"
Team:Carnegie Mellon/Protocols
From 2013.igem.org
Contents |
Minipreps
Plasmid DNA was purified from 3ml overnight cultures using GeneJET Plasmid Miniprep Kits (Thermo Scientific).
PCR amplification
PCR was used to amplify the fluorescent proteins KillerRed and mRFP1 so that they could be cloned into the pSB1C3 plasmid backbone for BioBrick parts submission, pSB1A2 plasmid backbone containing the WTlac promoter and ligated into the lambda gt11 arms. Phusion High Fidelity Taq Polymerase (Thermo Scientific) was used with an annealing temperature of 60ºC and an elongation time of 45sec.
Primers for PCR
Killer Red part submission
BB_Eco_KR_F TATATAGAATTCGCGGCCGCTTCTAGATGGGTTCAGAGGGCGGC
BB_Pst_KR_R TATATACTGCAGCGGCCGCTACTAGTATTATTAATCCTCGTCGCTACCGATGG
Plasmid expression of KillerRed (KR) and mRFP1 (RFP)
SpeRBSKRF TATATAACTAGTTCTAGAGAAAGAGGAGAAATACTAGATGGGTTCAGAGGGCGGC
PstSTKRR TATATACTGCAGTTATTAATCCTCGTCGCTACCGATGG
SpeRBSRFPfor TATATAACTAGTTCTAGAGAAAGAGGAGAAATACTAGATGGCTTCCTCCGAAGACGTTATC/p> <p>PstSTRFPrev TATATACTGCAGTTATTAGCGATCTACACTAGCACTATCAGCG
Cloning KR and RFP into lambda predigested arms
EcoKRF TATATAGAATTCATGGGTTCAGAGGGCGGC
EcoKRStR TATATAGAATTCTTATTAATCCTCGTCGCTACCGATGG
EcoRFPfor TATATAGAATTCATGGCTTCCTCCGAAGACGTTATC
EcoRFPstR TATATAGAATTCTTATTAGCGATCTACACTAGCACTATCAGCG
XL10 competent cell preparation
1. Set up 5mL overnight (O/N) culture from a single colony (freshly struck from glycerol stock if possible).
2. Inoculate 50 mL pre-warmed LB in 250mL conical flask with 0.5 mL O/N culture.
3. Grow at 37ºC until the A600 nm is between 0.3 and 0.5 (0.4 is ideal).
4. Pour cells into pre-chilled 50 mL Falcon tube. Leave in ice-water for 10 minutes (cold room is ideal).
5. Spin down at 4000 rpm for 10 minutes and remove supernatant very gently. Resuspend cells in 25mL of ice-cold 0.1 M CaCl2. Use a P1000 to resuspend the cells initially in 1mL and then bring up to 25mL. Mix until not clumps are visible.
6. Incubate in ice-water for 30 minutes.
7. Spin down at 4000 rpm for 10 minutes and remove supernatant very gently. Resuspend cells in 3.3mL of ice-cold 0.1 M CaCl2. Use a P1000 to resuspend the cells in 1mL initially and then bring up to 3.3mL. Make sure no clumps are visible.
8. Incubate cells on ice for at least 1 hour before using them – the longer the better up to 24 hours.
9. To store cells at -80ºC add 1mL 50 % (v/v) glycerol (final concentration = 12.5 %). Aliquot 100ml into pre-chilled eppendorf tubes (~40 tubes worth). Snap-freeze tubes in liquid nitrogen and then store in -80ºC.
Transformations
1. Add DNA to chilled eppendorf tube and add 30-100 uL of cells.
2. Incubate on ice for 5 minutes.
3. Heat shock at 42ºC for 2 minutes.
4. Place on ice for 5 minutes.
5. Add 500ul LB to the cells and incubate at 37ºC for ~1 hour.
6. Plate out cells.
Plasmid cloning
Vectors and PCR products were digested with appropriate restriction enzymes (New England Biolabs) for 2 hours and purified from agarose with GeneJET Gel Extraction kits (Thermo Scientific). Ligations were for 10min at room temperature.
Lambda ligation and packaging
Digested PCR product was ligated with predigested lambda arms (Lambda gt11/EcoRI/CIAP Treated Vector Kit, Agilent Technologies) at 4ºC overnight and then mixed with Gigapack III Plus Packaging Extract for 2hours prior to infection of the permissive host, Y1088.
Infections with lambda and titering of phage
The host for infection was prepared by growing overnights with 0.2% maltose and 10mM MgSO4. To prepare plating cells, bacteria were diluted, outgrown for 1-2 hours, pelleted and resuspended to an OD600 of 0.5 with MgSO4. Bacteriophage were adsorbed to plating cells for 15min at 37ºC and then mixed with 3ml of top agar prior to spreading. IPTG and X-Gal (Research Products International Corp) were added to the top agar when necessary. For titering, serial dilutions of the phage were made. Plates were incubated at 32ºC or 37ºC.
Lysogens
Lysogens were formed by infecting Y1089 at high multiplicity (more phage than bacteria). Colonies were then patched and screened for growth at 32ºC, 37ºC and 42ºC, those bacteria that showed phage at 42ºC were lysogens.
To induce the prophage and increase copy number the cultures were incubated at 42ºC for one hour and then cultured and induced with 10mM IPTG.
Photobleaching
Overnight cultures were diluted 1:10 and grown for 2 hours, IPTG was added and growth continued for another 4 hours. Cultures were placed in 4ºC refrigerator overnight to allow for the maturation of the KillerRed and mRFP1 chromophores. Cultures were divided into exposed and unexposed and those to be exposed were placed 24 inches from the lamp. Light intensities range from .7 to 1.3 W/cm2 between 545 nm and 585 nm. Continuous wave bleaching was performed for 5 hours.
