·Materials (used in this part)

Table 3-1: Bacterial strains and plasmids

Strains and vectors	Relevant genotype and characteristics	Originate
E.coli DH5α	strains	conserved in the lab
pMD18T	vectors	TaKaRa Biotechnology (DaLian)Co. ,Ltd.
pSB1C3	vectors	iGEM package

Table 3-2: Primers used in this part
(* Midi Plasmid Kit , Midi Purification Kit and Pfu Taq produced by TIANGEN BIOTECH(BEIJING)CO.,LTD.LA Taq produced by TaKaRa Biotechnology (DaLian)Co. ,Ltd.)

Primer	Sequence（5’-3’）
ygfG-F	GAATTCGCGGCCGCTTCTAGAGATGTCTTATCAGTATG
ygfG-R	CTGCAGCGGCCGCTACTAGTATTAATGACCAACGAAAT
ygfH-F	GAATTCGCGGCCGCTTCTAGAGATGGAAACTCAGTGGA
ygfH-R	CTGCAGCGGCCGCTACTAGTATTAACCCAGCATCGAGC
ygfD-F	GTTTCTTCGAATTCGCGGCCGCTTCTAGAGATGATTAATGAAGCCACGC
ygfD-R	GTTTCTTCCTGCAGCGGCCGCTACTAGTATTAATCAAAATATTGCGTCTGGA
ygfD-mF	CGGCGATGATCTCCAGGGCATTAAAAAAGGGCTGATGG
ygfD-mR	CCTTTTTTAATGCCCTGGAGATCATCGCCGCCACCGG
sbm-F	GAATTCGCGGCCGCTTCTAGAGATGTCTAACGTGCAGG
sbm-R	CTGCAGCGGCCGCTACTAGTATTAATCATGATGCTGGCTTATC
VR	ATTACCGCCTTTGAGTGAGC
VF2	TGCCACCTGACGTCTAAGAA

·Methods

Step 1 : PCR amplification with the four pairs of primer set as the template (E.coli genome) will produce four fragments namely ygfG(785bp), ygfH(1478bp), ygfD(995bp) and sbm(2144bp). The conditions of the reaction were listed in table 3 and figure 3-1 displayed the result testified by 1% agarose gel electrophoresis.

Table 3-3: The PCR reaction to harvest target genes
(*Item 2 to item 6 for 36 cycles)

Item	System components(50μl)	Conditions
1	Template 1.25μl	94℃5min
2	dNTPs 2.5μl	94℃30sec
3	10×LA PCR Buffer 5μl	58℃30sec
4	LA Tag 0.5μl	72℃(1min for ygfG, ygfD)
5	Primer-F(10μmol/L)2.5μl	72℃(1min30sec for ygfH)
6	Primer-R(10μmol/L)2.5μl	72℃(2min for sbm)
7	ddH2O up to 50μl	72℃ 10min

Step 2 : It is necessary to add PstI and standard restriction enzyme sites to both terminals of each gene. However, ygfD has the sequence that PstI recognize and function. So we obliterated the restriction site by site-directed mutagenesis based on overlap extension PCR. Briefly, target mutation.(TGCA→TCCA) was introduced into primers, and the two previous PCR products were used as template for the third PCR. The final PCR segment with target mutant was then cloned into pMD18-T vector for sequencing. The three PCR system were listed in table 3-4, 3-5,3-6. The final outcome was testified by agarose gel electrophoresis and displayed in figure 3-2.

Table 3-4: Conditions of the 1st PCR
(*Item 2 to item 4 for 34 cycles)

Item	System components(50μl)	Conditions
1	ygfD 1ul	94℃5min
2	dNTPs 4μl	94℃30sec
3	10×pfu PCR Buffer 5μl	58℃30sec
4	pfu 0.5μl	72℃ 1min
5	Primer-F(10μmol/L)2.5μl and Primer-mR(10μmol/L)2.5μl for D1
6	Primer-mF(10μmol/L)2.5μl and Primer-R(10μmol/L)2.5μl for D2
7	ddH2O up to 50μl

Table 3-5: Conditions of 2nd PCR
(*Item 3 to item 4 for 34 cycles)

Item	System components(50μl)	Conditions
1	The first PCR produces D1 10μl	94℃ 5min
2	The first PCR produces D2 10μl	94℃ 5min
3	dNTPs 2.5μl	94℃30sec
4	10×pfu PCR Buffer 5μl	58℃30sec
5	pfu 0.5μl	72℃ 1 min
6	ddH2O up to 50μl	72℃ 10 min

Table 3-6: Conditions of 3rd PCR
(*Item 2 to item 4 for 34 cycles)

Item	System components(50μl)	Conditions
1	the second PCR produces 2μl	94℃ 5min
2	The first PCR produces D2 10μl	94℃ 5min
3	10×LA PCR Buffer 5μl	58℃30sec
4	LA Tagase 0.5μl	72℃1min
5	Primer-F(10μmol/L)2.5μl	72℃ 10 min
5	Primer-R(10μmol/L)2.5μl	72℃ 10 min
5	ddH2O up to 50μl	72℃ 10 min

Step 3 : Retrieve and purify the targets with kits produced by TIANGEN BIOTECH(BEIJING)CO.,LTD. Store the washed genes in -20℃ for next steps.

Step 4 : Conjunct the four genes and pMD18T vectors respectively. Then transfer the conjunctions into DH5αstrain to pick the positive clone after being inoculated in the LB solid culture, 37℃ for one night. To ensure the conjunctions were correct, we confirmed the vectors by colonial PCR. The conditions for conjunction and PCR were listed in the table 3-7, 3-8.

Table 3-7: Conditions for gene conjunction

Item	System components(50μl)	Conditions
1	Solution I 5μl	16℃ 2h
2	DNA 4.5μl	16℃ 2h
3	pMD18T 0.5μl	16℃ 2h

Table 3-8: Conditions for colonial PCR
(*Item 2 to item 4 for 34 cycles)

Item	System components(50μl)	Conditions
1	2×EX Tag Mix 5μl	94℃5min
2	M13-47(10μmol/L)0.5μl	94℃30sec
3	M13-48(10μmol/L)0.5μl	58℃30sec
4	ddH2O up to 10μl	72℃(1min for ygfG, ygfD 1min30sec for ygfH 2min for Sbm) 10min

Step 5 : Extract the correct plasmids with kits and sequence part of them to see if there were possible mutations in the target genes.

Step 6 : Digest and purify the genes by restriction enzymes in pMD18T-ygfD (ygfH,ygfG,sbm) vectors and ligate each together with pSB1C3. The conditions for digestion and ligation were listed in the table 3-9,3-10. Then transfer the conjunctions into DH5αstrain to pick the positive clone after being inoculated in the LB solid culture, 37℃ for one night. To ensure the conjunctions were correct, we confirmed the vectors by colonial PCR. Later the pSB1C3 holding ygfD (ygfH,ygfG,sbm) were sent to sequence. See the details in part 2 step 4 and 5.

Table 3-9: Conditions for digestion

Item	System components(50μl)	Conditions
1	10×H Buffer 5μl	94℃5min
2	EocRI 2.5μl	37℃ 1h
3	PstI 2.5μl	37℃ 1h
4	PstI 10μl	37℃ 1h
4	ddH2O up to 50μl	37℃ 1h

Table 3-10: Conditions for ligation

Item	System components(50μl)	Conditions
1	Solution I 6μl	16℃ 4h
2	DNA 5μl	16℃ 4h
3	PstI 2.5μl	16℃ 4h

Step 7 : After completing all the validation, the four gene were submitted to iGEM official organization in the early September and arrived in New York in 16th Sep. The information were listed in the table 3-11.

Table 3-11: Information of four standard biobricks

Standard biobricks	description
pSB1C3-ygfD(EocRI PstI）	According to Toomas Haller, the enzyme encoded by the second gene, ygfD, contains a consensus binding sequence for ATP. They thought it might be a succinate (or propionate)CoA ligase, or a novel (biotin-independent) propionyl-CoA carboxylase.
pSB1C3-ygfH(EocRI PstI）	This gene encode propionyl-CoA:succinate CoA transferase that catalyzes a CoA transferase reaction from propionyl-CoA to succinyl, generating propionate.
pSB1C3-ygfG(EocRI PstI）	The third gene in the operon encoding methylmalonyl-CoA decarboxylase that catalyzes the decarboxylation of methylmalonyl-CoA to propionyl-CoA
pSB1C3-sbm(EocRI PstI）	Sbm encodes methylmalonyl-CoA epimerase which catalyzes the reversible reaction of succinyl-CoA and methylmalonyl -CoA