"
Team:Heidelberg/Del week16 overview
From 2013.igem.org
Contents |
Week 16
Strategy
Most PCRs have worked!! Yeah- finally!!! Thus, all the fragments needed for Gibson assembly are now available, however yields are still suboptimal for some of the fragments amplified. Furthermore, we designed screening primers for our final construct pFSN. These primers will be used to analyze our transformed bacteria for presence of the complete DelRest construct pFSN by colony-PCR.
| Identifier | Order date | Note | Sequence |
|---|---|---|---|
| FS_47_screening_BB_AF_fw | 2013-08-02 | Primer for screening/sequencing of pFSN construct | GTTGGCCGATTCATTAATGC |
| FS_48_screening_BB_AF_rv | 2013-08-02 | Primer for screening/sequencing of pFSN construct | TAACGGTATCGGTATCGCTTTG |
| FS_49_screening_AFI_AFII_fw | 2013-08-02 | Primer for screening/sequencing of pFSN construct | GTTTCTCTGGAAGATGGATAC |
| FS_50_screening_AFI_AFII_rv | 2013-08-02 | Primer for screening/sequencing of pFSN construct | GTTGACGAAAAAGCCGACCAC |
| FS_51_screening_AF_FG(21-26)_fw | 2013-08-02 | Primer for screening/sequencing of pFSN construct | TGGATATCGACTGGACTGCCTG |
| FS_52_screening_AF_FG(21-26)_rv | 2013-08-02 | Primer for screening/sequencing of pFSN construct | TGCACCACATCGACGAAACGG |
| FS_53_screening_FG(21-26)_G_fw | 2013-08-02 | Primer for screening/sequencing of pFSN construct | GTACGGCCTATCACATCAGCG |
| FS_54_screening_FG(21-26)_G_rv | 2013-08-02 | Primer for screening/sequencing of pFSN construct | GAACCTGGGTGTTCACGAAAAAGCC |
| FS_55_screening_G_OP_fw | 2013-08-02 | Primer for screening/sequencing of pFSN construct | GTATCTCTACATGCATCGCTAC |
| FS_56_screening_G_OP_fw | 2013-08-02 | Primer for screening/sequencing of pFSN construct | AGGACATTTTCCGCACCCCG |
| FS_57_screening_G_OP_rv | 2013-08-02 | Primer for screening/sequencing of pFSN construct | GCTGGCGTTTTCCATAAG |
| FS_58_screening_OP_L_fw | 2013-08-02 | Primer for screening/sequencing of pFSN construct | GAACAACTTCCAGCACAGCCTGTTC |
| FS_59_screening_OP_L_rv | 2013-08-02 | Primer for screening/sequencing of pFSN construct | CGTTGAAGATTTCGTTGACG |
| FS_60_screening_L_BB_fw | 2013-08-02 | Primer for screening/sequencing of pFSN construct | CATCTTCAAGGTGTTCTATGAAC |
| FS_61_screening_L_BB(with_mRFP)_rv | 2013-08-02 | Primer for screening/sequencing of pFSN construct | CAGTTTAACTTTGTAGATGAAC |
| NK_01_FS_62_screening_L_BB(without_mRFP)_rv | 2013-08-02 | Primer for screening/sequencing of pFSN construct | GTTCACCGACAAACAACAGATAAAACG |
Amplification and purification of Del Genes from SPH-1
Goals
As we were able to establish amplification protocols for most of our desired amplicons by the end of last week, we will repeat these PCRs to obtain the required amounts and concentrations. Furthermore we will optimize the PCR conditions of DelO-P by using higher annealing temperatures, hopefully inhibiting secondary structe formation of the primers. Afterwards we will assemble our construct, transform it into E.Coli DH10B and screen for (hopefully many) positive clones using the recently ordered screening primers.
| PCRs from D.acidovorans SPH-1 | ||||
|---|---|---|---|---|
| Gene(s) | Fragment | Primer combination | Successful? | |
| DelA DelB DelC DelD DelE DelF DelG | DelA-F | Primer FS_02 and FS_05 |  | |
| DelA-G | Primer FS_02 and FS_11 |  | ||
| Primer FS_02 and FS_11_short | | |||
| DelF-G | Primer FS_21 and FS_07 |  | ||
| Primer FS_21 and FS_26 | | |||
| DelG | Primer SR_01 and FS_23 | | ||
| DelO DelP DelL | DelO-P | Primer FS_22 and FS_13_short | | |
| Primer FS_22 and FS_13 | | |||
| Test restriction digests of PCR amplified fragments | ||||
|---|---|---|---|---|
| Fragment | Primer | Digestion enzyme | Expected bands | |
| DelO-P | Primer FS_22 and FS_13 | EcoRI-HF | 1883, 960 | |
