Team:Heidelberg/Templates/DelH overview1

Revision as of 22:48, 1 October 2013 by Fanny (Talk | contribs)

Schematic representation of DelH cluster and structure of delftibactin.

PCR amplification of the 18 Kb DelH fragment as sub fragments F1 (10 Kb) and F2 (8 Kb)
Assembly of backbone pSB6A1-Arac-lacZ by PCR amplification of fragments from BioBricks
Ligation of the construct DelH F1 + DelH F2 + backbone pSB6A1-Arac-lacZ
Transformation of E. coli TOP10 with DelH plasmid
Characterization of positive (blue) colonies by colony PCR

Vector map of the pHM01:DelH plasmid.

Backbone	Part	Distribution	Plate	Well	Usage	Resistance
pSB4K5	J04450	Spring 2012	1	5G	Backbone for DelA-G,OP,L	Kanamycin
pSB1AK3	I732019	Spring 2012	4	12G	lacZ reporter gene	Kanamycin, Ampicillin
pSB2K3	I0500	Spring 2012	1	14N	AraC promoter	Kanamycin
pSB6A1	J04450	Spring 2012	1	1K	Backbone for DelH	Ampicillin
pSB1C3	J04450	Spring 2012	1	3A	Backbone for Indigoidine	Chloramphenicol

Identifier	Order date	Note	Sequence
DN01:DelH_f1_PacI_fw	03-05-2013	Amplification of DelH F1, with RBS and adding PacI restriction site	tttt ttaattaa tcacacaggaaagtactag ATGGACCGTGGCCGCCTGC GCCAAATCG
DN02:DelH_f1_SalI_rev	03-05-2013	Amplification of DelH F1 until SalI	tttt GTCGACCAACACCTGTGCCTGC
DN03:DelH_f2_SalI_fw	03-05-2013	Amplification of DelH F2 starting SalI	tttt GTCGACTGGATGGAGCCTGGTGAAAG
DN04:DelH_f2_KpnI_rev	03-05-2013	Amplification of DelH F2, adding KpnII restriction site	tttt ggtacc TCAGTCCAGCGCGTACTCCAG
DN05:AraCbb_KpnI_fw	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site	tttt ggtacc aaagaggagaaatactagatgaccatg
DN08:AraCbb_PacI_rev	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site	tttt ttaattaa gctagcccaaaaaaacgggtatg