"
Team:Heidelberg/Templates/DelH overview22
From 2013.igem.org
Results
| Colonies | Alignment File | Sequence |
|---|---|---|
| III F7 | Sequencing of clone III F7 with VF2 | Mutation |
| III F9 | Sequencing of clone III F9 with VF2 | Mutation |
| III G3 | Sequencing of clone III G3 with VF2 | Mutation |
| III G4 | Sequencing of clone III G4 with VF2 | Mutation |
Vector Maps and Primers
Strategy A: weak Promotor, weak RBS
Expression of the possibly toxic DelH module on pFS02 is minimized by usage of a weak promoter: BBa_J23114 as well as a weak RBS: BBa_0032.
File:PFS 02.png
Vector map of the weak promotor and weak RBS DelH plasmid pFS02 (pSB6A1_BBa_J23114_BBa_B0032_DelH) Gibson plasmid.
| Identifier | Order date | Note | Sequence |
|---|---|---|---|
| FS_78:BB_HPLC_rev | 26-09-2013 | Gibson-Primer rev, amplify the Backbone pSB6A1 introducing the RBS BBa_B0032 and the promotor BBa_J23114 and creating an overlap to the first fragment of DelH amplified with primer DN_11 | GATTTGGCGCAGGCGGCCACGG TCCATCTAGTACTTTCCTGTGTGACTCTA GAGCTAGCATTGTACCTAGGACTGAGCT AGCCATAAACTCTAGAAGCGGCCGCGAATTC |
| FS_84:BB_HPLC_fw | 26-09-2013 | Gibson-Primer fw to amplify first fragment of DelH introducing the RBS BBa_B0032 and creating an overlap to primer FS_85 thereby partially introducing the promotor BBa_J23114 | GCTCAGTCCTAGGTACAATGCTAGC TCTAGAGTCACACAGGAAAGTACTAGATGGA CCGTGGCCGCCTGCG |
| FS_85:BB_HPLC_rev | 26-09-2013 | Gibson-Primer rev to amplify the Backbone pSB6A1, partially introducing the promotor BBa_B0032 with overlap to primer FS_84 and therefore the promotor BBa_J23114, it creates an overlap to the beginning of DelH | GCGATTTGGCGCAGGCGGCCACGGT CCATCTAGTATTTCTCCTCTTTC |
Strategy B: ccdB Construct
Selection for mutated and thus truncated DelH sequences will be minimized by using a ccdB strategy. DelH will be integrated in a pSB4K5 backbone flanked by KpnI and BamHI sites (pFS02). The pSB6A1 backbone will be assembled with a ccdB cassette flanked by KpnI and BamHI sites (pFS03). The final DelH plasmid will be assembled by restriction - ligation of pFS02 and pFS03 to pFS05.
| Identifier | Order date | Note | Sequence |
|---|---|---|---|
| FS_85:BB_HPLC_rev | 26-09-2013 | Gibson-Primer rev to amplify the Backbone pSB6A1, partially introducing the promotor BBa_B0032 with overlap to primer FS_84 and therefore the promotor BBa_J23114, it creates an overlap to the beginning of DelH | GCGATTTGGCGCAGGCGGCCACGGTCCATCTAGTATTTCTCCTCTTTC |
| FS_86:BB_HPLC_rev | 26-09-2013 | Gibson-Primer rev to amplify the Backbone pSB4K5 without any promotor introducing a KpnI cutting site for restriction cloning, creates an overlap to DelH and will be used for the ccdB strategy | GGCGATTTGGCGCAGGCGGCCACGGTCCATGTACTTCGAGTCACTAAGGGCTAAC |
| FS_87:BB_HPLC_fw | 26-09-2013 | Gibson-Primer fw to amplify the Backbone pSB6A1 introducing a BamHI cutting site for restriction cloning and creating an overlap to the last fragment of DelH | CGCTGGAGTACGCGCTGGACTGAGATCCCAGGCATCAAATAAAACG |
| FS_90:ccdB_HPLC_fw | 26-09-2013 | Gibson-Primer fw to amplify the ccdB cassette from the template pDonor Plasmid introducing a KpnI cutting site for restriction cloning, creates an overlap to the promotor BBa_J23114 and will be used for the ccdB strategy | CTCAGTCCTAGGTACAATGCTAGCTCTAGAGTCACACAGGAAAGCAGTAC ACTGGCTGTGTATAAGGGAG |
| FS_93:ccdB_HPLC_rev | 26-09-2013 | Gibson-Primer rev to amplify the ccdB cassette from the template pDonor Plasmid introducing a BamHI cutting site for restriction cloning, creates an overlap to the backbone pSB6A1 and will be used for the ccdB strategy | GTTCACCGACAAACAACAGATGATCCGCGTGGATCCGGCTTAC |
| FS_94:BB_HPLC_fw | 26-09-2013 | Primer fw to amplify the backbone pSB6A1, will be used for the ccdB strategy | ATCTGTTGTTTGTCGGTGAACGC |
File:PFS 03.png
Vector map of the DelH plasmid without promoter in pSB4K5 pFS03 (pSB4K5min_KpnI_DelH_BamHI) Gibson plasmid.
File:PFS 04.png
Vector map of the pSB6A1 backbone with ccdB cassette pFS04 (pSB6A1_BBa_J23114_BBa_B0032_ccdB_cassette) Gibson plasmid.
File:PFS 05.png
Vector map of the final DelH plasmid in pSB6A1 pFS05 (DelH_final_pSB6A1_BBa_J23114_BBa_B0032_KpnI_DelH_BamHI) Gibson plasmid.
