assembly of construct DelH + backbone to DelH plasmid
- Electroporation of E. coli TOP10 with DelH plasmid
- Characterization of positive (red) colonies by colony PCR
Vector Map and Primers
Identifier | Order Date | Note | Sequence |
---|---|---|---|
HM02_DelH_Gib1.1_rev | 09-07-2013 | Gibson-Primer DelH | TGCTGCGCCTGCATACGGCCAAACA |
HM03_DelH_Gib1.2_fw | 09-07-2013 | Gibson-Primer DelH | AGCGGCAGGGACGACGTGGT |
HM04_DelH_Gib1.2_rev | 09-07-2013 | Gibson-Primer DelH | CATAGAGGTTGTAGAGA |
HM05_DelH_Gib2.1_fw | 09-07-2013 | Gibson-Primer DelH | AGAACGCCGTCTTCAGGCTCCTG |
HM06_DelH_Gib2.1_rev | 09-07-2013 | Gibson-Primer DelH | CAATGCTTTG CCGCTCGAA |
HM07_DelH_Gib2.2_fw | 09-07-2013 | Gibson-Primer DelH | TCGCCACGGCAGCTGTTCGA |
HM08_DelH_Gib2_end_rev | 09-07-2013 | Gibson-Primer DelH | TCAGTCCAGCGCGTACTCCAG |
HM09_AraC_RBS_DelH_rev | 09-07-2013 | Gibson-Primer rev, introduces a new RBS and has the AraC promotor and the beginning of DelH | TTGCAAAGCGCTCGGCGATTTGGCGCAGGCGGCCACGGTCCAT ttaactTTCTCCTCTTTAATactttgagctagcccaaAaaaacggtatggagaa acagtagagagtt |
HM10_RBS_lacZ | 09-07-2013 | Gibson-Primer fw for the pSB6A1 Backbone with the end of DelH, RBS(1) and the beginning of lacZ | TGGAGTACGCGCTGGACTGA TCTAGAG AAAGAGGAGAAA TACTAG ATGACCATGATTA |