Team:UNITN-Trento/Notebook

First day as iGEMMers at CIBIO (Center for the Integrative Biology)!
We extracted BBa_J45319, BBa_J45320, BBa_J45004 and BBa_J45119 and then transformed them into NEB10β cells.

We performed the purification of BBa_J45320, BBa_J45119, BBa_J45700 (obtained from NEB10β colonies transformed by Viola, Emil and Pedro last week) following the “Wizard® Plus SV Minipreps DNA purification System” protocol. After the quantification through NanoDrop, we digested the plasmid with EcoR I and Pst I to obtain the devices. To verify the correct results of our purification we did an electrophoresis run as it is shown in the image.

Since we didn't obtained our product using the Phusion PCR, we tried again to amplify the SAMsynthase gene from an extract of E.coli genomic DNA (strain MG1655). In order to do that we exploited the same primers used in our previous attempt (see 06-06-2013).

For the protocol used see the RBC Taq PCR protocol.. When the reaction finished, we tested the presence of the aplificate product througt an electrophoresis analisys (adding 2 µl of LD for 10 µl of DNA).

Results:

As you can see from our gel image, our product is present in both reactions (TAQ and TAQ+Phusion). After purifying our products we find out that the concentration of DNA that we obtained is too low (about 5ng/ul) maybe for an experimental error in setting the PCR program. For this reason, our team is going to redo the PCR reaction again.

We tried to amplify the SAMsynthase gene from an extract of E.coli genomic DNA (strain MG1655). In order to do that we exploited two primers previoursly designed and synthetized.

Foward: GCCGCTTCTAGAGAAGGAGGAACTACTATGGCAAAACACCTTTTT Reverse: CTGCAGCGGCCGCTACTAGTATTATTACTTCAGACCGGCAG

For the protocol used see the Phusion PCR protocol.. When the reaction finished, we tested the presence of the aplificate product througt an electrophoresis analisys (adding 2 µl of LD for 10 µl of DNA).

Results:

As you can see from our gel image, our product is not present. The next move will be to try to amplify using a TAQ polymerase and we hope that this will work!

We've tried another combination to maximize the outputs of the PCR done to amplify the SAMsynthetase synthase gene from an extract of E.coli genomic DNA (strain MG1655). This time we used the RBC Taq DNA Polymerase protocol but with a mix of this polymerase (0.25 ul) and the Phusion polymerase (0.3 ul). We've prepared two identical samples to see who is the better PCR maker! :)

As you can see from the picture we both obtained great results

We purified the products of SAMsynthetase and pSB1C3 PCR performed by Gire and Pedro following the illustra™ GFX™ PCR DNA and Gel Band Purification Kit protocol. After the quantification with NanoDrop, we did the ligation reaction.

We extracted BBa_K143012, BBa_K823000, BBa_K823002 and BBa_K823003 and then transformed them into NEB10β cells.

We purified the PCR (third attempt) products of SAMsynthetase and pSB1C3 linearized vector following the Quick Reference protocol. After that, we quantified them using the nanodrop instrument.

That's definetely not a good result, however we will continue working with them.

To understand if our Neb10β cells and all our reagents for transformation worked well, we transformed 200 ul of cells with 1 ul of pSB1C3 with RFP, previously purificated. As you can see from the picture we've done a nice job!!

We took the ligation products (SAMsynthetase + pSB1C3 in two different rapports 2:1 and 1:!) done by Caterina and Fabio in the morning and we transformed it in NEB10 cells. We've also prepared some inocula from the plates of the devices extract in CiBio (BBa_J45700, BBa_J45320, BBa_J45119)in LB with the correct antibioticum to have a lot of materials to work on.

We prepared some agar plates with tetracyclin (10ug/ml) and some Luria Broth. Then we extracted, transformed in competent cells and plated the following parts :

part	plasmid	plate	colonies
Bba_J45119	pSB1AT3	amp, tet 10µg/ml, tet 50µg/ml	only in amp plate
Bba_J45320	pSB1AT3	amp, tet 10µg/ml, tet 50µg/ml	only in amp and tet 10µg/ml
Bba_J45 700	pSB1AK3	kan	yes

We also screened the parts purified by Fabio and Gire : K1,K2,K3 = BBa_J45319 A1,A2=BBa_J45004

We took the three inocula of SAMsynthetase+pSB1C3 and we performed the purification (Wizard Plus SV Miniprep DNA purification system). Then to verify if the colonies that we took contain the correct insert we perform the screening protocol and the gel eletrophoresis.

We digested using XbaI and PstI and purified the products previously obtained via PCR and via extraction from the registry (pSB1C3 with RFP). We then quantified them at the nano-drop.

Due to a too high concentration of Cloramphenicol in the plates, we have to re-transform the promoters previously extracted from the registry. We transformed and plated the following parts:

- K323002

- K143012

- K323000

- K323003

Results: since we didn't obtain any colonies we failed the experiment.

Inoculum of three B.subtilis backbone

We have done the inoculum of three Bacillus-specific backbone (previously transformed in NEB and plated on Ampicillin LB Agar) in 19 50ml Falcon - 7 with the part BBa_K823023 - 6 with the part BBa_K823022 - 6 with the part BBa_K823027 The Falcons were put in the incubator at 37 °C o/n.

Digestion of SAMsynthetase and psB1C3

We have digested the SAMsynthetase gene (previously amplificated and purificated)and the linerarized vector psB1C3 with the enzyme Xba1 and Pst1 exploiting the same protocol. Then we have incubated the mix at 37C o/n.

We purified with the Quick Reference purification kit(GE) and made a PCR of the linearized plasmid pSB1C3 using the prefix and suffix primers and the Phusion polimerase following its protocol. Then we took the PCR samples and checked the results with an electrophoresis gel using the ladder Generuler 1 kb Plus DNA Ladder of Fermentas: As we can see the plasmid, stopped at 2 kb ca (pSB1C3=2070kb).

We have done the miniprep of the three backbone exploiting the Kit from Promega.

N.B.Some sample have shown an unexpected red color. There is the possibilities that some backbones contain the RFP, maybe all.

We have quantified the products with the following results:

BBa_K823023(4 sample):220 ng/μl , 228.9 ng/μl ,246.4 ng/μl , 272.3 ng/μl

BBa_K823022(3 sample): 222.8 ng/μl , 227.5 ng/μl ,284.9 ng/μl

BBa_K823027(2 sample):268 ng/μl , 299.3 ng/μl

Then we have tried to verify the parts digesting with EcoR1 and Pst1 and doing an electrophoresis, unfortunately it seems that we didn't load the marker Fermentas 1 KB.

We have verifyed the parts from LMU Munich doing an electrophoresis after having digested the parts with Pst1 and EcoR1.

Ligation of SAMsynthetase and pSB1C3 with and without RFP, so I prepared four samples:
1) pSB1C3 with RFP (Ctrl_1)
2) pSB1C3 with RFP + SAMsynthetase (1:2)
3) pSB1C3 without RFP (Ctrl_2)
4) pSB1C3 without RFP (1:2)
The samples were prepared and ligation was performed following the ligation protocol.


Transformation in NEB10β cells was performed following the transformation protocol. Plates in incubator ON at 37°C static, more than 16 hours.

I have prepared the stock solution, 10 ml, for the antibiotic resistance, specifically I have prepared a stock for Ampicillin and Chloramphenicol respectively 50 mg/ml and 34 mg/ml. I have prepared starting from the dust.
Particular care to use Distilled water for Ampicillin and Ethanol for Chloramphenicol.

We have prepared LB Agar and then added antibiotic. Finally we have plated the preparation in plastes.
We have prepared plate at the concentration of 50 um/ml for ampicillin and 150 ul/ml for chloramphenicol.
Seems that the concentration of Chloramphenicol is 5 times more concentrated than normally used.

Since we received the Ethylen Forming Enzyme gene from Genescript company, we proceeded with the extraction and the transformation test. We resuspended the 4 ug of DNA in 40 ul of sterilized water (obtaining a 100 ng/ul stock solution). After that, we transformed 200 ul of NEB10 competent cells with 1ul of EFE DNA. Finally we plated them in two 50 ug/ml Amp LB-Agar Petri dishes.

Results:

As you can see from the image, we obtained many colonies. We then inculated x5 colonies in 5ml LB with Ampicillin.

Me and Bruno transformed the parts that LMU Munich sent us in NEB10beta cells line. The following transformation worked:

Bba_K823022 (pSBBS4S)

Bba_K823027 (pSBBS2E)

Bba_K823023 (pSBBS1C)

We followed the protocol for the transformation efficiency kit to determine how efficiency are our competent cells. We performed 5 transformations with 5 different concetrations of the part Bba_J04450 in the plasmid pSB1C3.

Both the 1:2 ligation plates have number of colonies comparable with their control:

• SAMsynthetase+RFP (1:2) = too many to count.
• SAMsynthetase+RFP (ctrl) = too many to count.
• SAMsynthetase (1:2) = 11 colonies.
• SAMsynthetase (ctrl) = 12 colonies.

Performed 5 inocula for each of the two 1:2 plates, in 5ml LB with 5µl CM. Tomorrow miniprep, quantification, digestion and gel to control what happened.

Got the inocula from yesterday:

• 4 out of 5 inocula of SAMsynthetase+pSB1C3[no_RFP] were good, one (3) didn't grow.
• 4 out of 5 inocula of SAMsynthetase+pSB1C3[RFP] were good, one (5R) was red!

Then, we miniprepped the samples (except for the red, 5R, one) using the protocol. We chose to miniprep also the inocula that did not grow (3), just as a control. After miniprep, quantification was performed with nanodrop.

After that, we digested an aliquote of 800ng of each DNA sample with EcoRI and PstI using our digestion protocol, putting the digestion mix to incubate for 1.5h at 37°C (static).

Then we realized that LacI+RFP and SAMsynthetase have the same base length, and that a gel would not be able to discriminate between them. So, we added 1µl of BamHI to each sample, knowing that this enzyme is able to cut SAMsynthetase (in a band of 100bp and one of 1055bp) to identify the presence of SAM.

So, we prepared a 1.5% agarose gel and performed an electrophoresis for 30 minutes at 120V. From the gel is clear that the samples without RFP (1, 2, 4, 5) do not have any insert. The RFP samples (1R, 2R, 3R, 4R) might contain the SAMsynthetase, but the insert might be LacI+RFP.

To determine whether the insert was LacI+RFP or SAMsynthetase we wanted to perform a RBC Taq PCR against SAMsynthetase (SAMsynthetase-Fw and SAMsynthetase-Rv primers), but we set a wrong PCR program... next time verify the PCR program more accurately!!! On Monday we will start again from the PCR... so sad D:

The day after transformation I have check the grow of the our cell line and I have find only 4 colony in the more concentrated plate with DNA. This results is probably due to the very low concentration of DNA insert in the cell line (only 50pg of DNA). However, the presence of cell indicates that the efficiency of the cell is sufficient for our experiments.

We wanted to do a trasformation but...we don't have the plates. So, at a good pace, we started to make plates with ampicillin and chloramphenicol.

I digested the pSB1C3 linearized with EcoR I and Spe I.
Next I perfomed six different ligations:
two controls with: the pSB1C3 linearized and not but without the insert
two with: pSB1C3 linearized or not and BMST1
two with: pSB1C3 linearized or not and PCHA

We took 4 inocula of pSB1C3 and we performed the purification (Wizard Plus SV Miniprep DNA purification system). Then we performed a digestion with EcoRI and PstI of this 4 minipreps, SAM (another time because we were not satisfied of the previous results!) and two pSB1C3. After the digestion we did a gel to understand if it was our lucky day. As you can see from the picture, evidently not! In the afternoon we prepared two PCR reactions: one for J45700 (from the miniprep = it’s the complete device!) and one to linearize and to amplify the pSB1C3 vector. Both the reactions failed and we were too disappointed to take a picture of the gel. Finally we made another digestion for J45319, J45119 and Cate’s pSB1C3 with EcoRI and PstI.

Today we started anew extracting SAMsynthetase from the genome of E. coli strain MG1655, following the usual protocol (2 samples for Gabriele and 2 for Emil). Then we performed an electrophoresis on a 1% agarose gel.
Sadly, something went wrong with G2 sample (probably Gabriele forgot to add something to the PCR mix). But the gel is very beautiful!!!

Then G1, E1 and E2 samples were purified using Wizard® SV Gel and PCR Clean-Up System and then quantified using the Nanodrop. Sadly, the quantities were not so high, but the results was good anyway!

Finally we prepared overnight digestion of SAMsynthetase (G1 and E1, E2 was put at -20°C) and pSB1C3 linearized both with XbaI and PstI-HF, using the digestion protocol. We used Nebuffer4 and the mix were prepared as follows: The mix were incubated at 37°C overnight.

We took the ligation products (see the post) done by Caterina on Friday and we transformed them in 200 ul of Neb10β competent cells following the protocol. Than we plated them on LB Agar with Cloramphenicol and incubated O/N to see if something will happen.

This morning we added 1µl of SAP to the pSB1C3 overnight digestion and 1µl of DpN1 to the SAMsynthetase overnight digestion, then both were incubated at 37°C for 1.5 hours.

During these 1.5 hours, we performed the miniprep (protocol) and quantification of the circular pSB1C3 inocula of yesterday.

After the incubation, we purified the digestion mixes using the Wizard® SV Gel and PCR Clean-Up System and then quantified.
Then, we performed the ligation of pSB1C3 and SAMsynthetase exploiting the usual protocol. We incubated the ligation mixes for 2 hours at room temperature.

Also, we extracted R0010 promoter (Plac) from the registry (2013 distribution kit, plate 3, well 3H). Unfortunately, we also extracted a part from the same plate and well of the 2012 distribution kit (BBa_K115032) because we mistook the kits.

Finally, we transformed NEB10β competent cells with the usual protocol, we used the following quantities of DNA: 10µl of each ligation product except for the 1:4 ligation, of which we used 15µl, and 1µl of the extracted R0010. Then, we plated on CM plates.

I began the week doing some minipreps (x5 of EFE and x5 of pSB1C3+RFP) following this protocol.

I then digested the linearized pSB1C3 (500 ng, kindly offered by Caterina), pSB1C3 + RFP (500 ng) and EFE (1000 ng) with EcorI and PstI following the 2A assembly protocol. After that, I proceeded with the ligation and transformation in NEB10B cells.

I inoculated the previously transformed EFE in pSB1C3 and AraCpBAD into 5ml of LB containing Chloramphenicol.

First, we extracted K090504 and K090501 (gram+ consitutive promoter and gram+ IPTG inducible promoter)from 2012 kit n5. Then we tried to transform 2 ul of them in 100 ul of NEB10B cells. Furthermore we transformed 3 ul of K823000, K823002, K823003, K143012 in 200 ul of NEB10B.

with some tips we selected 2 colonies for each promoter and then put them in LB ( 10 ml) for an overnight incubation (under shake). In the meanwhile we received a new e.coli strain ( NEB5a) and made an inoculum overnight.

from the previous inoculum ( with NEB10b cells) we could only take K823000 ( duplicate) and K143012 (triplicate). Then we performed the minipreps and quantified the yields: K823000 a = 30.7 ng/ul K823000 b = 34.2 ng/ul K143012a = 26.8 ng/ul K143012b = 30.3 ng/ul K143012c = 29.5 ng/ul As far as NEB5a are concerned, from the inoculum we made our cells competent. In the afternoon we transformed these cells with our promoters.

today we performed the screening protocol in order to verify the real presence of the promoters in the miniprep ( K823000a, K143012b) . To do that, we digested 600 ng of both templates with Ecor1-HF and Pst1-HF

Starting from the inocula of yesterday, we did minipreps followingthis protocol. As you can see we obtained a set of very high concentrations. We proceded then with the screening test. To do that we digested 900 ng of DNA with EcorI and PstI following this protocol. In the end we prepared the sample for an electrophoresis analysis. As you can see from the image, al the AraCpBAD samples (on the right of the ladder) were confirmed and 4 out of 7 of EFE were confirmed too.. So we have our second Biobrick! EFE in pSB1C3!

Today we (GG, ET, BA) tried to linearize pSB1C3 (with poor results), with this protocol, using the circular DNA samples of Tuesday (18-06): Emil 117.3ng/microl, Gabriele 184.1ng/microl.

Then we prepared a gel (1% GellyPhor gel) and checked for the products. Unfortunately, some of the PCR reactions did not succeed!

Then we (GG, ET) have proceeded with the inoculation of pSB1C3+SAMsynthetase (1:1, 1:2, 1:4) and of part R0010 (pLac). Unfortunately there were a few colonies also in the control.
The inocula were performed in plastic culture tubes (15ml) instead of the glass ones, because we do not know how to sterilize the latter. The tubes were filled with 5ml of LB with Cloramphenycol (1µl of 34mg/ml Cloramphenycol stock solution for 1ml of LB).

In the afternoon Gabriele performed again the same PCR protocol to linearize pSB1C3. He loaded the E1-3 samples again, as double-check.

We started digesting 500 ng of AraCpBAD in pSB1C3 with the SpeI and PstI and 500 ng of EFE in Puc57 with XbaI and PstI following digestion for Biobricks protocol.

For the digested vector (AraCpBAD), we incubated the part for one hour at 37°C with the SAP phosphatase before disactivating the enzymes.

We then preceeded by ligating and transforming the two parts in competent NEB10b cells following the ligation protocol for Biobricks .
We decided to do that in duplicate and with different ratios plasmid:insert (ctrl, 1:1, 1:2, 1:4) obtaining so 8 reactions.
Results: as you can see from the pictures, we there are only few colonies in the control so we hope our construct is correctly cloned. The next step will be the inocula and the screening test.

I inoculated the previously transformed AraCpBAD + EFE in pSB1C3 into 5ml of LB containing Chloramphenicol.

As you can see, it seems that all the inocula grown. I will proceed with the purification and the screening test!

Starting from the inocula of yesterday, I did minipreps following this protocol. As you can see we obtained a set of very high concentrations. We proceded then with the screening test. To do that we digested 800 ng of DNA with EcorI and PstI following the screening digestion protocol. In the end we prepared the sample for an electrophoresis analysis.
As you can see, 6 samples out of 8 have the expected bands: 2070bp for the vector and 2300bp for AraCpBAD.

I made competent cells from the stock of NEB10beta. I followed the protocol

From inocula of the day before I made the minipreps by the following protocol. I made the screening test. To do that we digested 1500 ng of DNA with EcorI and PstI following the screening digestion protocol.
I used a 1.5% concentration of agarose to create a gel and I used Ethidium bromide instead the normal EuroSafe. In addition I have not used a normal Dye with the 20ul of sample loaded but I used 4ul of 30% glycerol.

After the incula that Michele made on Sunday of araCpBAD with BBa_K1065100 (BMST1 in pSB1C3) we did the screening of the minipreps. Before obtaining a good result we tried three different gels. As you can see from these pictures (METTI IMMAGINI) the first two gels made from the same digestion were not lucky while the last, performed with different agarose concentration (1.5% instead of 1%) gave a nice result!

We quantified yesterday inocula (1:1, 1:2, 1:4 of SAMsynthetase and R0010, both in pSB1C3). Then, we screened the products of ligation (1:1, 1:2, 1:4 and R0010): digestion with EcoRI-HF and PstI-HF following the digestion protocol and agarose gel 1%.

In these images we can only see the band of the backbone and no insert!

Of the 8 inocula (pSB1C3+SAMsynthetase), only 7 succeeded and were purified with the Promega kit, following the miniprep protocol with vacuum. The quantification of the samples (one (D) showed a very strange absorbtion pattern, maybe due to contamination, so here is not presented) gave the following results:

After that, I have digested 800ng of each sample with EcoR1-HF and Pst1-HF and one (F) also with Xba1 and Pst1-HF following the digestion protocol after 30min at 37°C I have run the final pruduct on a gel with no results again:

I have re-re-tried to linearize pSB1C3 (in triplicates) with no results (in the second line we can see some aspecific bands): Exploiting the iGem 2012 kit I have transformed 2µl of the pLac promoter (R0010 in pSB1A2) in NEB10β competent cells following the transformation protocol. Afterwards, I plated them on an ampicillin-containing plate.

We performed 5 inocula from the plate containing the colonies resulted from the transformation of R0010 (in pSB1A2).
The LB medium contained Ampicillin (1:1000).

I purified, and then quantified, 3 out of 5 of the previous inocula following the miniprep protocol with vacuum. Afterwards, I digested 800ng of each sample with Spe1-HF and Pst1-HF following the digestion protocol for screening. Finally I ran the products on a gel (1,5% agarose, due to the short length of the insert: only 200 bp + prefix and suffix). I loaded 12 µl of a ladder 100bp prepared as follows: This time, I loaded 12 µl (10 µl of sample and 2 µl of glicerol solution 30%) of each sample.

We can see 2 bands: the highest is the backbone (pSB1A2: 2079bp) and the lower is pLac (nearly 243bp, located between the bands 300 and 200bp of the ladder).
After the screening I digested 3µg of the pSB1A2+R0010 (sample #2) with SpeI and PstI-HF o/n following the usual protocol.

We performed the digestion and the ligation on:

1a)BBa_K1065101 with EcoR I and Xba I and 1b)BBa_J45320 with EcoR I and Spt I

to obtain the complete device BBa_K1065102(placI+PchBA+araC-pBAD promoter+BMST1 in pSB1C3)

2a)pSB1C3 linearized with EcoR I and Pst I 2b)BBa_J45320 with EcoR I and Pst I

to obtain the device BBa_K1065103 (placI+PchBA in pSB1C3).

At the end of the day we did the trasformaion in NEB10β cells. Waiting for the results...break a leg!

Today we added 1 µl of SAP to the o/n digestion and then incubated it for 1.5h. Then we performed the ligation of SAMynthetase (previously digested with XbaI and PstI), following the ligation protocol.
Afterwards, Gabriele purified the product following the usual purification protocol and then transformed it in NEB10β cells following the transformation protocol.

Gabriele prepared also 4 inocula from the pSB1C3+R0010 CM-plate, just to be sure that it is (not) there.

I have re-tried to linearize through a PCR the backbone PsB1C3 that we have previously purified and quntified.
I have tried to amplify the sample of 117.3 ng/µl, 105.7 ng/µl and one of Girelli's sample(184.1 ng/µl)following the Phusion PCR protocol and the universal primers.
No one of this PCRs has succeded!

Emil transformed two construct of the ancient Igem competition: both consist in a RBS with the GFP(E0040) and 2 terminators(B0010)(B0012) and are contained in bSB1A2 Emil followed the transformation protocol loading 150 ng of each sample. Then Emil plated the product on an Ampicillin plate.
Moreover Emil did the inocula (in LB + Ampicillin) of two backbones(BBa_823024 and BBa_823026) from the plates of Fabio and Bruno(2 inocula for each sample).

In order to evalutate if the expression of EFE is toxic or not to our cells I created a growth curve. I started from an inoculum of AraCpBAD + EFE that I prepared yesterday. I diluited 50ul of the overnight culture in 5ml of LB and I incubated at 37C with shaker until the cultures reached approximately 0,6 O.D at 600nm. I took 2 samples for negative controls and 2 samples for the induced cells. After that I added 25ul of Arabinose 1M stock solution to the induced samples (5mM working solution) and I registered the O.D. of the samples one time per hour (for 4 hours). In the end I plotted the results.

As expected, the strong induction of our gene slightly influences on growth-rate (caused by stress) but still is not completely toxic.
To confirm this result I made a toxicity test by serial dilution. I diluited 50ul of overnight culture (one induced sample and one not induced) into 9,5ml of LB. After vortexed the samples, I further diluited them 1:10 for three times. In the end I plated 150ul of each dilution onto Chloramhenicol Plates.
As you can see from the images, there's not big differences in the colony forming ability of the induced and the not induced sample, even in a dilution of 1:1000. Maybe I should dilute them more!

The results of the transformations were not so good. We've only few colonies on each plate (only on Michele's control there were many colonies!). Despite this, we've decided to do inocula of some colonies in the afternoon. On the rest of the day Michele tried two different PCRs to obtain pSB1C3 linearized (someone stole his supplies!!). Obviously no results (immagini gel?). Caterina repeated the digstion but she used two differents type of ligase for the reaction of ligation. At the end of the day she transformed Nebα with these new products of ligation.

In orde to caracterize the inducible promoters of the two B. subtilis backbone I have to amplify two reporters and ligate them into the backbones. So I did the miniprep of the 4 inocula(B.subtilis backbones) following the vacuum protocol then I have quantified the products with the following results: Moreover I did the inocula of the 2 GFPs(BBa_E0240 and BBa_E0840)(4 inocula for each sample) from the plates previously done.

I did the miniprep of the 8 inocula(2 GFP constructs) following the vacuum protocol then I have quantified the products with the following results: Then I did the screening of the samples E0840/1,E0840/3,E0240/2,E0240/4. I digested 800 ng of each sample with EcoR1-HF and Pst1-HF following the digestion protocol for screening. After 40 minutes I loaded the samples on a gel with the following results: We can see 2 bands for well: the upper is the backbone(pSB1A2 2079 bp), the lower is presumably the GFP(BBa_E0240 826 bp,BBa_E0840 828 bp)(pefix and suffix escluded ?).

First of all Gabriele quantified the four pSB1C3+R0010 inocula of yesterday.
Then, the four quantified samples were screened after a digestion with ExoRI-HF and PstI-HF, with the usual screening protocol (incubated only for 45min, since both the enzymes are HF).

The digestion products were then run on a gel with a transparent loading dye (30% glycerol): each loaded sample contained 16µl of the sample and 4µl of transparent loading dye. Both a 1kb normal ladder and a 100bp transparent ladder were loaded, also the first well was loaded with the usual loading dye.
Finally, Emil prepared the inocula of the product of ligation of R0010 and SAMsynthetase (in pSB1A2: 6 inocula of the 1:1 ligation product and 3 of the 1:3 ligation producta).

I screened the three other sample of GFP(0840/2,0840/4,0240/1,0240/3) like in the previous post with the following results:(the gel was run together with Girelli's sample, we are interested in the first 4 sample) We can see 2 bands for each sample: the upper is the plasmid(pSB1A2 2079 bp), the lower is presumably the GFP(BBa_E0240 826 bp,BBa_E0840 828 bp)(prefix and suffix escluded)at 900 bp.Afterwards i have amplified 0.5 6micro;l of one of the 4 sample(E0840/4 475.9 ng/micro;l) following the PCR protocol and exploiting the universal primers(prefix Forward,Suffix Reverse) with the following resuts(as usual I did a gel to verify the pcr): As we can see the pcr completed succesfully, there are the right bands at 900-1000 bp.Then I purified the pcr following the purification protocol . After that I have quantified the product with the following results: Finally I have digested o/n all the 48.5 µl of b sample and of 2 sample of the backbone(K823026 359.7ng/µl,K823024 334.4ng/µl) with EcoR1-HF and Pst1 following the digestion protocol.

This morning I added 1 µl of DPN1 to the GFP ligation and 1 µl of SAP(alkaline phosphatase) to the 2 backbones.After 1h 30 min I have stopped the reaction by putting the reaction tubes at 80 C°.Afterwards I have purified the products following the purification protocol.Then I quantified the products with the following results:

Then I performed the ligation(1:1,1:3,CTRL) of the GFP with the 2 backbone individually and following the ligation protocol.Finally I transformed 10 µl of the ligation protocol in Neb10β and plate them on ampicillin LB agar following the transformation protocol.

I miniprepped K823025 and obtained two good yields: 293,5 ng/ul and 236,6 ng/ul; I screened both samples (1000 ng digested in 50 ul) and the gel confirmed the presence of the plasmid. We have another one!! Afterwards we reported a summary table of part obtained and their yelds

OOPS… I DID IT AGAIN!!! Yesterday’s screening was a total failure, so today we tried to screen K823000a and k143012b but unfortunately we chocked again, twice!! We made 2 different gels, with 2 different formulas (the first one with 1 % of agarose, the second one with 1,5 % and 100bp ladder, right for short parts). At the same time we failed to screen a bunch of new promoters miniprepped this morning from some overnight inocula: K823003, k823002, k143012 (all transformed in NEB5a) While attempting to screen those parts we transformed and plated NEB5a with k823000; K050901; K050904 and two new backbones for B.subtilis: K823024 (Pxil) and K823026 (Pspac).

The last battle!!! Today we screened successfully three parts, K823003, K823002, K143012 . We used a brand new formula: first of all we digested 1500 ng of DNA in 50 ul. Then we changed the gel composition (1,5 % agarose, 3,5 ul of etidium bromide in 35 ml of gel). Finally we loaded the 100 bp marker along with the 1000kb marker and the parts with a loading dye missing of the dye ( 30% glicerole solution instead). We put this unusual gel in the electrophoresis chamber for 20 minutes. We obtained dim but still present traces. In the afternoon we extracted a new Bacillus promoter (PliaI, K823001) from 2013 registry kit (plate 1 20c) and transformed both in 100 ul of NEB10b and NEB5a. We also did the inocula for the parts plated yesterday.

we realized that the other day we put the wrong antibiotic in the new plasmids inocula; according to that Bruno found out that nothing grew in there. So this afternoon we made inocula again, this time with Ampicilline. We also made some inocula of the 3 confermed promoters just to have enough stock material.

today we miniprepped k823001, k823024 and k823026 and screened successfully (1500 ng digested for the promoter, 800 ng for the plasmids). WOOT!! we used a standard gel composition for the backbones and the “ brand new formula” for K823001. Thing is, the 2 plasmids seem to be inverted!!! Now we gotta figure out when the two of them have been inverted!!

in order to verify weather the plasmids have been inverted during miniprep purification protocol, or screening protocol or even before, during plating, we made the minipreps out of the remaining inocula and then screened them: the risults were the same, so probably we made a mistake during plating! Now everything is more clear!! In the afternoon we made the inoculum of the last plasmid ( K823025, sent right from the Part’s Registry Headquarters).

in order to propagate B. subtilis from the pellet that we purchased (strain ind- tyr+ B.subtilis ATCC 23857) , first we needed to obtain the perfect medium for its growth. We prepared Nutrient Broth for liquid cultures and Nutrient Broth + Agar for plates, following ATCC PROTOCOLS. So we decided to have them in both a STARCH-added version and a version without starch.
Nutrient agar (100 ml) : 0,8 g nutrient broth: 1,5g Agar; water to 100 ml.
Nutrient agar + starch (100 ml) : 0,8 g nutrient broth: 1,5g Agar; 2ml starch from potato, water up to 100 ml.
Nutrient broth (250 ml): 2 g nutrient broth; 250 ml water.
Nutrient broth + starch (250 ml): 2 g nutrient broth; 5 ml starch; water up to 250 ml;
To propagate di original bacillus pellet, we resuspended it in 1 ml of nutrient broth+starch and put this milliliter in 5 ml of nutrient broth+starch for a final 6 ml mother liquid culture. Then we made several other liquid cultures with different bacteria concentrations from the Mother (for each concentration we made both starch and non-starch liquid cultures). We put all in a shaker at 26 degrees. We plated also the same concentrations in several plates with both Nutrient agar + starch and Nutrient agar alone, and put them at 26. Just out of curiosity we decided to put some plates and some liquid cultures at 37 degrees.

HORROR!! We lost kind of the whole bacillus that we had, during the night, cause the liquid cultures were disrupted in the shaker at 26!! Luckily we have a survivor, the liquid culture at 37, and all the plates.
From the survivor we made further liquid cultures ( at 26°, 1:50 and 1:100; at 37° 1:50 and 1:100)
As soon as they became very cloudy we went along with the glycerol stock preparation and put our bacillus at -80°. The one that weren’t cloudy have been kept in the shaker all night long.
In the afternoon we inoculated some colonies from the plates in 5 ml of nutrient broth +starch.

today we made glycerol stock tubes from the remaining cultures and from the inocula made yesterday, but before that we collected some bacteria to make other two liquid cultures just to have more glycerol stock tubes to put at -80°

In order to see if our EFE enzyme is effectively active and functional I made a gas-cromatography analysis.
Starting from an overnight culture, I diluted it 1:100 and I incubated it until it reached 0,5 O.D.600. After that, I added 5mM of Arabinose and I incubated the culture at 37°C for about 4-5 hours. In the I connected the vial previously keeped ermetically closed at the micro GC and I took the measure. I did this work for three samples: negative control (not induced), 5mM Arabinose V=1,5ml and 5mM Arabinose V=3ml. As you can see, seems that the device is correct and functionally active! Definetely a good result!

Today was a nice day! Finally Michele’s plate were positive (no colonies on the control and lot of them on the others!) So at the end of the day we could do the inocula. Moreover Michele finished the reaction of ligation with the plasmid pSB1C3 linearized (digested the day previous by Caterina (link post)) and J45319 and transformed it in 200 ul of NebB10. At the end of the day Caterina plate them. Everything is working. Hoping that Mesa will be detectable!

You know, after a BBBQ, everything is more difficult!! In particular today was an exausting day. While in the morning Caterina did three miniprep from the inocula (post del giorno prima metti link = 4 with araCpBAD + BSTM1 in pSB1C3 and 1 only control of Neb10&beta, mettere immagine del gel di cate) Michele took the two inocula that left and did 7 diluition 1:100 in 20 mL of LB. In particular he did 2 diluition for the control and five for the bacteria with the plasmid. He put them at 37°C in agitation waiting for them reaching O.D. = 0.5. After four hours he did the induction with arabinosio even if the bacteria with the plasmid were at about 0.3 O.D. The induction was done only on five samples to have another control. After two hours it was added different concentrations of Salycilic Acid (in solution with H20 and etanol) in different samples and after two more hours we did a SNIFF Test to understand if some Mesa was produced. The results were not so brilliant: in fact the bacteria in which were added higher concentrations of SA stinked a bit less and were more fresh. Durante la giornata cate ha fatto anche pcr per J45119 ma fail (immagine) In più fatte prime misure con GC per vedere detabilità mesa (grafici)

I observed the plates but unfortunately there were some colonies also in the control (perhaps it was due to degradation of ampicillin when it was added to LB agar too hot) so I have decided to re-transform the products of ligation left following the transformation protocol. These are the results of the plate: Moreover I did the inocula of the old plate(3 for K823026+E0840 1:1,3 for K823026+E0840 1:3,3 for K823024+E0840 1:1,3 for K823024+E0840 1:3) in 5 mL of LB with Ampicillin(1:1000).

I purified the inocula done the day before following the purification protocol.Then I quantified the results with the following results: Then I screened the purified products following the digestion protocol.These are the results of the gel(1%): As we can see ther are two bands for each well(like expected after the digestion) but only the lower band of the 6 well has the GFP(920 bp) as insert, the other have only the RFP witha promoter.So I decided to repeat the digestion of GFP(an old sample 42.6 ng/µl digested completely) and the same sample of the two backbone exactly like in the previous days.I did the inocula of the new transformation and also of two colonies of the plate that I tooK the E sample from(2 E sample(1:1 024+0840),1 1:1 024+0840,2 1:3 024+0840,2 1:1 026+0840, 2 1:3 026+0840).

I added 1 µl of DPN1 to the insert and 1 µl of SAP to the backbones.Then I have purified the inocula following the miniprep protocol.Afterwards I quantified them toghether with the results of the purification of the digestion products(performed following the purification protocol ) with the following results: Then I digested 800 ng of each sample with EcoR1 HF and Pst1 following the digestion protocol with the following results: As we can see no one of the wells shows the right insert in the lower band(there is always the previous insert the RFP + Lac promoter ~ 1200 bp).At the same time I did the ligation of K823024+E0840 and K823026+E0840 previously digested following the ligation protocol .
N.B. Remember always to spin the ligation buffer before using
After that I plated the product of the ligation as done before(1:1,1:3,ctrl for each sample) on Ampicillin added LB.

I verifyed the status of the last inocula(05/7) that resulted a bit strange. Unfortunately The day before were inoculate uncorrect plates(03/7) so I have purified them following the purification protocol these are the results of the quantification. Afterwards I screened 800 ng of the samples following the screening protocol with EcoR1 HF and Pst1, these are the results of the gel:

As we can see only the third(024) sample shows the insert at the right size of 1000 bp(the lower band), then I did the inocula of the plates of 5/07(1:1,1:2,1:3) and of the old plate that gives right results to amplify 024(1:1).

I set up a system to ripening or block ripening a set of green (immature) bananas.
The idea is to grow into a beaker our strain of E. coli that produces ethylene, and connect it to a laboratory dryer with bananas. In this way, E. coli (be stirred and 37 ° C), producing Ethylene, should increase the maturation of the banana in the dryer connected.
In addition, we have included in another beaker Mesa pure with LB, which should slow down the ripening at high concentration and should promote the ripening at low concentrations.

Unfortunately only one of the inocula of 05/7 has succeded and shows an incorrect red color(RFP the previous insert) so I decided to purify and quantfy only the 2 attempt to amplify 024. I have purified them following the purification protocol these are the results of the quantification. Afterwards I screened 800 ng of the samples following the screening protocol with EcoR1 HF and Pst1, these are the results of the gel: No one of the sample has succeded there are only the bands of the backbone and ther aren't visible inserts of any kind, so I decided to re-try the ligation with two couples of 026 and GFP(026a=36.3 ng/µl,026b=37.6ng/µl,GFPa=15.9ng/µl,GFPb015.8ng/µl,I have done it following the ligation protocol (I have only changed the amaunt of plasmid:300 ng).Afterwards I have transformed and plated on ampicillin agar 8 NEB10β (2 ctrl,2 1:1, 2 1:2, 2 1:3).I have also amplified the 024(2 inocula).

(1) PCR: SAM synthetase amplification

I amplified SAM synthetase by performing a PCR on the samples G1 and E2 from 17/06.

Sample	Quantification
G1	80ng/µl
E2	60ng/µl

The PCR was performed following the usual SAM extraction protocol.

PCR results were then run on a 1% agarose gel:

Since the gel shows two bands at nearly 1200bp, the PCR results are confirmed. The PCR products were then purified with the Promega kit.

Sample	Type	Quantity
G1	SAM synthetase	35.6ng/µl
E2	SAM synthetase	31.5ng/µl

---

(2) pSB1A2+R0010+SAMsynthetase ligation screening

Then I screened the inocula from the 26/06 ligation. First I miniprepped the inocula:

The samples were then digested using the screening digestion protocol and then run on a 1% agarose gel.

Given that the gel shows only two bands (one at nearly 2kbp and the other at 200bp), SAM synthetase is not present and the ligation failed.

---

(3) Linear pSB1C3 purification

I also purified with the usual protocol the linearized pSB1C3 from 19/06.

	Sample	Type	Quantity
G2	linear pSB1C3	74.4ng/µl
G3	linear pSB1C3	63.3ng/µl
G2A	linear pSB1C3	44.0ng/µl
G3A	linear pSB1C3	44.8ng/µl
G4A	linear pSB1C3	41.9ng/µl

---

(4) O/N Digestion

Finally, I prepared an overnight digestion of the samples G1 (SAM synthetase) and G2 (linear pSB1C3) to try again the ligation tomorrow. I followed the usual protocol.

SAM synthetase ligation in (linear) pSB1C3

First of all, early in the morning I added 1µl of DpnI to the SAMsynthetase#G2 O/N digestion and 1µl of SAP to the linear_pSB1C3#G2 digestion and then incubated them at 37°C for 1.5 hours (afterward I inhibited the enzyme with 20 minutes at 80°C).

Then, I purified and quantified the two digestion samples:

Sample	Quantity
G1 SAMsynthetase	18.8ng/µl
G2 linear pSB1C3	6.5ng/µl

After that, I performed the ligation (the plasmid had a too low concentration).

	Ctrl	0.5:1	0.5:2
Buffer	3µl
Plasmid	14.3µl
Insert	0	6µl	12µl
Ligase	1µl
Water	11.7µl	5.7µl	0µl

And, "finally", I transformed the ligations in NEB10β cells.

---

(2) SAMsynthetase amplification

I amplified SAMsynthetase from the E2 sample (that was purified yesterday) following the usual protocol. The PCR was performed in triplicates.

The PCR products were run on a 1% agarose gel.
As shown in the gel, a band at nearly 1200bp is present, confirming the success of the PCR.

---

(3) R0010 amplification

I also amplified R0010 from A sample (R0010, 243.7ng/µl) from 27/06. Being the first time amplifying this sequence, I performed (in triplicates or duplicates) a Phusion PCR using as primers the prefix Fw (Tm = 86°C) and the suffix Rv (Tm = 90°C).

Given that R0010 is 200bp long, the PCR program was the following:
Since R0010 is very short, the PCR products were run on a 1.5% agarose gel using transparent loading dye.
As shown in the gel, a band at nearly 200bp is present in each lane. So, the PCRs were successful!

---

(4) linear pSB1C3 amplification

I didn't know that linear pSB1C3 is "impossible" to amplify, and that the only way to get it is to linearize the circular one. So I tried its amplification and failed.

First of all I counted the colonies from yesterday:

plate	#colonies
Ctrl	4
0.5:1	2
0.5:2	0

---

Then, I tried again to linearize pSB1C3 (this time, starting from the circular), but I failed.

In order to see the progress of the production of ethylene in time, 7 ml of culture were grown until O.D. 600 reached 0,5. The culture was then induced with 70 ul arabinose (5mM) and putted with a stirrer into a sealed tube with a pierceable septum. The tube was then connected to the Micro GC (Agilent 3000A) and immersed in a thermal bath at 37 °C with magnetic stirring. A measurment was taken every hour for 8 hours. The results were not so exciting. The colony didn't produce any level ethylene and we have no idea why. Maybe the colony from which the inocula were done wasn't the right one. I'll try the experiment again the next monday!

This morning I repeated the experiment done the last thursday. This time however, I used the same vial used during the ethylene detection experiment. This time the experiment worked as expected and I successfully plotted the data.
A sample of the same stock culture was kept in thermoshaker. As expected an higher value of ethylene was detected (see the green point) since it was subjected to only one measure (thus having no gas loss due to repeated measures).

I (yes I'm egocentric) did the miniprep(wath a new thing!) of the inocula(I didn't purified the 1:2 due to their despicable red color) previously done(the last I hope) following(is always the same but I have to write it anyway)the miniprep protocol(OOOH!that's incredible!).These are(obviously)the results of the quantification: Afterwards I screened them(800 ng for each sample) following the digestion protocol so I have obtained these results: As we can see in the last 4 samples the lower band is clearly at 1000 bp then the GFP is probably present, the succesfull samples were sent to be sequenced!

Since the new forward primer (with the entire prefix) arrived, I started again from the beginning.

SAM synthetase extraction

The new primer forward has just the EcoRI restriction site added at its beginning (complete prefix):
GAATTCGCGGCCGCTTCTAGAGAAGGAGGAACTACTATGGCAAAACACCTTTTT
It has a Tm = 68.7°C.

Then I performed two Phusion PCR (one GC and one HF) and one Phusion/RBC PCR to identify the best protocol for SAM synthetase extraction with the new primer.
The products of these three PCRs were then loaded on a 1% agarose gel. As showed by the gel, only the Phusion/RBC PCR was successful.

---

Purifications

Then, I purified the EX-SAMsynthetase-SP sample produced today with the Phusion/RBC PCR, and the 5 R0010 PCR insert that were amplified on tuesday 02/07.

Sample	Type	Quantity
RBC(3)	EX-SAMsynthetase-SP	103.6ng/µl
HF1	R0010 insert	17.5ng/µl
HF2	R0010 insert	19.5ng/µl
HF3	R0010 insert	15.9ng/µl
G1	R0010 insert	17.8ng/µl
G2	R0010 insert	16.3ng/µl

---

OverNight Purification

Then, Viola was so polite to prepare the O/N digestion mixes (with the usual protocol) and incubate them at 37°C. An EX-SAMsynthetase-SP sample (RBC#3 from today, 103.6ng/µl) and a linear pSB1C3 sample (G3A from 01/07, 44.8ng/µl) were restricted with XbaI and PstI (Nebuffer2).

Firstable I did an inoculum of Neb10β in order to make them competent the next day.I started to prepare the media needed for the transformation of Bacillus according to LMU munich protocol but due to the failure of this protocol I won't report the protocol.

I did some competent cells according to the competent cell protocol .

SAM synthetase extraction

Last time I determined the correct protocol to extract SAM synthetase from the E. coli using the new plasmid (at the end, the protocol was the usual one). I performed three PCRs (G1, G2, G3) and run the products on 1% agarose gel.

---

Ligation

At first, I added 1µl of SAP to pSB1C3 O/N digestion and 1µl of DpnI to SAMsynthetase O/N digestion, and incubated the samples at 37°C for 1.5h. Then I quantified the digestions.

Sample	Quantity
SAM synthetase	12.2ng/µl
pSB1C3	14.0ng/µl

Then I performed the ligation and left the reaction run for 2h at room temperature. Then I transformed the ligation products in NEB10β

Checked out the plates from yesterday and then stocked them at 4°C.

Plate	#colonies
CTRL	7
1:1	2
1:2	1

I prepared 3 inocula from yesterday's plates:

• Two inocula from the 1:1 plate.
• One inocula from the 1:2 plate.

All the inocula medium contained cloramphenycol.

Since I was not satisfied with the curve obtained during the last experiment, I decided to redo the experiment, this time starting from a culture with O.D.600 = 0,8 and registering a measurment every 45 min.
Interestingly, inducing with arabinose when the sample has reached OD600 0.8 causes an increase of more than two fold in the production of ethylene.

I added 1µl of DpnI to G1_EX-SAMsynth-SP O/N digestion and 1µl of SAP to G2A_linear-pSB1C3 O/N digestion, and then incubated both samples at 37°C for 1.5h. Finally, I stocked both samples at -20°C because I would like to ligate them together with the short digestion that I am going to perform tomorrow.

Screening with AgeI

First, Caterina performed a screening using AgeI on the "1:1 A" sample from 15/07. But then we realized the Gabriele was mistaken, AgeI is able to cut both Plac+RFP and SAMsynthetase so it is not the correct enzyme to perform the screening with...

---

Short digestion

Gabriele then performed a short digestion (aka: a digestion similar to the screening run for 2 hours) with the sample G2_EX-SAMsynth-SP (62.6ng/µl from 15/07) and G4A_linear-pSB1C3 (41.9ng/µl from 01/07). After the 2 hours of incubation, Gabriele added 1µl of DpnI to the G2 sample and 1µl of SAP to the G4A sample and incubated them at 37°C for 1h.

---

Digestions purification

After that, Gabriele purificated both today's short digestion and the O/N digestion from yesterday.

Sample	Digestion	Quantity
EX-SAMsynth-SP	Short	39.0ng/µl
linear-pSB1C3	Short	12.1ng/µl
EX-SAMsynth-SP	O/N	13.1ng/µl
linear-pSB1C3	O/N	7.8ng/µl

---

Short digest Ligation

So, Gabriele performed a ligation of the short digested samples.

	Ctrl	1:1	1:2	1:3
buffer	3.5µl
plasmid	5µl
insert	0	8µl	16µl	26µl
Ligase	1µl
Water	25.5µl	17.5µl	9.5µl	0

Then the ligation mixes were incubated at room temperature for 2 hours.

---

O/N digest Ligation

Finally, Gabriele performed a ligation of the overnight digested samples.

	Ctrl	1:1
Buffer	3.5µl
Plasmid	15µl
Insert	0	15µl
Ligase	1µl
Water	15.5µl	0.5µl

Then, the ligation mixes were incubated at room temperature for 2 hourse.

Today, after a long and hard fight with our thesis, we came back to work. In particular we teased the 2012 Registry Distribution and we extracted two new parts: BBa_K537055 (679 bp) and BBa_K537056 (721 bp). These two parts contained two reportes gene, mCherry and Venus. We did this because we wanted to fuse at the C-term of BBa_K1065001 a reporter in order to measure the kinetic of the protein sythesis. A new chapter to add to our team!

Yesterday, I performed inocula from different plates prepared by Gire. After miniprep and screening we had the confirmation that into pSB1C3 there was RFP and not SAM synthetase. So on Monday we will repeat the experiment.

Then I performed the miniprep of some inocula that I prepared the yesterday containing K1065101 and K1065102.

This is the part two of this experiment. Since both Venus (BBa_K537006) and AraC-pBAD + EFE were in pSB1C3 vector, I had to do a PCR on Venus using primers Prefix Fwd and Suffing Rev following this protocol. The PCR product was then confirmed by an electrophoresis analysis (Venus is 729 bp and KAPA universal Ladder was adopted).

The PCR product was then purified and quantified at the NanoDrop. Once I obtained Venus without his backbone, I proceeded digesting all the PRC Venus product with NgoMIV and PstI and 2-3 ug of AraC-pBAD + EFE with AgeI and PstI following the PCR product digestion protocol. The digestion products were finally purified, quantified and stored at -20 °C.

This is the part three of this experiment. The digestion products were ligated together following this protocol. The vector (AraC-pBAD + EFE) was ligated with 1:0 (control), 1:1 and 1:4 of insert (Venus). The ligation product was then transformed into NEB10b competent cells and plated on Cloramphenicol containing Petri dishes.

I performed the digestion o/n of SAM synthetase and R0010 in pSB1C3.

I performed the ligation and the trasformation of SAMsynthetase in pSB1C3 with ROO10.

Also I transformed Gabriele's ligations from 17/07 into NEB10β.

I have prepared a minimal medium for bacillus following the Cambridge Igem 2012 protocol and I did an inocula of bacillus from a glicerol stock 50% for the following day. Moreover I tried to grow some competent NEB10β following the competent cell protocol .

We have tied to grow B.subtilis in the minimal medium (Cambridge protocol and Mansy's friend's protocol) with no evidence of growth, in the previous days we have observed that B. subtilis grow in LB so we have tried to transform B. subtilis in LB following the LMU munich protocol modified.We transformed 2 groups of cells with the construct K823026+GFP but we mistaken the right Kanamicin concentration of the stock solution(10mg/ml)so no the following day ther were no colonies on the plates.

This is the part four of this experiment. I proceeded preparing 5 inocula from the 1:1 and 1:4 ligation product Plates. The inocula were grown overnight at 37 °C in thermoshaker.

Unfortunately the previous attempt to transform failed maybe due to the mistaken concentration of antibiotic so I restarted generating a stock solution of Kanamicin(10mg/ml).I did an inocula in LB of Bacillus overnight from the stock solution with 50% of glicerol.

I have transformed 3 groups of cells with 500 ng of pSpac+pLac+RFP,I grew Bacillus in LB and when it reached OD of 1.1 I added the DNA to 400 µl of cells,I let grow for 1 hour and then I plated the cell on Kanamicin plates.Afterwards I transformed Neb10β with 100 ng of K823026+E0840 following the transformation protocol.

What happened to the inocula???

First, I wanted to miniprep 3 inocula... but two were RED!!! So sad, the RFP was present... that's because I forgot to treat the linear plasmid with DpnI :(
I miniprepped the only not-red inoculum, the "1:1 A" which had a concentration of 230.5ng/µl. Then I stocked the sample at -20°C. The possible presence of Plac+RFP is a problem since it is nearly as long as the SAM synthetase gene. So, for the screening, I need an enzyme that cuts only one (either SAM synthetase OR Plac+RFP) forming two fragment with a Δlength higher than 500bp (otherwise it is impossible to distinguish the two bands). Then enzyme that we will use is AgeI.

---

Another digestion

So, I purified the SAM synthetase extracted through PCR on 11/07.

sample	Quantity
G1	116.7ng/µl
G2	62.6ng/µl
G3	82ng/µl

Then I added 1µl of DpnI to the linear pSB1C3 sample (G2A from 01/07) and incubated it at 37°C for 1 hour. Then I prepared an overnight digestion following the usual protocol.

I checked the plates prepared by Caterina yesterday.

plate	#colonies	#inocula
ON Ctrl	0	0
ON 1:1	6	5
ON 1:3	0	0
Short Ctrl	0	0
Short 1:1	1	1
Short 1:3	1	1

As you might notice, an O/N 1:3 ligation was never performed, the problem is that Caterina wrote the wrong labels on the plates, so we can't link the plates back to the ligations... anyway, we will keep the denomination of the plates from now onward.

I checked yesterday's inocula and, surprisingly and sadly, 4 out of 7 were red!!! I must admit that I don't get how it is possible to have red inocula when I treated the linearized-by-PCR pSB1C3 with the DpnI enzyme... that's crazy... anyway the quantification results are the following:

Inocula	Quantity
ON 1:1 A	RED
ON 1:1 B	RED
ON 1:1 C	216.4ng/µl
ON 1:1 D	215.5ng/µl
ON 1:1 E	RED
Short 1:1	RED
Short 1:3	315.5ng/µl

Screening digestion

Screening was performed with BamHI-HF and PstI-HF. While PstI-HF cuts at the suffix (the end of the insert), BamHI-HF is able to cut only SAMsynthetase at 102th base position. So, the screening digestion will show one band at nearly 3100bp if pSB1C3 contains Plac+RFP, at nearly 2000bp if an 'empty' pSB1C3 is present and two bands (one at nearly 2200bp and the other at nearly 1000bp) if we have pSB1C3 with SAMsynthetase.
The screening digestions were incubated at 37°C for 1 hour and the run on a 1% agarose gel.
As you can see, the gel shows a band at nearly 2kbp and one at nearly 1kbp at the 13S lane, so that sample should contain the desired construct (pSB1C3+SAMsynthetase).

This is the part five of this experiment. I proceeded with a miniprep purification of the previously prepared inocula and a screening digestion in order to verify the construct.


As you can see from the gel image, only one sample seems to confirm our fusion protein and will be sent for sequencing. Lane 4: insert 3024 bp, vector 2070 bp. Kapa universal ladder was adopted.

this morning, Bruno is not available, so I will take care of the ripenator. I have to replace all the cultures with new LB and new bacteria : I’m gonna put 300 ml of LB in each beutas, then connect immediately a beuta with LB and 3ml of not-induced bacteria to the control banana!! After that, I will dissolve 78 ul of MESA in the second beuta and connect to the blocked banana! As far as the ethylene sample is concerned, I have to put 3 ml of bacteria in the last beuta, wait for the OD lecture to reach the value of 0,5 and then induce the culture with Arabinose to produce Ethylene! Finally I can connect it with the mature banana.

the time has come to extract from the 2013 kit some other new parts: they will be needed to allow our divice to be activated by blue or red light!! Awesome, don’t you think? The parts are:
K592016: a blue sensor with its response regulator; k592006: a promoter induced by the blue regulator;
k519030: the device with the red sensor and necessary enzymes; r0082: the red promoter.
We after extracting them we transformed in neb5a and plated.

today we made 2 inocula for each one of the 4 parts we transformed!! We’re ready to see what’s next!

today we performed the miniprep protocol on our inocula. yealds are:
006 a: 169,3 ng/ul;
006 b: 204,4ng/ul;
016 a: 204,9 ng/ul;
016 b: 173,7 ng/ul;
030 a: 276ng/ul;
030 b: 375,8ng/ul;
082 a: 173,1ng/ul;
082 b: 225,9 ng/ul;
After that we screened 006b, 016a,082 and 030.
As we can see from the gels, we didn’t confirm the presence of any of them!! Now we are going to do a second set of inocula!

today we tried to pcr yesterday’s minipreps out with Taq polymerase but even this time the screening wasn’t successful at all!!
We inoculated for the THIRD time the 4 parts too!

this morning I made some minipreps from last night inocula ( third set) instead Bruno perform the same protocol on the second set of inocula.
Second set yields are:
006a : 289
006b : 409.3
016° : 188.8
016b :266.6
030a : 388.6
030b : 270
082a : 433.0
082b : 568
Third set yiealds are:
006: 321 ng/ul
016: 440.9 ng/ul
R0082: 441,5 ng/ul
030: 199,9 ng/ul
These ones haven’t been screened so far.
Meanwhile, we extracted a latter incredible part: k952003, which contains the blue device, the blue promoter and a fluorescent reporter.

today we decided to get our parts sequenced, so I prepared sequencing samples and tomorrow they will be sent to a sequencing company.
We also inoculate the new part: k952003. From now on Bruno and I will take our own paths!!

let’s get ready to screen!! This time I amplified my parts by pcr them out with OneTaq polymerase!! I started from the blue promoter (number A from the firt set). Pcr sample composition:
5X Onetaq standard reaction buffer 10 ul
10 mM dNTPs 1 ul
Forward primer 1ul
Reverse primer 1 ul
One Taq 0.25
Phusion 0.3
Template 0.5
Water up to 50 ul
Pcr program values:
Initial digestion: 94° 2min
Digestion: 94 30 sec
Annealing: 60 1 min
Annealing: 68° 15 sec
Final extention: 68° 5 min
(30 cycles from step 3 to step 5)
The screening was successful :
Finally I purified the PCR and abtained a 209,8 ng/ul yieald. Meanwhile I started thinking about the ligation of the two blue parts: the idea is to use k592016 as plasmid and k592006 as an insert to put downstream . So I had to digest o/n 3 ug of 016(from the first set) with Spel and Pstl, and 006( the purified Pcr) with Xbal and Pstl. At the same time I digested R0010 with Ecorl and Spel, cause I’ll need to put it on top of everything once I have my biobrick.

this morning I added Sap to the 016 digestion and dPnl to the other two, then I purified them and quantified'em:
O16: 29,8 ng/ul
006: 16,2 ng/ul
R0010: 6,1 ng/ul
Then I started the ligation following the ligation protocol: at the end of it, I transformed 10ul of the ligation in 200 Neb10b and plated. Meanwhile Bruno miniprepped k952003 inocula and the screening was successful!!

Today I inoculated 6 colonies of the plated ligation ( 3 from the 1:1 plate and 2 from the 1:3 plate)
I also made the Onetaq Pcr for all the light parts ( blue device,the b sample from the first set; red device, from the third set; and red promoter, from the third set).
After that I screened them all and found out that only the blue part was confirmed: up to now we only have the blue parts confirmed!! Red parts , it seems to me that you’re in hot waters !!

today I miniprepped and screened (on a medium and a large size gel) the 6 ligation inocula!

As we can see from the gel the ligation seems not to be occurred!! I forgot to run the plasmid (016) alone to see a difference with the ligations though!! However I need to digest k592016 again to repeat another ligation with the blu promoter!!this time I digested 3 ug of the A sample from the first set!!

I first added sap to the o/n digestion( third), then purified and quantified : yield, 32,3 ng/ul. Then again I ligated 006 to 016 folowing the protocol and plated 10 ul in 200 ul of neb10b. In the afternoon I made 6 inocula from the second ligation plates! Today I decided also to take a crack at a fourth ligation with a new strategy: using 006 as my plasmid and 016 as the insert!! I need to digest the two part with different enzymes E and X for 006 and E and S for 016! This time I digested 2400 ng for only 5 ours, not all the night: yields are, 25 ng/ul for 016 and 11,8ng/ul for oo6. Tomorrow I will continue with the ligation number 4.

today I started with the fourth ligation and then I transformed for the fourth time. Meanwhile I minipreppeed inocula from the second ligation, but screening wasn’t successful!! I also inoculated 6 colonies from the third ligation plates( only the plate 1:1).

here we go again!! Today I miniprepped the third ligation inocula and the screening as asual wasn’t successful!! I’m kinda bummed!! At list I have my fourth and last ligation: I made 6 inocula from the plate 1:1. Will see tomorrow!

Once I confirmed the construct through an electrophoresis analisis, I decided to transorm the sample C into NEB10b cells. I plated then 100 ul of cells and putted the plate in static incubation at 37 °C overnight. As you can see from the picture, the colonies grown. One of them was then picked up and inoculated overnight.

Starting from an inoculum, I diluted the cells 1:100 in fresh LB and I waited until O.D.600 of the sample reached 0.5. I induced then the cells (V=5ml) with 25 ul of Arabinose (5mM) and I incubated them into thermoshaker at 37 °C for 4 hours. One sample were not induced and used as negative control. After 4 hours I tried to use the trans-UV too see any differences between induced sample and control. Both culture had the same color (not fluorescence) so the experiment failed. However the sample was sent for sequencing so now I'll wait the result before restart all the cloning steps..

In order to test the transformation protocol for B. subtilis that Groeningen team kindly sent to us I prepared a competent cell Media following this protocol. I proceeded then perfonming the transformation using the empty vector BBa_K823026. I finally plated the tranformed cells into LB agar plates with 10 ug/ml of Kanamycin. The day after took a picture of the plate and performed a Gram staining following this protocol. As you can see from the pictures, seems that Bacillus was successful transformed!!!!

Today massive miniprepping y’all!! This is a wonderful day because one of my miniprep seems toOk!! Sample number 3 from the 3rd ligation doesn’t show the band that correspond to 016 not ligated to the 006 promoter! Tomorrow I’ll need to verify by onetaq pcr.

today I made the Onetaq pcr on my positive ligation miniprep (same program and sample composition that I used last time!! On the gel below we can see 016 digested and my positive ligation pcr amplification. After this success I started the ligation of this device to r0010, already digested with proper enzymes: E and S; I digested with E and X for 30 minutes even 50 ng O16+006 ( yield is 161,9 ), then deactivated enzymes at 80 degrees, added Sap, and ligated: I prepared control, 1:1, 1:2, 1:3 and 1:4 using the ligation protocol, and incubating for 30 minutes, then I deactivated at 80 degrees. After that I transformed 10 ul of the ligations in neb10b.

today unfortunately I miniprepped the last inocula (from ligation nr. 4) and screening didn’t verify the presence of any ligation. What a drag!! The only thing that remains to be done is to inoculate more and more colonies from previous plates: 6 from ligation 3 (plate 1:1) and 6 from ligation nr. 4 (plate 1:1).

So, I didn't believe Cristina when in July she told us: "In August we're going to work twice than this" but I had better trust her. Today I did two TLC on four different samples to detect MeSA presence (FOTO). As you can see only the control (MeSA pure diluited 1:1 in CH2Cl2) ran. These was the third TLC that failed then we decided to avoid more TLC tests. During the day I checked also the growth of Bacillus (link previous post sporulation). In the crazy afternoon after an hard fight with the order in the Lab I performed a screening on GFP (Bba_E0840) to verify if our stock was correct.. As you can is present the band at 878 bp so the screening gave positive results. During the digestion and the electrophoretic run I also did a transforamtion of Neb10β with EFE in pSB1C3. (HTML format)

I made mini prep from inoculum overnight. I oubtained the following yields:


from that I made an overnight digestion of 5ug of DNA with EcoRI and XbaI but only for 003-1 sample, two set of digestion.

Today it was an hard day, after 27 miniprep and 27 screening I didn't obtain positive results, so I restarted the digestion, ligation and trasformation of R0010 + K592009 in pSB1C3 and in pSB1A2.

Today I started a new cloning in order to obtain GFP in the vector pSBBs0K-Pspac (BBa_K823026). This construct will be useful to Emil in order to characterize Pspac at difference concentration of inducer (IPTG). I started performing a PCR on the GFP following the Phusion PCR protocol. I used BB_fwd and BB_rev primers to obtain an amplification of the insert. This because the GFP backbone (BBa_E0840) had the same antibiotic resisistance of our destination vector BBa_K823026 (Amp). I obtain a PCR product with a concentration of 146 ng/µl, confirmed by electrophoresis analysis. I continued then with the restriction digestions following this protocol. I digested BBa_K823026 using SpeI and PstI, and PCR product with XbaI and PstI.
The two digestion products were then purified and quantified: GFP PCR 60 ng/µl, BBa_K823026 19 ng/µl. The last step was then the ligation that was performed following this protocol. The ligation products were then plated on CM plates.

Starting with the plates I did yesterday, I prepared the following overnight cultures. I did that also with some colonies transformed with pXyl (BBa_K823024) + GFP (BBa_E0840) that Fabio gave me in order to amplify his construct.

Today I started from the overnight cultures that I did yesterday. I performed a miniprep purification following this protocol. I quantified then the products at the nanodrop obtaining these results: I proceded then with a screening digestion in order to confirm the products. Kapa universal Ladder was adopted. Lane 2,3,4: as you can see, the bands confirmed the reamplification of BBa_K823024 (4974 bp) + BBa_E0840 (878 bp). Lane 5,6,7,8,9: as you can see, the higher band confirmed the vector BBa_K823026 (8289 bp) while the lower band didn't confirm the insert BBa_E0840 (878 bp). I think it took a fusion between BBa_E0840 (878 bp) and RFP coding device (1069 bp) since the band is at the level of 2100 bp and since I had few pellets that were red. So the ligation between pSpac and GFP failed.. I hope that the next time I'll be more lucky!

Today I performed a PCR on EFE in pUC57 vector in order to linearize it and eliminate the vector. To do this I used primers BBa_Fwd and BBa_Rev. The reaction was assembled as follow exploting both OneTaq and Phusion polymerase.

5x One Taq Buffer	10 µl
Fwd Primer	1 µl
Rev Primer	1 µl
10 mM dNTP's	1 µl
One Taq	0.25 µl
Phusion	0.3 µl
Template DNA	0.7 µl (about 500 ng)
H2O	35.75 µl

When the reaction finished, I performed an electrophoresis analysis in order to confirm the product. Kapa universal ladder was adopted. As you can see, the Gel image is quite confusing. First of all, the marker should be diffused in the sample lane (lane 1) as we can see the same band of the ladder but with a more tenuous coloration. Secondly, the thickest band was at about 1200 bp height even if EFE is 1078 bp long. I think the product has to be confirmed again...!

today i saw the plates of the cloning that i did yesterday and tha control plate was a mess... there were too many colonies!!i will do some inocula this evening..i try to redo a new ligation adding the SAP after the digestion of EFE in pUC57. Meanwhile i will start a new overnight digestion trying to insert EFE in the PsB1C3 backbone of the part s04617.

Today we made 5 different competent cells following the transformation protocol:
- NEB10β
- TB1
- TOP10
- JM109
-BL21

Then we trasformed in these cells R0010-K592009 in psB1C3 and K1065300.

After the negative screening of Pedro's inocula of the ligation of EFE + s04617 today I retried this cloning.

The plates that i did yesterday are quite perfect! The ctrl plate is quite empty and there are many colonies on the other samples (1:1,1:2,1:3,1:4). This evening i will do some inocula. Today I'm making also the screening of yesterday's inocula from that bad plates and from the gel we can see that the ligation worked only in the third sample:

After some fails we repeated the cloning of K592016 in psB1A3 (with R0010) and of R0010 in pSB1C3 (with K591016).

I did a cloning of K592016 in J61002. The promoter in this plasmid is J23100.

I obtained K592016 in the J61002 plasmid under the control of J23100 promoter! I did a screening to confirm the cloning with EcoR I and Pst I.

In order to transform Bacillus with pXyl (BBa_K823024) + GFP (BBa_E0840), reamplified and screened the 2nd of August, I prepared an inoculum in 2 ml of MN completed medium (see protocol). While I was waiting that O.D.600 reached 0.5, I proceded digesting 2,5 µg of sample 2 and sample 3 of the construct pXyl + GFP using ScaI as restriction enzyme. I did this in order to linearize the plasmid and allow his integration in B. subtilis genome. 0.5 µg of each sample were then run on an agarose gel for screening. As you can see from the picture, there are two not expected bands: one at height of 4500 bp and one at height of about 1800 bp. I can't explain this two bands since ScaI should digest only at only one sites on the construct.. However there's also a band at the height between 5000 and 6000 bp as expected (pXyl+GFP = 5782 bp) so I transformed it into bacillus anyway.

Today we performed a digestion of J23100+K592016 with EcoR I and Spe I, and K592020 in pSB1C3 with EcoR I and XbaI to obtain the complete biobrick...waiting tomorrow for the results.

in order to demonstrate the integration of pXyl in Thr locus (essential for the biosinthesis of threonine) I have prepared 40 ml of a minimal medium (MNGE) following the LMU munich protocol without the threonine.Then I did an inoculum from the plate obtained from the transformation of 29/7.