Team:Heidelberg/Templates/Del week12 overview

From 2013.igem.org

Revision as of 18:16, 4 October 2013 by FloSmi (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Strategy

Vector map of pFSN plasmid including Primers FS_01 to FS_241 used for assembly of the desired genes from the D. acidovorans genome and the partsregistry backbone pSB4K5 .

As we discovered that there is a predicted promoter located right in front of DelO, we decided to include this promotor into our construct. This should ensure that the genes DelO, DelP and DelL are still expressed in the case that there is a terminator by the end of DelG. For this we designed primer FS_22 which binds right at the predicted promoter. However, this also meant, that we had to change the reverse primer for the DelG fragment in order to enable Gibson assembly of these fragments next to each oterh. Furthermore we created new primers for amplifying DelE, DelF and DelG as we were not successful in amplifying these fragments so far. These primers now offer more potential fragment combinations which can be tested. We hope to get the missing fragments with this new strategy.

Primer pairs, corresponding sequences and usage

Identifier	Order date	Note	Sequence
FS_21: DelF_fw	2013-07-13	Amplification of DelF from Delftia acidovorans Gibson Primer	GACGCCATCTACCACCTGTG
FS_22: DelOP_short_fw	2013-08-02	Amplification of DelOP from Delftia acidovorans inlcuding the recently predicted endogenous Promotor for DelOP Gibson Primer	GATGACGCAGGGCGGCGGAATTTGTTCATC
FS_23: DelG_long_rv	2013-07-13	Amplification of DelG from Delftia acidovorans Gibson primer with overhang to DelOP element including the recently predicted endogenous Promotor	GATGAACAAATTCCGCCGCCCTGCGTCATCTCAGATATCTCCCAGAGTTTCGAGAAAG
FS_24: DelAE_rv	2013-07-13	Amplification of DelAE from Delftia acidovorans Gibson Primer	CAGAAGAATTCCCAGAAGGAGATGTCGAAG
FS_26: DelFG_rv	2013-07-13	Amplification of DelFG from Delftia acidovorans Gibson Primer	GAATTCATCCACGATGATCTGCATG

Amplification of Del Genes from D. acidovorans DSM-39 genome

Goals

This week we will try to amplify the sequence region of DelF-G with several combinations of primers including both, the intial primers and the recently ordered ones beeing FS_20, FS_21, FS_22, FS_23, FS_24 and FS_26. Furthermore we will continue opimtizing our protocol for the amplification of DelO-P. To evaluate whether the very weak bands on the corresponding agarose gels represent the intended amplicons, we decided to carry out re PCR and test restriction digests.

Results

The following table summarizes the outcomes of this weeks PCRs

PCRs from D.acidovorans DSM-39
Gene(s)	Fragment	Primer combination	Successful?
DelA DelB DelC DelD DelE DelF DelG	DelA-E	Primer FS_02 and FS_03
	DelE-G	Primer FS_04 and FS_07
	DelF-G	Primer FS_20 and FS_07
		Primer FS_20 and FS_09
		Primer FS_21 and FS_09
	DelG	Primer FS_08 and FS_09
	DelG	Primer FS_08 and FS_11_short
DelO DelP DelL	DelO-P	Primer FS_22 and FS_13
	DelO-P	Primer FS_22 and FS_13_short
	DelL-P	Primer FS_13_short and FS_15_short

Re-PCRs
Gene(s)	Fragment	Primer combination	Successful?
DelE DelF DelG	DelE-G	Primer FS_04 and FS_07
	DelF-G	Primer FS_06 and FS_09
	DelF-G	Primer FS_21 and FS_09
	DelG	Primer FS_08 and FS_09
	DelG	Primer FS_08 and FS_11_short
DelO DelP DelL	DelO-P	Primer FS_22 and FS_13