Team:Heidelberg/Templates/DelH week11

From 2013.igem.org

Contents

08-07 - 14-07-13

Amplification of DelH F1b

PCR Conditions F1b.W11.A

Reagent DelH F1b - from purified F1b
05-07 (genome amplified) 		DelH F1b - from purified F1b
05-07 (genome amplified)
Template 1 µl of PCR 1b (19 ng/µl) 1 µl D. acidovorans
Primer fw 10 µM 1 µl DelH_EcoRI_fw 1 µl DelH_EcoRI_fw
Primer rev 10 µM 1 µl DelH_f1_SalI_rev 10 1 µl DelH_f1_SalI_rev
Phusion Flash Ready Mix 10 µl 10 µl
ddH2O 7 µl 6 µl
DMSO - 1 µl
Cycles Temperature [°C] Time [s]
1 98 5
30 98 1
68 5
72 2:15 min
1 72 7 min
1 4 inf

Result

Expected band: 5 Kb

Fig.11.1 gel of amplified fragment F1B(loaded 20 µL)
l1:F1b without DMSO, l2: 2log ladder, l3: F1b with DMSO

There is a specific band, but not at 5 Kb.

=> We cannot amplify F1b from a PCR fragment. Use fresh bacteria instead.


Preparation of fresh ACM media

  • Mix ingrediants according to Acidovorax complex medium
  • Autoclave
  • pH adjust to 7,3
  • Mix 500 ml media and 6 g agar
  • Autoclave again
  • Pour plates

Preparation of fresh D. acidovorans

  • Inocculate 5 ml ACM media with D. acidovorans
  • Incubate ON
  • Prepare glycerol stock
  • Streak some of culture on plates


PCR Conditions F1b.W11.B

Reagent DelH F1b DelH F1b
Template Fresh colony of plate
by DN from 10-07 		Fresh colony of plate
by DN from 10-07
Primer fw 10 µM 1 µl delH_EcoRI_fw 1 µl delH_EcoRI_fw
Primer rev 10 µM 1 µl delH_f1_SalI_rev 1 µl delH_f1_SalI_rev
Phusion Flash Ready Mix 10 µl 10 µl
ddH2O 7 µl 6 µl
DMSO - 1 µl
Cycles Temperature [°C] Time [s]
1 98 5
12 98 1
68 (touchdown -0.5°C) 5
72 2:30 min
18 98 1
68 5
72 2:30 min
1 72 10 min
1 4 inf

Result

Expected band: 5.4 Kb

Fig.11.2 gel of amplified fragment 1B(loaded 20 µL)
l1:F1b without DMSO, l2: 2log ladder, l3: F 1b with DMSO
l3 shows a slight band at 5 Kb


There is a weak band at the probe 1b WITH DMSO above 5 Kb.

=> Start a new PCR with 50 µl with the same conditions.


PCR Conditions F1b.W11.C

Reagent DelH 1b
Template Fresh colony of plate by DN from 10-07
Primer fw 10 µM 2.5 µl delH_EcoRI_fw
Primer rev 10 µM 2.5 µl delH_f1_SalI_rev
Phusion Flash Ready Mix 25 µl
ddH2O 17.5 µl
DMSO 2.5 µl
Cycles Temperature [°C] Time [s]
1 98 5
12 98 1
68 (touchdown -0.5°C) 5
72 2:30 min
18 98 1
68 5
72 2:30 min
1 72 10 min
1 4 inf

Result

Expected band: 5 Kb.

Fig.11.4gel of amplified fragment 1B(loaded 50 µL)
l1:2log ladder, l2-4: F 1b with DMSO
l2-4 band at 5 Kb was cut out
Fig.11.3 gel of amplified fragment 1B (loaded 50 µL)
l1:2log ladder, l2-4: F 1b with DMSO
l2-4 show expected band at 5 Kb and another lower band



The expected band at 5 Bk is weak, but visible. Note that there is sample left in the pocket.

=> The fragment was cut and gel extracted.


Generation of DelH plasmid

Restriction Digest

Of fragments F1a, F1b, F2 and backbone.

Fragment DNA [µl] ddH2O [µl] Enzymes [µl] BSA [µl] Buffer 4 [µl]
F1a (1) 30 7 1.5 Pac & EcoRI-HF each 5 5
F1a (2) 30 7 1.5 Pac & EcoRI-HF each 5 5
F1b (11.7 - 20 µl) 20 17 1.5 SalI-HF & EcoRI-HF each 5 5
F1b (11.7 - 50 µl) 20 17 1.5 SalI-HF & EcoRI-HF each 5 5
F2 20 17 1.5 SalI-HF & KpnI-HF each 5 5
BB (6-7 of IK - 14 ng/µl) 20 17 1.5PacI & KpnI-HF each 5 5
BB (6-7) 20 17 1.5 PacI & KpnI-HF each 5 5

Result

Loaded 5 µl of restriction digested fragments on gel. The result stands in the table below:

Fragment Band Conclusion Next step
F1a purified on 12-07 strong bands at 1, 2 and 3 Kb
weak band at wanted 5 KB 		PCR purification of F1a step was not the right purifying step load complete probe on gel and gel extract
F1b purified on 12-07 weak band at 5 Kb maybe only low concentration run PCR again
F2 no band maybe too low concentration run PCR again
BB weak band at 7.4 Kb maybe only low concentration run PCR again

Gel Extraction of DelH F1a

Expected band: 5 KB, loaded entire F1a purified on 12-07 on gel

Fig.11.5gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: F1b, l4:F2, l5: BB

No band visible.

=> Gel extract earlier PCR from 06-07.


Expected band: 5 Kb

Fig.11.6gel of minipreped and PCR-amplified DelH fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: Miniprep of BB (pSB6A1), l4:PCR of BB (pSB6A1)

PCR shows expected band.

=> F1a was cut and gel extracted.


Amplification of DelH F1b

PCR Conditions F1b.W11.D

Reagent DelH F1b
Template 1 µl F1b digested 12-07
Primer fw 10 µM 1 µl delH_EcoRI_fw
Primer rev 10 µM 1 µl delH_f1_SalI_rev
Phusion Flash Ready Mix 10 µl
ddH2O 6µl
DMSO 1 µl
Cycles Temperature [°C] Time [s]
1 98 5
12 98 1
68 (touchdown -0,5°C) 5
72 2:30 min
18 98 1
68 5
72 2:30 min
1 72 10 min
1 4 inf

Result

Expected band: 5.4 Kb

Fig.11.7gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: F1b, l4:F2, l5: BB

PCR did not yield the specific band.

=> Use altered PCR conditions.


Amplification of DelH F2

PCR Conditions F2.W11.A

Reagent DelH F2
Template 1 µl F2 digested 12-07
Primer fw 10 µM 1 µl delH_f2_SalI_fw
Primer rev 10 µM 1 µl delH_f2_KpnI_rev
Phusion Flash Ready Mix 10 µl
ddH2O 7 µl
Cycles Temperature [°C] Time
1 98 5 s
30 98 1 s
66 5 s
72 3:00 min
1 72 10 min
1 4 inf

Result

Expected band: 8 Kb

Fig.11.7Gel of PCR of DelH fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: F1b, l4:F2, l5: BB

PCR does not show the specific band.

=> Further optimization.


Amplification of Backbone

PCR Conditions BB.W11.A

Reagent Backbone
Template 1 µl backbone digested 12-07
Primer fw 10 µM 1 µl AraCbb_KpnI_fw
Primer rev 10 µM 1 µl AraCbb_PacI_rev2 10
Phusion Flash Ready Mix 10 µl
ddH2O 7 µl
Cycles Temperature [°C] Time [s]
1 98 5
30 98 1
66 5
72 3:00 min
1 72 10 min
1 4 inf

Result

Expected band: 8 Kb

Fig.11.7Gel of PCR of DelH fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: F1b, l4:F2, l5: BB

PCR does not show the specific band.

=> Repeat using fresh backbone DNA from miniprep.


Miniprep

  • Inocculation of 10 ml LB Amp with DH10ß (pSB6A1-AraC-lacZ)
  • Perform mini prep


PCR Conditions BB.W11.B

Reagent Backbone
Template 1 µl Miniprep A of 10-07
Primer fw 10 µM 1 µl AraCbb_KpnI_fw
Primer rev 10 µM 1 µl AraCbb_PacI_rev2
Phusion Flash Ready Mix 10 µl
ddH2O 7 µl
Cycles Temperature [°C] Time [s]
1 98 5
12 98 1
66 (touchdown -0.5°C) 5
72 3:00 min
18 98 1
66 5
72 3:00 min
1 72 10 min
1 4 inf

Results

Expected band: 7.4 Kb, loaded miniprep and PCR product.

Fig.11.8gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: Miniprep A of BB, l4:PCR of BB

Miniprep shows weak band at ~7.4 Kb. PCR does not show expected band.

=> Prepare new mediprep of backbone (pSB6A1-AraC-lacZ)


Gibson Assembly Strategy

Vector map of the pHM02:DelH-pSB6A1-AraC-lacZ Gibson-plasmid.
Identifier Order date Note Sequence
DN01:DelH_f1_PacI_fw 03-05-2013 Amplification of DelH F1, with RBS and
adding PacI restriction site 		TTTT TTAATTAA TCACACAGGAAAGTACTAG ATGGACCGTGGCCGCCTGC GCCAAATCG
DN02:DelH_f1_SalI_rev 03-05-2013 Amplification of DelH F1 until SalI
restriction site 		TTTT GTCGACCAACACCTGTGCCTGC
DN03:DelH_f2_SalI_fw 03-05-2013 Amplification of DelH F2 starting at
SalI restriction site		 TTTT GTCGACTGGATGGAGCCTGGTGAAAG
DN04:DelH_f2_KpnI_rev 03-05-2013 Amplification of DelH F2, adding
KpnII restriction site 		TTTT GGTACC TCAGTCCAGCGCGTACTCCAG
DN05:AraCbb_KpnI_fw 03-05-2013 Amplification of backbone for DelH
(pSB6A1-AraC-lacZ), adding KpnI site 		TTTT GGTACC AAAAGAGGAGAAATACTAGATGACCATG
DN08:AraCbb_PacI_rev 03-05-2013 Amplification of backbone for DelH
(pSB6A1-AraC-lacZ), adding PacI site 		TTTT TTAATTAA GCTAGCCCAAAAAAACGGGTATG


Retrieved from "http://2013.igem.org/Team:Heidelberg/Templates/DelH_week11"