Team:Heidelberg/Templates/DelH overview1

From 2013.igem.org

Schematic representation of DelH cluster and structure of delftibactin.

Restriction Digest and Ligation Strategy

  • PCR amplification of the 18 Kb DelH fragment as sub fragments F1 (10 Kb) and F2 (8 Kb)
  • Assembly of backbone pSB6A1-Arac-lacZ by PCR amplification of fragments from BioBricks
  • Ligation of the construct DelH F1 + DelH F2 + backbone pSB6A1-Arac-lacZ
  • Transformation of E. coli TOP10 with DelH plasmid
  • Characterization of positive (blue) colonies by colony PCR


Vector Maps, Primers and BioBricks

Vector map of the pHM01:DelH plasmid.
Backbone Part Distribution Plate Well Usage Resistance
pSB4K5 J04450 Spring 2012 1 5G Backbone for DelA-G,OP,L Kanamycin
pSB1AK3 I732019 Spring 2012 4 12G lacZ reporter gene Kanamycin, Ampicillin
pSB2K3 I0500 Spring 2012 1 14N AraC promoter Kanamycin
pSB6A1 J04450 Spring 2012 1 1K Backbone for DelH Ampicillin
pSB1C3 J04450 Spring 2012 1 3A Backbone for Indigoidine Chloramphenicol
Identifier Order date Note Sequence
DN01:DelH_f1_PacI_fw 03-05-2013 Amplification of DelH F1, with RBS and adding PacI restriction site TTTT TTAATTAA TCACACAGGAAAGTACTAG ATGGACCGTGGCCGCCTGC GCCAAATCG
DN02:DelH_f1_SalI_rev 03-05-2013 Amplification of DelH F1 until SalI TTTT GTCGACCAACACCTGTGCCTGC
DN03:DelH_f2_SalI_fw 03-05-2013 Amplification of DelH F2 starting SalI TTTT GTCGACTGGATGGAGCCTGGTGAAAG
DN04:DelH_f2_KpnI_rev 03-05-2013 Amplification of DelH F2, adding KpnII restriction site TTTT GGTACC TCAGTCCAGCGCGTACTCCAG
DN05:AraCbb_KpnI_fw 03-05-2013 Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site TTTT GGTACC AAAGAGGAGAAATACTAGATGACCATG
DN08:AraCbb_PacI_rev 03-05-2013 Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site TTTT TTAATTAA GCTAGCCCAAAAAAACGGGTATG


Retrieved from "http://2013.igem.org/Team:Heidelberg/Templates/DelH_overview1"