Team:UChicago/Plan

Summer Plan

Construct pUB110 BioBrick

-Digest pUB110 w/ NdeI and AflII--> gel purify-->nanodrop for concentration

-Digest pUB110 linker w/ NdeI and AflII

Linker sequence: attcgtcttaaggaattcgcggccgcttctagagtactagtagcggccgctgcagcatatgtcatac

-Set up overnight ligation of digested, gel purified pUB110 and digested pUB110 linker = generates pUB110 BioBrick

-Transform into B. subtilis to amplify

-Set up O. N. cultures

-Do B. subtilis miniprep

-Digest our pUB110 BioBrick

To test pUB110 Biobrick (kanamycin resistant) construction (send for sequencing)

-Put a promoter/upstream BioBrick (in vector with chloramphenicol resistance) + RFP BioBrick from amp resistant vector => do 3 step assembly

-Do transformation in B. subtilis

-Choose transformants--> if transformants express RFP, we could conclude our pUB110 BioBrick works--> submit pUB110 BioBrick

Construct kerA BioBrick

-Do Gibson assembly to put together the two kerA gBlocks from IDT

-Put our kerA biobrick into an empty vector w/ amp resistance (so we can use the 3 step assembly) and transform into DH5-a

-Since promoter/upstream biobrick will be in chloramphenicol resistant vector

-And our puB110 vector will use kanamycin resistance

-So that leaves our kerA biobrick the vector that is amp resistant

Orange: prefix Green: suffix Purple: kerA signal peptide