"
Team:Hong Kong HKUST/Project/module3
-
Module Three
- Cell Line
- Cell Culture
-
Cell Viability
- MTT Assay
- Results
-
Fatty Acid Quantification
- Fatty Acid Treatment
- GC-MS
Protein Trafficking
Overview
In our project, we introduced bacterial enzymes to mammalian cell to modify metabolic pathway. However, unlike bacteria, citric acid cycle in mammalian cells is compartmentalized in mitochondria. The ACE proteins should be targeted to mitochondria for their functionality. To do so, we fused ACE enzymes with Mitochondrial Leader Sequence (MLS).Mechanism of MLS
MLS is attached to the N-terminal of enzyme, and bind to the receptor protein on mitochondrial membrane, and diffuse to contact site where inner and outer membrane fuse, then bring the ACE enzyme into mitochondria. Afterward, it is be cleaved, leaving the enzyme in mitochondria.Submission of BioBricks
The MLS was cloned from a commercial plasmid, pCMV/myc/mito (Invitrogen) by PCR. For the MLS BioBrick, we have submitted the MLS BioBrick in RFC 10 and RFC 25, the Freiburg format which allows protein fusion, to facilitate other team to fuse the MLS with other protein for purpose of introducing other protein into mitochondria.For characterization, MLS and green fluorescence protein was fused with constitutive mammalian CMV promoter. The promoter was cloned from pEGFP-N1 (Clonetech) in RFC10 format, since such part could not be found in partsregistry. The CMV cloned for our characterization construct was also submitted. The two construct for characterization, the CMV promoter – green fluorescent protein – polyadenylation sequence – pSB1C3 and CMV promoter – mitochondria leader sequence – green fluorescence protein – polyadenylation sequence – pSB1C3 composite parts are also submitted. Click here to see our submitted parts.
Characterization
In order to characterize mitochondria that it can translocate protein into mitochondria in standard BioBrick, we constructed CMV promoter – mitochondria leader sequence – green fluorescent protein – polyadenylation sequence – pSB1C3. We use pCMV/myc/mito.GFP (Invitrogen) as positive control, which include MLS with GFP reporter, and we built negative control, CMV promoter – green fluorescent protein – polyadenylation sequence – pSB1C3 for response without MLS. Characterization was conducted on HEK 293FT cell. If the result shows that GFP is localized in mitochondria while the negative control is scatter all around cell, we can conclude that MLS is targeting GFP into mitochondria in HEK 293FT Cell.Since we could not find a constitutive promoter BioBrick allow expression in mammalian cell, we amplified pCMV from pEGFP-N1 (Clonetech). To characterize this CMV promoter, we used CMV promoter – green fluorescent protein – polyadenylation sequence construct with pEGFP-N1 as positive control and GFP-PolyA in pSB1C3 as negative control. If the result shows that GFP is expressed and scatter around in cell, while negative control shows no GFP signal in cell, we can conclude that CMV is functioning.
Characterization for MLS
Promoter CMV mammalian promoter to allow expressing the construct in mammalian cell.
Forward primer:
Reverse primer:
These primers were used to amplify CMV from pEGFP-N1 (Clonetech) in RFC 10 format. Since not enough length is kept after the transcription start site, future user may need to put spacer between the CMV promoter and the part need to be transcribed.
Mitochondria Leader Sequence MLS was cloned from pCMV/myc/mito (Invitrogen) using forward primer: [GATCATGAATTCGCGGCCGCTTCTAGATGGCCGGCATGTCCGTCCTGACGCCGC] and reverse primer: [GATCATCTGCAGCGGCCGCTACTAGTATTAACCGGTCAACGAATGGATCTTGGCGCG]. The MLS was cloned with RFC 25 Freiburg standard prefix and suffix to allow doing fusion protein with MLS, to allow trafficking of reporter into mitochondria.
