"

From 2013.igem.org

'

Primer Design

IDT’s Oligo Analyzer

Finnezymes Multiple primer analyzer
Tyler’s primer design video- Primer Design for PCR

General Guidelines:
PCR Primer Design Guidelines


Primer Design
Forward Primer:
Take the beginning of the 18~35 bases of your targeted sequence according to the melting temperature for the gene primer bind to the plasmid you want to transform into. Tms should be around 58*C to match VF2 and VR primers, unless making “hanging primers” by adding the prefix and suffix for cloning - these Tms can be a bit lower to make the combined oligo shorter.
Add the *prefix “gaattcgcggccgcttctagag” at the beginning (extend if needed)
Reverse primer:
Add the *suffix “tactagtagcggccgctgcag” to the end of the targeted sequence
Then reverse complement the whole thing (end of the 20 bases + suffix). Both primers must be listed 5’->3’ for ordering format purposes.

General notes:
-When finding the reverse complement of the end sequence, instead of writing out the reverse complement either use http://www.bioinformatics.org/sms/rev_comp.html or highlight the sequence in Ape, right click and click “Copy Rev-Com”
- The primer has to be at least 18 base pairs long ( NO LESS )
- The primer should end on an G/C for stability
When possible use the Oligo Analyzer or Multiple primer analyzer (ignore Tms):
- Click on hairpin, and looking at the structures the site pops out with. If there is a delta G value of <-2.0 add more base pairs till all values of any resulting structures are >-2.0. The reason for this is because of free energy, the primer might loop onto itself and not function anymore.
Using Ape:
- The highlighted region that you will use for primers will show “Tm” = mel temps. It should be between 40-50 degrees (THIS HAS MORE PRIORITY THAN THE delta G)

*the prefix and the suffix can be found in the following website:
http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix
(use the prefix for the non-inframe cloning, i.e. the longer one)
*match the melting temperature of forward and reverse primer
*A good way to check whether you design the primer correctly is used “find” (control +F) on a new plasmid file you construct by inserting the segment between the prefix and suffix.