"

From 2013.igem.org

{ "date" : "2013-06-06", "author" : "thomas-emil", "title" : "First SAMsynthase extraction attempt - FAILED ", "content" : "We tried to amplify the SAMsynthase gene from an extract of E.coli genomic DNA (strain MG1655). In order to do that we exploited two primers previoursly designed and synthetized.Foward: GCCGCTTCTAGAGAAGGAGGAACTACTATGGCAAAACACCTTTTTReverse: CTGCAGCGGCCGCTACTAGTATTATTACTTCAGACCGGCAGFor the protocol used see the Phusion PCR protocol..When the reaction finished, we tested the presence of the aplificate product througt an electrophoresis analisys (adding 2 µl of LD for 10 µl of DNA).Results:

As you can see from our gel image, our product is not present.The next move will be to try to amplify using a TAQ polymerase and we hope that this will work!", "tags" : "SAMsynthetase" }