Team:Heidelberg/Templates/DelH overview22

From 2013.igem.org

Revision as of 09:43, 2 October 2013 by Fanny (Talk | contribs)

Results

Colonies Alignment File Sequence
III F7 Sequencing of clone III F7 with VF2 Mutation
III F9 Sequencing of clone III F9 with VF2 Mutation
III G3 Sequencing of clone III G3 with VF2 Mutation
III G4 Sequencing of clone III G4 with VF2 Mutation


Vector Maps and Primers

Strategy A: weak Promotor, weak RBS
Expression of the possibly toxic DelH module on pFS02 is minimized by usage of a weak promoter: BBa_J23114 as well as a weak RBS: BBa_0032.

Vector map of the weak promotor and weak RBS DelH plasmid pFS02 (pSB6A1_BBa_J23114_BBa_B0032_DelH) Gibson plasmid.
Identifier Order date Note Sequence
FS_78:BB_HPLC_rev 26-09-2013 Gibson-Primer rev, amplify the Backbone pSB6A1 introducing the
RBS BBa_B0032 and the promotor BBa_J23114 and
creating an overlap to the first fragment of
DelH amplified with primer DN_11
GATTTGGCGCAGGCGGCCACGG
TCCATCTAGTACTTTCCTGTGTGACTCTA
GAGCTAGCATTGTACCTAGGACTGAGCT
AGCCATAAACTCTAGAAGCGGCCGCGAATTC
FS_84:BB_HPLC_fw 26-09-2013 Gibson-Primer fw to amplify first fragment of DelH introducing
the RBS BBa_B0032 and creating an overlap to
primer FS_85 thereby partially introducing the
promotor BBa_J23114
GCTCAGTCCTAGGTACAATGCTAGC
TCTAGAGTCACACAGGAAAGTACTAGATGGA
CCGTGGCCGCCTGCG
FS_85:BB_HPLC_rev 26-09-2013 Gibson-Primer rev to amplify the Backbone pSB6A1, partially
introducing the promotor BBa_B0032 with overlap to primer
FS_84 and therefore the promotor BBa_J23114,
it creates an overlap to the beginning of DelH
GCGATTTGGCGCAGGCGGCCACGGT
CCATCTAGTATTTCTCCTCTTTC


Strategy B: ccdB Construct
Selection for mutated and thus truncated DelH sequences will be minimized by using a ccdB strategy. DelH will be integrated in a pSB4K5 backbone flanked by KpnI and BamHI sites (pFS02). The pSB6A1 backbone will be assembled with a ccdB cassette flanked by KpnI and BamHI sites (pFS03). The final DelH plasmid will be assembled by restriction - ligation of pFS02 and pFS03 to pFS05.

Identifier Order date Note Sequence
FS_85:BB_HPLC_rev 26-09-2013 Gibson-Primer rev to amplify the Backbone pSB6A1, partially introducing the
promotor BBa_B0032 with overlap to primer FS_84 and therefore
the promotor BBa_J23114, it creates an overlap to the beginning of DelH
GCGATTTGGCGCAGGCGGCCACGGTCCATCTAGTATTTCTCCTCTTTC
FS_86:BB_HPLC_rev 26-09-2013 Gibson-Primer rev to amplify the Backbone pSB4K5 without any promotor
introducing a KpnI cutting site for restriction cloning, creates an overlap
to DelH and will be used for the ccdB strategy
GGCGATTTGGCGCAGGCGGCCACGGTCCATGTACTTCGAGTCACTAAGGGCTAAC
FS_87:BB_HPLC_fw 26-09-2013 Gibson-Primer fw to amplify the Backbone pSB6A1 introducing a BamHI
cutting site for restriction cloning and creating an overlap to the last
fragment of DelH
CGCTGGAGTACGCGCTGGACTGAGATCCCAGGCATCAAATAAAACG
FS_90:ccdB_HPLC_fw 26-09-2013 Gibson-Primer fw to amplify the ccdB cassette from the template pDonor
Plasmid introducing a KpnI cutting site for restriction cloning, creates an
overlap to the promotor BBa_J23114 and will be used for
the ccdB strategy
CTCAGTCCTAGGTACAATGCTAGCTCTAGAGTCACACAGGAAAGCAGTAC
ACTGGCTGTGTATAAGGGAG
FS_93:ccdB_HPLC_rev 26-09-2013 Gibson-Primer rev to amplify the ccdB cassette from the template pDonor
Plasmid introducing a BamHI cutting site for restriction cloning,
creates an overlap to the backbone pSB6A1 and will be used for
the ccdB strategy
GTTCACCGACAAACAACAGATGATCCGCGTGGATCCGGCTTAC
FS_94:BB_HPLC_fw 26-09-2013 Primer fw to amplify the backbone pSB6A1, will be used for the ccdB strategy ATCTGTTGTTTGTCGGTGAACGC
Vector map of the DelH plasmid without promoter in pSB4K5 pFS03 (pSB4K5min_KpnI_DelH_BamHI) Gibson plasmid.
Vector map of the pSB6A1 backbone with ccdB cassette pFS04 (pSB6A1_BBa_J23114_BBa_B0032_ccdB_cassette) Gibson plasmid.