http://2013.igem.org/wiki/index.php?title=Special:Contributions/Czh&feed=atom&limit=50&target=Czh&year=&month=
2013.igem.org - User contributions [en]
2024-03-28T13:29:13Z
From 2013.igem.org
MediaWiki 1.16.5
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Team
Team:Shenzhen BGIC 0101/Team
2014-04-03T11:13:06Z
<p>Czh: </p>
<hr />
<div>{{:Team:Shenzhen_BGIC_0101/Templates/Header}}<br />
<html><br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<body><br />
<br />
<!-- test --><br />
<h1>Consortium</h1><br />
<p>Shenzhen_BGIC_0101 is a union team:<br/><br />
6 universities<br/><br />
– UCAS, SCUT, UESTC, SCNU, SCU and HUST<br/><br />
9 members<br/><br />
– 2 postgraduates and 7 undergraduates</br><br />
– They are all co-culture students between BGI college and their home universities.</br><br />
</p><br />
<p style="text-align:center;"><img src="https://static.igem.org/mediawiki/2013/5/52/Tj_1.jpg" width="800px" /></p><br />
<br />
<br/><br/><br />
<hr style="color:#B09CC9; height:3px;" /><br />
<br />
<h1 class="team">Members</h1><br />
<h2>Postgraduate</h2><br />
<section class="container clearfix" id="home-content"><br />
<div class="one-third column"><br />
<article class="mini-post"><br />
<img width="290" height="135" src="https://static.igem.org/mediawiki/igem.org/3/3a/Xiang.jpg" class="attachment-front-page-thumb wp-post-image" alt="Yuxiang Li" /> <br />
<div class="text"><br />
<h3>Yuxiang Li</h3><br />
<p>Li is a postgraduate in UCAS, majoring in Bioinformatics. <br/><br />
He is a calm man and likes to speak reasonably. He concentrates on programming for nucleotide sequence editing and also data transport.</p> <br />
</div><br />
</article> <br />
</div><br />
<br />
<div class="one-third column"><br />
<article class="mini-post"><br />
<img width="290" height="135" src="https://static.igem.org/mediawiki/igem.org/a/a5/Xiao.jpg" class="attachment-front-page-thumb wp-post-image" alt="Xinming Liang" /> <br />
<div class="text"><br />
<h3>Xinming Liang</h3><br />
<p>Liang is also a postgraduate in UCAS, same with Li. </br><br />
He is responsible man. He loves badminton, orienteering, swimming and also is a HD movie fan. He focuses on programming for chromosome design in this project.</p><br />
</div><br />
</article><br />
</div><br />
</section><br />
<br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br />
<hr style="color:#BDCBBD; height:1px;" /><br />
<br />
<br />
<h2>Undergraduate</h2><br />
<section class="container clearfix" id="home-content"> <br />
<div class="one-third column"> <br />
<article class="mini-post"><br />
<img width="290" height="135" src="https://static.igem.org/mediawiki/2013/a/a7/Gongjianhun.png" class="attachment-front-page-thumb wp-post-image" alt="gongjun" /> <br />
<div class="text"><br />
<h3>Jianhui Gong</h3> <br />
<p>Gong just graduated from his college SCUT and now works for BGI as a synthetic biology-bioinformatics analyst. He is a crazy SBer and is responsible for chromosome segmentation. BTY, he is team leader.</p><br />
</div><br />
</article> <br />
</div><br />
<br />
<div class="one-third column"> <br />
<article class="mini-post"> <br />
<img width="290" height="135" src="https://static.igem.org/mediawiki/igem.org/2/2d/Lu.jpg" class="attachment-front-page-thumb wp-post-image" alt="Xujia Lu" /> <br />
<div class="text"><br />
<h3>Xujia Lu</h3><br />
<p>Xujia is from UESTC, shy in the face and gesture, but evil in the heart. He likes novel things and always does something amazing. He is very creative and for most of the time has his own ideas.</p><br />
</div><br />
</article><br />
</div><br />
<br />
<div class="one-third column"><br />
<article class="mini-post"><br />
<img width="290" height="135" src="https://static.igem.org/mediawiki/igem.org/2/2b/Li.jpg" class="attachment-front-page-thumb wp-post-image" alt="Yincheng Li" /> <br />
<div class="text"><br />
<h3>Yincheng Li</h3><br />
<p>Li is an undergraduate from SCNU, specializing in Information and Computer Science.</br><br />
He focus on the pathway processing. He enjoys the project and the teamwork. </p><br />
</div><br />
</article> <br />
</div><br />
</section><br />
<br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br />
<br />
<section class="container clearfix" id="home-content"><br />
<div class="one-third column"><br />
<article class="mini-post"><br />
<img width="290" height="135" src="https://static.igem.org/mediawiki/igem.org/2/29/Zc.jpg" class="attachment-front-page-thumb wp-post-image" alt="Chao Zhang" /><br />
<div class="text"><br />
<h3>Chao Zhang</h3><br />
<p>Czh is a student from UESTC, he is insteresting in bioinformatics and web technology. In his spare time, he enjoy playing e-sports (DOTA) with his little buddies.</p><br />
</div><br />
</article><br />
</div><br />
<br />
<div class="one-third column"><br />
<article class="mini-post"> <br />
<img width="290" height="135" src="https://static.igem.org/mediawiki/igem.org/d/d6/Zeng.jpg" class="attachment-front-page-thumb wp-post-image" alt="Wenzuo Zeng" /><br />
<div class="text"><br />
<h3>Wenzhuo Zeng</h3><br />
<p>Wenzhuo or Table is an undergraduate student in SCNU, majoring in Software Engineering. She is responsible for the pathway drawing of Genovo and she has passion for doing such significant software. </p><br />
</div><br />
</article><br />
</div><br />
<br />
<div class="one-third column"> <br />
<article class="mini-post"><br />
<img width="290" height="135" src="https://static.igem.org/mediawiki/2013/3/35/Bx.jpg" class="attachment-front-page-thumb wp-post-image" alt="Boxian Lai" /> </a><br />
<div class="text"><br />
<h3>Boxian Lai</h3><br />
<p>Boxian lai is student form SCNU, major in computer sciences. He is responsible for designing oligonucleotides and primers for synthesis on a chip.His interest is play computer program and mine information form bio_data. </p><br />
</div><br />
</article><br />
</div><br />
</section><br />
<br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br />
<br />
<br />
<section class="container clearfix" id="home-content"><br />
<div class="one-third column"><br />
<article class="mini-post"><br />
<img width="290" height="135" src="https://static.igem.org/mediawiki/igem.org/b/be/Hu.jpg" class="attachment-front-page-thumb wp-post-image" alt="Zeyun Hu" /><br />
<div class="text"><br />
<h3>Zeyun Hu</h3><br />
<p>Huzeyun is a student from Sichuan university, major in biotechnology, his is also a parter of Innovation Class of BGI. His hobby is play for the belife "life is a charming game, we should go all out."</p><br />
</div><br />
</article> <br />
</div><br />
</section><br />
<br />
<br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br />
<hr style="color:#BDCBBD; height:3px;" /><br />
<br />
<br />
<h1 class="team">Instructor & advisor</h1><br />
<section class="container clearfix" id="home-content1"><br />
<div class="one-third column"><br />
<h2>Huanming YANG</h2><br />
<article class="mini-post"><br />
<img width="290" height="320" src="https://static.igem.org/mediawiki/2013/9/9d/Yhm.jpg" class="attachment-front-page-thumb wp-post-image" alt="Huanming YANG" /> <br />
</article> <br />
</div> <br />
<br />
<div class="one-third column"><br />
<h2>Yun WANG</h2> <br />
<article class="mini-post"><br />
<img width="290" height="320" src="https://static.igem.org/mediawiki/2013/6/6f/Wy.jpg" class="attachment-front-page-thumb wp-post-image" alt="Yun Wang" /> <br />
</article><br />
</div><br />
<br />
<div class="one-third column"><br />
<h2>Yue SHEN</h2><br />
<article class="mini-post"><br />
<img width="290" height="320" src="https://static.igem.org/mediawiki/2013/2/2d/Sy.jpg" class="attachment-front-page-thumb wp-post-image" alt="Yue SHEN" /><br />
</article><br />
</div><br />
<br />
<br />
</section><br />
<br />
<br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br />
<br />
<section class="container clearfix" id="home-content"><br />
<div class="one-third column" style="margin: 0 110px 0 110px;"><br />
<h2>Yu CHEN</h2> <br />
<article class="mini-post"><br />
<img width="290" height="320" src="https://static.igem.org/mediawiki/2013/3/34/Cyy.jpg" class="attachment-front-page-thumb wp-post-image" alt="Yu CHEN" /> <br />
</article> <br />
</div><br />
<br />
<div class="one-third column"><br />
<h2>Kang KANG</h2><br />
<article class="mini-post"><br />
<img width="290" height="320" src="https://static.igem.org/mediawiki/2013/0/07/K2.jpg" class="attachment-front-page-thumb wp-post-image" alt="K2" /><br />
</article> <br />
</div><br />
</section><br />
<br />
<br />
<br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br />
<hr style="color:#B09CC9; height:3px;" /><br />
<br />
<h1>Attribution</h1><p><br />
1. Jianhui Gong designed most of the projects.<br/><br />
2. Xujia Lu covers graphical user interface and software framework of Genovo and also the drag & drop operation method.<br/><br />
3. Xinming Liang, Yuxiang Li and Jianhui Gong cover programming for chromosome structure constructing, nucleotide sequence editing and chromosome segmentation for assembly respectively.<br/><br />
4. Chao Zhang covers wiki establishment.<br/><br />
5. Yincheng Li covers BioStudio installation and debugging.<br/><br />
6. Wenzhuo Zeng covers kgml parsing and presentation.<br/><br />
7. Boxian Lai covers linking segmentation with OLS method for synthesizing DNA.<br/><br />
8. Zeyun Hu covers database collecting.<br/><br />
</p><br />
<br/><br/><br />
<hr style="color:#B09CC9; height:3px;" /><br />
<br />
<br />
<h1>Support</h1><br />
<h2>1. Financial support:</h2><p><br />
BGI College, it paid team & attendance registration fee, travel allowance and accommodation fee for us.</p><br />
<br/><h2>2. Workplace & desktop & test environment provider:</h2><p><br />
BGI, Shenzhen, it provided us enough room to discuss, work together, organize meetings and also at least 7 desktops. BGI also allowed us to test our plug-ins and program on mainframe.</p><br />
<br/><h2>3. Server support:</h2><p><br />
Dr. Huixiong Li from UESTC and Liping Yang from BGI assisted us to establish web-server.</p><br />
<br/><h2>4. Software design guidance:</h2><p><br />
Mr. Yun Wang assisted us to design the third module SegmMan, assembly from 2k minichunks to 10k chunks, and then to 30k megachunks.<br/><br />
Dr. Patrick Yizhi Cai pointed out some errors of design principle, especially in the homologous recombination from 30k megachunks to whole chromosome.</p><br />
<br/><h2>5. Software based framework provider:</h2><p><br />
Jbrowse & Gbrowse from GMOD.<br/><br />
GeneDesign & BioStudio from Dr. Sarah Richardson of John Hopkins University.<br/><br />
GASP from Dr. Eroshenko from Harvard School of Engineering and Applied <br/><br />
Sciences<br/><br />
Some nameless frameworks from D3 library and KEGG.</p><br />
<br/><h2>6. Team shirt design support:</h2><p><br />
Mr. Kang Kang helped us to design two types of shirts, one for team members, one for advertising and sales.</p><br />
<br/><br/><br />
<br />
<hr style="color:#7380AE; height:3px;" /><br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Home
Team:Shenzhen BGIC 0101/Home
2013-10-25T08:39:07Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<!-- lazyload --><br />
<br />
<br />
<br />
<br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style_slider?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/jquery?action=raw&ctype=text/javascript"></script><br />
<br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<br />
<br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<style><br />
h3{<br />
font-family: 'Tangerine', serif;<br />
font-size: 45px;<br />
text-shadow: 4px 4px 4px #aaa;<br />
color: #38f;<br />
letter-spacing: 0.1em;<br />
word-spacing: 0.3em;<br />
font-weight: 700;<br />
line-height: 36px;<br />
margin: 0;<br />
}<br />
<br />
.reference{<br />
clear:both;<br />
top:40px;<br />
left:120px;<br />
<br />
font-size: 16px;<br />
line-height: 19px;<br />
font-family: Trebuchet MS;<br />
font-weight: 600;<br />
position:absolute;<br />
text-align:left;<br />
width:48%;<br />
padding:20px;<br />
background-color:#ffe;<br />
-moz-box-shadow:1px 3px 15px #ddd;<br />
-webkit-box-shadow:1px 3px 15px #ddd;<br />
box-shadow:4px 3px 25px #ddd;<br />
}<br />
<br />
ul.accordion{<br />
list-style:none; <br />
position:absolute;<br />
right:150px;<br />
top:0px;<br />
font-family: Cambria, serif;<br />
font-size: 16px;<br />
font-style: italic;<br />
line-height: 1.5em;<br />
}<br />
ul.accordion li{<br />
float:right;<br />
width:115px;<br />
height:480px;<br />
display:block;<br />
border-right:2px solid #fff;<br />
border-bottom:2px solid #fff;<br />
background-color:#fff;<br />
background-repeat:no-repeat;<br />
background-position:center center;<br />
position:relative;<br />
overflow:hidden;<br />
cursor:pointer;<br />
-moz-box-shadow:1px 3px 15px #555;<br />
-webkit-box-shadow:1px 3px 15px #555;<br />
box-shadow:1px 3px 15px #555;<br />
}<br />
ul.accordion li.bg1{<br />
background-image:url(https://static.igem.org/mediawiki/2013/c/c8/Bki-20101209112236-2125207650.jpg);<br />
}<br />
ul.accordion li.bg2{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bg3{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bg4{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bleft{<br />
border-left:2px solid #fff;<br />
}<br />
ul.accordion li .heading{<br />
background-color:#fff;<br />
padding:10px;<br />
margin-top:60px;<br />
opacity:0.9;<br />
text-transform:uppercase;<br />
font-style:normal;<br />
font-weight:bold;<br />
letter-spacing:1px;<br />
font-size:14px;<br />
color:#444;<br />
text-align:center;<br />
text-shadow:-1px -1px 1px #ccc;<br />
}<br />
ul.accordion li .description{<br />
position:absolute;<br />
width:480px;<br />
height:175px;<br />
bottom:0px;<br />
left:0px;<br />
display:none;<br />
}<br />
ul.accordion li .description h2{<br />
text-transform: uppercase;<br />
font-style: normal;<br />
font-weight: bold;<br />
letter-spacing: 1px;<br />
font-size: 25px;<br />
color: #444;<br />
text-align: left;<br />
margin: -15px 0px 0px 20px;<br />
text-shadow: -1px -1px 1px #ccc;<br />
}<br />
ul.accordion li .description p{<br />
line-height:14px;<br />
margin:10px 22px;<br />
font-family: "Trebuchet MS", sans-serif;<br />
font-size: 12px;<br />
font-style: italic;<br />
font-weight: normal;<br />
text-transform: none;<br />
letter-spacing: normal;<br />
line-height: 1.6em;<br />
}<br />
ul.accordion li .description a{<br />
position:absolute;<br />
bottom:5px;<br />
left:20px;<br />
text-transform:uppercase;<br />
font-style:normal;<br />
font-size:11px;<br />
text-decoration:none;<br />
color:#888;<br />
}<br />
ul.accordion li .description a:hover{<br />
color:#333;<br />
text-decoration:underline;<br />
}<br />
<br />
ul.accordion li .bgDescription{<br />
background:transparent url(https://static.igem.org/mediawiki/igem.org/1/15/BgDescription.png) repeat-x top left;<br />
height:340px;<br />
position:absolute;<br />
bottom:0px;<br />
left:0px;<br />
width:100%;<br />
display:none;<br />
}<br />
<br />
.win {<br />
width: 970px;<br />
margin: 50px auto;<br />
}<br />
.win a {<br />
line-height: 180px;<br />
display: block;<br />
margin: 8px;<br />
text-align: center;<br />
float: left;<br />
opacity: 1;<br />
}<br />
.win8 {<br />
margin: 8px;<br />
display: block;<br />
width : 300px;<br />
<br />
float: left;<br />
color: #015;<br />
font-family: Verdana, 'Times New Roman',serif;<br />
font-weight: 300;<br />
font-size: 13px;<br />
}<br />
h4{<br />
font-weight: 600;<br />
font-size: 17px;<br />
<br />
margin :8px;<br />
}<br />
.win8 img{<br />
width : 150px;<br />
}<br />
<br />
</style><br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/jquery?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
<br />
$(document).ready(function() {<br />
$('.win a').hover(function() {<br />
$(this).stop().animate({<br />
opacity: 0.5<br />
}, 300);<br />
}, function() {<br />
$(this).stop().animate({<br />
opacity: 1<br />
}, 300);<br />
});<br />
});<br />
<br />
</script><br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="wrap" style="font-family: Verdana, Geneva, sans-serif;background-color: #ff9;"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav><br />
<a href="https://2013.igem.org/Main_Page" id="logo1">igem</a> <br />
</header><br />
<br />
<br />
<div id="wowslider-container1"><br />
<div class="ws_images"><ul><br />
<li><img src="https://static.igem.org/mediawiki/2013/e/e5/Ggggg.png" alt="1" title="" id="wows1_0" class="lazy" />Genove</li><br />
<li><img src="https://static.igem.org/mediawiki/igem.org/c/c4/Slider2.jpg" alt="2" title="Nucleotide modification" id="wows1_1" class="lazy"/>Nucleotide modification allow users to modify sequence as their wishes by utilizing codon synonomousness.</li><br />
<li><img src="https://static.igem.org/mediawiki/igem.org/9/99/Slider3.jpg" alt="3" title="chromosome" id="wows1_2" class="lazy"/>We can help you creat a new chromosome.</li><br />
<li><img src="https://static.igem.org/mediawiki/2013/0/0a/Slider_4.jpg" alt="4" title="pathway" id="wows1_3" class="lazy"/>Genove can help you design a new pathway.</li><br />
<li><img src="https://static.igem.org/mediawiki/2013/1/1d/Slider_1.jpg" alt="5" title="team" id="wows1_4" class="lazy"/>All members of our team.</li><br />
</ul></div><br />
<div class="ws_bullets"><div><br />
<a href="#" title="1"><img src="https://static.igem.org/mediawiki/igem.org/1/17/Little2.jpg" alt="1"/>1</a><br />
<a href="#" title="2"><img src="https://static.igem.org/mediawiki/igem.org/1/17/Little2.jpg" alt="2"/>2</a><br />
<a href="#" title="3"><img src="https://static.igem.org/mediawiki/igem.org/2/2f/Little3.jpg" alt="3"/>3</a><br />
<a href="#" title="4"><img src="https://static.igem.org/mediawiki/2013/c/c0/Little4.jpg" alt="4"/>4</a><br />
<a href="#" title="5"><img src="https://static.igem.org/mediawiki/2013/b/b2/Little1.jpg" alt="5"/>5</a><br />
</div></div></div><br />
<br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/wowslider?action=raw&ctype=text/javascript"></script> <br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/script?action=raw&ctype=text/javascript"></script><br />
<br />
<br/><br/><br />
<div class="win"><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/2/21/Lxm_3.png" /></a><h4>Neochr</h4>Construct genome's structure</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/c/c8/NucleoMod.png" /></a><h4>NucleoMod</h4>Modify CDS region</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/b/b2/SegmMan.png" /></a><h4>SegmMan</h4>Split into fragments</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial"><img src="https://static.igem.org/mediawiki/2013/c/ce/X_2.png" /></a><h4>Jbrowse GUI</h4>Operation interface</div><br />
<div class="win8"><a href="http://192.185.29.142/~luxujia/jbrowse_no_git/index.html?data=data/NeoChr/"><img src="https://static.igem.org/mediawiki/2013/4/47/Lxm_2.png" /></a><h4>Web sever</h4>Web version of Genovo</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial"><img src="https://static.igem.org/mediawiki/2013/0/08/Zwz.png" /></a> <h4>Tutorial</h4>Instruction for users</div><br />
</div><br />
<br />
<br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br />
<!-- The JavaScript --><br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1/jquery.min.js"></script><br />
<script type="text/javascript"><br />
$(function() {<br />
$('#accordion > li').hover(<br />
function () {<br />
var $this = $(this);<br />
$this.stop().animate({'width':'480px'},500);<br />
$('.heading',$this).stop(true,true).fadeOut();<br />
$('.bgDescription',$this).stop(true,true).slideDown(500);<br />
$('.description',$this).stop(true,true).fadeIn();<br />
},<br />
function () {<br />
var $this = $(this);<br />
$this.stop().animate({'width':'115px'},1000);<br />
$('.heading',$this).stop(true,true).fadeIn();<br />
$('.description',$this).stop(true,true).fadeOut(500);<br />
$('.bgDescription',$this).stop(true,true).slideUp(700);<br />
}<br />
);<br />
});<br />
</script><br />
<br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<br />
<footer><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.cn">gongjianhui@genomics.cn</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="http://www.humaan.com.au/wp-content/themes/humaan/js/scripts.min.js" type="text/javascript"></script><br />
<br />
<br />
</body><br />
</html><br />
{{Scroll}}</div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Home
Team:Shenzhen BGIC 0101/Home
2013-10-25T08:38:11Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<!-- lazyload --><br />
<br />
<br />
<br />
<br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style_slider?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/jquery?action=raw&ctype=text/javascript"></script><br />
<br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<br />
<br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<style><br />
h3{<br />
font-family: 'Tangerine', serif;<br />
font-size: 45px;<br />
text-shadow: 4px 4px 4px #aaa;<br />
color: #38f;<br />
letter-spacing: 0.1em;<br />
word-spacing: 0.3em;<br />
font-weight: 700;<br />
line-height: 36px;<br />
margin: 0;<br />
}<br />
<br />
.reference{<br />
clear:both;<br />
top:40px;<br />
left:120px;<br />
<br />
font-size: 16px;<br />
line-height: 19px;<br />
font-family: Trebuchet MS;<br />
font-weight: 600;<br />
position:absolute;<br />
text-align:left;<br />
width:48%;<br />
padding:20px;<br />
background-color:#ffe;<br />
-moz-box-shadow:1px 3px 15px #ddd;<br />
-webkit-box-shadow:1px 3px 15px #ddd;<br />
box-shadow:4px 3px 25px #ddd;<br />
}<br />
<br />
ul.accordion{<br />
list-style:none; <br />
position:absolute;<br />
right:150px;<br />
top:0px;<br />
font-family: Cambria, serif;<br />
font-size: 16px;<br />
font-style: italic;<br />
line-height: 1.5em;<br />
}<br />
ul.accordion li{<br />
float:right;<br />
width:115px;<br />
height:480px;<br />
display:block;<br />
border-right:2px solid #fff;<br />
border-bottom:2px solid #fff;<br />
background-color:#fff;<br />
background-repeat:no-repeat;<br />
background-position:center center;<br />
position:relative;<br />
overflow:hidden;<br />
cursor:pointer;<br />
-moz-box-shadow:1px 3px 15px #555;<br />
-webkit-box-shadow:1px 3px 15px #555;<br />
box-shadow:1px 3px 15px #555;<br />
}<br />
ul.accordion li.bg1{<br />
background-image:url(https://static.igem.org/mediawiki/2013/c/c8/Bki-20101209112236-2125207650.jpg);<br />
}<br />
ul.accordion li.bg2{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bg3{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bg4{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bleft{<br />
border-left:2px solid #fff;<br />
}<br />
ul.accordion li .heading{<br />
background-color:#fff;<br />
padding:10px;<br />
margin-top:60px;<br />
opacity:0.9;<br />
text-transform:uppercase;<br />
font-style:normal;<br />
font-weight:bold;<br />
letter-spacing:1px;<br />
font-size:14px;<br />
color:#444;<br />
text-align:center;<br />
text-shadow:-1px -1px 1px #ccc;<br />
}<br />
ul.accordion li .description{<br />
position:absolute;<br />
width:480px;<br />
height:175px;<br />
bottom:0px;<br />
left:0px;<br />
display:none;<br />
}<br />
ul.accordion li .description h2{<br />
text-transform: uppercase;<br />
font-style: normal;<br />
font-weight: bold;<br />
letter-spacing: 1px;<br />
font-size: 25px;<br />
color: #444;<br />
text-align: left;<br />
margin: -15px 0px 0px 20px;<br />
text-shadow: -1px -1px 1px #ccc;<br />
}<br />
ul.accordion li .description p{<br />
line-height:14px;<br />
margin:10px 22px;<br />
font-family: "Trebuchet MS", sans-serif;<br />
font-size: 12px;<br />
font-style: italic;<br />
font-weight: normal;<br />
text-transform: none;<br />
letter-spacing: normal;<br />
line-height: 1.6em;<br />
}<br />
ul.accordion li .description a{<br />
position:absolute;<br />
bottom:5px;<br />
left:20px;<br />
text-transform:uppercase;<br />
font-style:normal;<br />
font-size:11px;<br />
text-decoration:none;<br />
color:#888;<br />
}<br />
ul.accordion li .description a:hover{<br />
color:#333;<br />
text-decoration:underline;<br />
}<br />
<br />
ul.accordion li .bgDescription{<br />
background:transparent url(https://static.igem.org/mediawiki/igem.org/1/15/BgDescription.png) repeat-x top left;<br />
height:340px;<br />
position:absolute;<br />
bottom:0px;<br />
left:0px;<br />
width:100%;<br />
display:none;<br />
}<br />
<br />
.win {<br />
width: 970px;<br />
margin: 50px auto;<br />
}<br />
.win a {<br />
line-height: 180px;<br />
display: block;<br />
margin: 8px;<br />
text-align: center;<br />
float: left;<br />
opacity: 1;<br />
}<br />
.win8 {<br />
margin: 8px;<br />
display: block;<br />
width : 300px;<br />
<br />
float: left;<br />
color: #015;<br />
font-family: Verdana, 'Times New Roman',serif;<br />
font-weight: 300;<br />
font-size: 13px;<br />
}<br />
h4{<br />
font-weight: 600;<br />
font-size: 17px;<br />
<br />
margin :8px;<br />
}<br />
.win8 img{<br />
width : 150px;<br />
}<br />
<br />
</style><br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/jquery?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
<br />
$(document).ready(function() {<br />
$('.win a').hover(function() {<br />
$(this).stop().animate({<br />
opacity: 0.5<br />
}, 300);<br />
}, function() {<br />
$(this).stop().animate({<br />
opacity: 1<br />
}, 300);<br />
});<br />
});<br />
<br />
</script><br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="wrap" style="font-family: Verdana, Geneva, sans-serif;background-color: #ff9;"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav><br />
<a href="https://2013.igem.org/Main_Page" id="logo1">igem</a> <br />
</header><br />
<br />
<br />
<div id="wowslider-container1"><br />
<div class="ws_images"><ul><br />
<li><img src="https://static.igem.org/mediawiki/2013/e/e5/Ggggg.png" alt="1" title="" id="wows1_0" class="lazy" />Genove</li><br />
<li><img src="https://static.igem.org/mediawiki/igem.org/c/c4/Slider2.jpg" alt="2" title="Nucleotide modification" id="wows1_1" class="lazy"/>Nucleotide modification allow users to modify sequence as their wishes by utilizing codon synonomousness.</li><br />
<li><img src="https://static.igem.org/mediawiki/igem.org/9/99/Slider3.jpg" alt="3" title="chromosome" id="wows1_2" class="lazy"/>We can help you creat a new chromosome.</li><br />
<li><img src="https://static.igem.org/mediawiki/2013/0/0a/Slider_4.jpg" alt="4" title="pathway" id="wows1_3" class="lazy"/>Genove can help you design a new pathway.</li><br />
<li><img src="https://static.igem.org/mediawiki/2013/1/1d/Slider_1.jpg" alt="5" title="team" id="wows1_4" class="lazy"/>All members of our team.</li><br />
</ul></div><br />
<div class="ws_bullets"><div><br />
<a href="#" title="1"><img src="https://static.igem.org/mediawiki/2013/e/e5/Ggggg.png" alt="1"/>1</a><br />
<a href="#" title="2"><img src="https://static.igem.org/mediawiki/igem.org/1/17/Little2.jpg" alt="2"/>2</a><br />
<a href="#" title="3"><img src="https://static.igem.org/mediawiki/igem.org/2/2f/Little3.jpg" alt="3"/>3</a><br />
<a href="#" title="4"><img src="https://static.igem.org/mediawiki/2013/c/c0/Little4.jpg" alt="4"/>4</a><br />
<a href="#" title="5"><img src="https://static.igem.org/mediawiki/2013/b/b2/Little1.jpg" alt="5"/>5</a><br />
</div></div></div><br />
<br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/wowslider?action=raw&ctype=text/javascript"></script> <br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/script?action=raw&ctype=text/javascript"></script><br />
<br />
<br/><br/><br />
<div class="win"><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/2/21/Lxm_3.png" /></a><h4>Neochr</h4>Construct genome's structure</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/c/c8/NucleoMod.png" /></a><h4>NucleoMod</h4>Modify CDS region</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/b/b2/SegmMan.png" /></a><h4>SegmMan</h4>Split into fragments</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial"><img src="https://static.igem.org/mediawiki/2013/c/ce/X_2.png" /></a><h4>Jbrowse GUI</h4>Operation interface</div><br />
<div class="win8"><a href="http://192.185.29.142/~luxujia/jbrowse_no_git/index.html?data=data/NeoChr/"><img src="https://static.igem.org/mediawiki/2013/4/47/Lxm_2.png" /></a><h4>Web sever</h4>Web version of Genovo</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial"><img src="https://static.igem.org/mediawiki/2013/0/08/Zwz.png" /></a> <h4>Tutorial</h4>Instruction for users</div><br />
</div><br />
<br />
<br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br />
<!-- The JavaScript --><br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1/jquery.min.js"></script><br />
<script type="text/javascript"><br />
$(function() {<br />
$('#accordion > li').hover(<br />
function () {<br />
var $this = $(this);<br />
$this.stop().animate({'width':'480px'},500);<br />
$('.heading',$this).stop(true,true).fadeOut();<br />
$('.bgDescription',$this).stop(true,true).slideDown(500);<br />
$('.description',$this).stop(true,true).fadeIn();<br />
},<br />
function () {<br />
var $this = $(this);<br />
$this.stop().animate({'width':'115px'},1000);<br />
$('.heading',$this).stop(true,true).fadeIn();<br />
$('.description',$this).stop(true,true).fadeOut(500);<br />
$('.bgDescription',$this).stop(true,true).slideUp(700);<br />
}<br />
);<br />
});<br />
</script><br />
<br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<br />
<footer><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.cn">gongjianhui@genomics.cn</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="http://www.humaan.com.au/wp-content/themes/humaan/js/scripts.min.js" type="text/javascript"></script><br />
<br />
<br />
</body><br />
</html><br />
{{Scroll}}</div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/front_style
Team:Shenzhen BGIC 0101/front style
2013-10-25T08:35:28Z
<p>Czh: </p>
<hr />
<div>body {<br />
background:#191919;<br />
font-family:'PT Sans Narrow', Arial, Helvetica, sans-serif;<br />
font-size:12px;<br />
color:#333;<br />
line-height:18px;<br />
}<br />
<br />
#portfolio {<br />
position:fixed;<br />
top:50%;<br />
left:50%;<br />
z-index:1;<br />
width:1000px;<br />
height:800px;<br />
margin:-400px 0 0 -500px;<br />
}<br />
<br />
#background {<br />
position:fixed;<br />
top:0;<br />
left:0;<br />
width:100%;<br />
height:100%;<br />
z-index:2;<br />
background:url(https://static.igem.org/mediawiki/2013/b/bb/Bg_1.png) no-repeat center;<br />
opacity: 0.5;<br />
}<br />
<br />
#portfolio .gallery,<br />
#portfolio .gallery .inside {<br />
position:absolute;<br />
top:10px;<br />
left:0;<br />
}<br />
<br />
#portfolio .gallery {<br />
width:100%;<br />
height:100%;<br />
overflow:hidden;<br />
}<br />
<br />
#portfolio .gallery .inside {<br />
z-index:1;<br />
}<br />
<br />
#portfolio .arrows a {<br />
position:absolute;<br />
z-index:3;<br />
width:32px;<br />
height:32px;<br />
background-image:url(https://static.igem.org/mediawiki/2013/8/82/Front_Arrows.png);<br />
background-repeat:no-repeat;<br />
outline:none;<br />
text-indent:-9999px;<br />
}<br />
<br />
#portfolio .arrows .prev,<br />
#portfolio .arrows .up {<br />
display:none;<br />
}<br />
<br />
#portfolio .arrows .up,<br />
#portfolio .arrows .down {<br />
left:50%;<br />
margin-left:-16px;<br />
}<br />
<br />
#portfolio .arrows .prev,<br />
#portfolio .arrows .next {<br />
top:300px;<br />
}<br />
<br />
#portfolio .arrows .up {<br />
background-position:0 -64px;<br />
top:20px;<br />
}<br />
<br />
#portfolio .arrows .down {<br />
background-position:0 -96px;<br />
bottom:120px;<br />
}<br />
<br />
#portfolio .arrows .prev {<br />
background-position:0 -32px;<br />
left:30px;<br />
}<br />
<br />
#portfolio .arrows .next {<br />
background-position:0 0;<br />
<br />
right:30px;<br />
}<br />
<br />
#portfolio .arrows .up:hover {<br />
background-position:-32px -64px;<br />
}<br />
<br />
#portfolio .arrows .down:hover {<br />
background-position:-32px -96px;<br />
}<br />
<br />
#portfolio .arrows .next:hover {<br />
background-position:-32px 0;<br />
}<br />
<br />
#portfolio .arrows .prev:hover {<br />
background-position:-32px -32px;<br />
}<br />
<br />
<br />
#portfolio .item {<br />
position:absolute;<br />
top:0;<br />
width:1200px;<br />
height:800px;<br />
}<br />
<br />
#portfolio .item div {<br />
position:absolute;<br />
left:0;<br />
width:100%;<br />
height:100%;<br />
}<br />
<br />
#portfolio .item div img {<br />
position:absolute;<br />
top:0;<br />
left:50%;<br />
margin-left:-500px;<br />
<br />
}<br />
<br />
#portfolio .paths {<br />
position:absolute;<br />
bottom:100px;<br />
left:50%;<br />
margin-left:-30px;<br />
z-index:4;<br />
}<br />
<br />
#portfolio .paths div {<br />
position:absolute;<br />
top:0;<br />
}<br />
<br />
#portfolio .paths a {<br />
background:#333;<br />
display:block;<br />
position:absolute;<br />
left:0;<br />
outline:none;<br />
}<br />
<br />
#portfolio .paths a:hover,<br />
#portfolio .paths .active {<br />
background:#fff;<br />
}<br />
<br />
<br />
/* heading */<br />
h1{<br />
font-size:35px;<br />
text-shadow:1px 1px 2px #38f;<br />
position:relative;<br />
z-index:1000;<br />
color:#3f8;<br />
font-weight:normal;<br />
padding:10px;<br />
margin-top:10px;<br />
background:#000;<br />
float:left;<br />
}</div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/style
Team:Shenzhen BGIC 0101/style
2013-10-20T10:01:14Z
<p>Czh: </p>
<hr />
<div>@font-face {<br />
font-family: 'Tangerine';<br />
font-style: normal;<br />
font-weight: 400;<br />
src: local('Tangerine'), url(http://themes.googleusercontent.com/static/fonts/tangerine/v3/HGfsyCL5WASpHOFnouG-RD8E0i7KZn-EPnyo3HZu7kw.woff) format('woff');<br />
}<br />
<br />
html, body, div, span, applet, object, iframe, h1, h2, h3, h4, h5, h6, p, blockquote, pre, a, abbr, acronym, address, big, cite, code, del, dfn, em, img, ins, kbd, q, s, samp, small, strike, strong, sub, sup, tt, var, b, u, i, center, dl, dt, dd, ol, ul, li, fieldset, form, label, legend, table, caption, tbody, tfoot, thead, tr, th, td, article, aside, canvas, details, embed, figure, figcaption, footer, header, hgroup, menu, nav, output, ruby, section, summary, time, mark, audio, video {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-size: 100%;<br />
font: inherit;<br />
vertical-align: baseline;<br />
letter-spacing: 0.05em;<br />
}<br />
article, aside, details, figcaption, figure, footer, header, hgroup, menu, nav, section {<br />
display: block;<br />
}<br />
body {<br />
line-height: 1;<br />
}<br />
ol, ul {<br />
list-style: none;<br />
}<br />
<br />
p, ul, ol {<br />
margin: 0 0 0px; <br />
<br />
}<br />
ul, ol {<br />
padding: 1.5em 0 0 2.5em;<br />
}<br />
<br />
<br />
body {<br />
/* background: #f2f2f2;*/<br />
background: #262626;<br />
font-family: "proxima-nova", "HelveticaNeue", "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
font-size: 14px;<br />
line-height: 21px;<br />
color: #262626;<br />
-webkit-font-smoothing: antialiased;<br />
-webkit-text-size-adjust: 100%}<br />
html, body {<br />
height: 100%}<br />
#wrap {<br />
background: #ff9;<br />
background-size:cover;<br />
margin-bottom: 0px;<br />
min-height: 100%;<br />
height: auto!important;<br />
height: 100%}<br />
.push {<br />
height: 45px;<br />
}<br />
p img {<br />
margin: 0;<br />
}<br />
em {<br />
font-style: italic;<br />
}<br />
strong {<br />
font-weight: bold;<br />
}<br />
hr {<br />
border: solid #ddd;<br />
border-width: 1px 0 0;<br />
clear: both;<br />
margin: 10px 0 30px;<br />
height: 0;<br />
}<br />
a, a:visited {<br />
color: #666;<br />
text-decoration: none;<br />
outline: 0;<br />
}<br />
a:hover, a:focus {<br />
color: #333;<br />
}<br />
p a, p a:visited {<br />
line-height: inherit;<br />
}<br />
img.scale-with-grid {<br />
max-width: 100%;<br />
height: auto;<br />
}<br />
<br />
header {<br />
width: 100%;<br />
height: 90px;<br />
background: #222;<br />
background: rgba(0, 0, 0, .2);<br />
border-color: #fff;<br />
border-bottom: 1px solid rgba(255, 255, 255, .25);<br />
position: fixed;<br />
top: 0;<br />
z-index: 10;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
-ms-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
}<br />
header.sticky {<br />
height: 60px;<br />
background: #993399;<br />
border: 0;<br />
box-shadow: 0 1px 6px rgba(0, 0, 0, .2);<br />
}<br />
header h1 {<br />
margin: 0;<br />
}<br />
#logo {<br />
width: 84px;<br />
height: 59px;<br />
display: block;<br />
background: url(https://static.igem.org/mediawiki/igem.org/e/e8/Genovo-logo.png) no-repeat;<br />
text-indent: -99999em;<br />
position: absolute;<br />
top: 15px;<br />
left: 15px;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
}<br />
#logo1{<br />
width: 80px;<br />
height: 60px;<br />
display: block;<br />
background: url(https://static.igem.org/mediawiki/2013/d/dd/Igem_logo12.png) no-repeat;<br />
text-indent: -99999em;<br />
position: absolute;<br />
top: 15px;<br />
right: 10px;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
z-index:9999;<br />
}<br />
nav {<br />
text-align: center;<br />
margin-top: 35px;<br />
-webkit-transition: margin .2s ease-in-out;<br />
-moz-transition: margin .2s ease-in-out;<br />
transition: margin .2s ease-in-out;<br />
}<br />
.sticky nav {<br />
margin-top: 20px;<br />
}<br />
nav a, #start-project {<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
color: #555;<br />
text-shadow: 0 1px 0 #fff;<br />
padding: 16px;<br />
font-size: 14px;<br />
}<br />
.light nav a {<br />
color: #ddd;/* top-nav color */<br />
text-shadow: 0 1px 0 rgba(0, 0, 0, .5);<br />
opacity: .5;<br />
-webkit-transition: opacity .1s linear;<br />
-moz-transition: opacity .1s linear;<br />
transition: opacity .1s linear;<br />
}<br />
nav a.current-menu-item, nav a.current_page_parent, nav a:hover, .single-work .light nav a.menu-item-18, .single-lab .light nav a.menu-item-17, .single-post .light nav a.menu-item-16 {<br />
opacity: 1;<br />
}<br />
.single-work nav a.current_page_parent, .single-lab nav a.current_page_parent {<br />
opacity: .5;<br />
}<br />
#blog {<br />
z-index: 6;<br />
}<br />
#blog article {<br />
margin: 10px auto 60px;<br />
max-width: 700px;<br />
position: relative;<br />
}<br />
<br />
<br />
#home-content h2, #fresh h2, h2.section-title {<br />
color: #358;<br />
font-size: 12px;<br />
text-shadow: 0 1px 0 #fff;<br />
font-weight: 600;<br />
width: 150px;<br />
background: #CCFF66;<br />
margin: -20px auto 20px;<br />
text-align: center;<br />
}<br />
#home-content .column, #fresh {<br />
border-top: 1px solid #d0d0d0;<br />
}<br />
#home-content .one-third {<br />
float: right!important;<br />
}<br />
.mini-post {<br />
float: left;<br />
background: #fff;<br />
box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
border-radius: 2px;<br />
overflow: hidden;<br />
width: 290px;<br />
-webkit-transition: all .2s ease-out;<br />
-moz-transition: all .2s ease-out;<br />
transition: all .2s ease-out;<br />
color: #333;<br />
min-height: 320px;<br />
cursor: pointer;<br />
}<br />
.mini-post:hover {<br />
margin-top: -5px;<br />
box-shadow: 0 3px 3px 0 rgba(0, 0, 0, .4);<br />
}<br />
.mini-post .text {<br />
padding: 20px 20px 10px;<br />
}<br />
.mini-post h3 {<br />
font-size: 16px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
margin: 0;<br />
}<br />
.mini-post .meta {<br />
font-size: 11px;<br />
}<br />
.mini-post p {<br />
font-size: 13px;<br />
}<br />
.mini-post .more {<br />
font-weight: 600;<br />
}<br />
#tweet {<br />
margin: 40px auto;<br />
padding-top: 40px;<br />
border-top: 1px solid #d0d0d0;<br />
}<br />
#tweet .text {<br />
padding: 0 90px;<br />
background: url(art/bird.svg) no-repeat 35px 0;<br />
font-size: 26px;<br />
font-weight: 300;<br />
}<br />
#tweet .text p {<br />
margin: 0 0 10px;<br />
text-align: center;<br />
line-height: 36px;<br />
}<br />
#tweet .text p.author {<br />
font-size: 20px;<br />
}<br />
#page-header {<br />
width: auto;<br />
// height: 220px;<br />
//background: url(https://static.igem.org/mediawiki/2013/3/34/Test-head.jpg) top center;<br />
margin: 0 0 35px;<br />
box-shadow: 2px 1px 12px #272727;<br />
<br />
}<br />
.wf-loading #page-header h1 {<br />
visibility: hidden;<br />
}<br />
<br />
.blog #page-header {<br />
// background: url(https://static.igem.org/mediawiki/2013/3/34/Test-head.jpg) top center;<br />
}<br />
#page-header h1 {<br />
font-family: "abril-fatface", 'Adobe Garamond', 'Garamond', serif;<br />
color: #fff;<br />
text-align: center;<br />
padding: 130px 0 0 0;<br />
text-shadow: 0 2px 0 #000;<br />
font-size: 60px;<br />
}<br />
#blog {<br />
z-index: 6;<br />
}<br />
#blog article {<br />
margin: 10px auto 60px;<br />
max-width: 1200px;<br />
position: relative;<br />
}<br />
#blog article .post {<br />
background: #cf9;<br />
// box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
box-shadow: 2px 1px 6px #272727;<br />
border-radius: 2px;<br />
overflow: hidden;<br />
color: #333;<br />
margin: 0 0 15px;<br />
}<br />
#blog article .post .text {<br />
padding: 20px 20px 10px;<br />
}<br />
.post-content a {<br />
color: #2683a5;<br />
}<br />
.post-content a:hover {<br />
color: #4ea9a2; <br />
}<br />
#blog article .post h2 {<br />
font-family: 'Tangerine', serif;<br />
font-size: 48px;<br />
text-shadow: 4px 4px 4px #aaa;<br />
color: #38f;<br />
letter-spacing: 0.1em;<br />
word-spacing: 0.3em;<br />
font-weight: 700;<br />
line-height: 36px;<br />
margin: 0;<br />
}<br />
#blog article .post h3 {<br />
font-size: 14px;<br />
line-height: 18px;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
}<br />
#blog article .post .meta {<br />
font-size: 11px;<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
}<br />
#blog article .post p {<br />
font-size: 16px;<br />
line-height: 19px;<br />
font-family: Trebuchet MS;<br />
font-weight: 600;<br />
color: #000;<br />
}<br />
.short-url, .share, .categories {<br />
background: #eaeaea left center no-repeat;<br />
border-radius: 2px;<br />
border-bottom: 1px solid #fff;<br />
border-top: 1px solid #d0d0d0;<br />
float: left;<br />
margin: 0 20px 0 0;<br />
padding: 4px 15px 4px 35px;<br />
font-size: 11px;<br />
color: #666;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
text-shadow: 0 1px 0 #fff;<br />
-webkit-transition: all .2s ease-out;<br />
-moz-transition: all .2s ease-out;<br />
transition: all .2s ease-out;<br />
}<br />
.addthis_toolbox {<br />
display: none;<br />
padding: 0 20px 20px;<br />
}<br />
.short-url:hover, .share:hover {<br />
background-color: #ddd;<br />
border-top: 1px solid #aaa;<br />
}<br />
<br />
#blog article.quote {<br />
max-width: 940px;<br />
}<br />
#blog article.quote .quote-content {<br />
background: #676767;<br />
padding: 30px;<br />
border-radius: 3px;<br />
border-top: #111 1px solid;<br />
border-bottom: #fff 1px solid;<br />
margin: 0 0 15px;<br />
}<br />
#blog article.quote .quote-content p {<br />
font-size: 26px;<br />
line-height: 32px;<br />
color: #eee;<br />
font-weight: 300;<br />
}<br />
#blog article.quote p.ref {<br />
color: #fff;<br />
padding: 0;<br />
margin: 0;<br />
}<br />
#blog article.quote .quote-content a {<br />
color: #fff;<br />
text-decoration: underline;<br />
}<br />
#blog-pagination {<br />
display: block;<br />
text-align: center;<br />
margin: 35px 0;<br />
}<br />
.wp-paginate {<br />
display: inline-block;<br />
padding: 0;<br />
box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
border-radius: 3px;<br />
}<br />
.wp-paginate li {<br />
padding: 0!important;<br />
display: inline-block;<br />
background-image: none!important;<br />
background-color: #fff;<br />
margin: 0;<br />
float: left;<br />
}<br />
.wp-paginate a, .wp-paginate .page.current {<br />
color: #333;<br />
padding: 10px 13px;<br />
display: inline-block;<br />
margin-bottom: 0!important;<br />
min-width: 10px;<br />
border-right: 1px solid #eee;<br />
font-size: 12px;<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
-webkit-transition: all .1s ease-in-out;<br />
-moz-transition: all .1s ease-in-out;<br />
transition: all .1s ease-in-out;<br />
}<br />
.wp-paginate span {<br />
margin-bottom: 0!important;<br />
}<br />
.wp-paginate a.next {<br />
border-left: 0;<br />
}<br />
.wp-paginate .page {<br />
margin: 0;<br />
}<br />
.wp-paginate .page.current {<br />
background-color: #fafafa;<br />
color: #888;<br />
}<br />
.wp-paginate a:hover {<br />
background: #555;<br />
color: #fff;<br />
border-right: 1px solid #555;<br />
}<br />
#disqus_thread {<br />
margin: 10px auto 35px!important;<br />
max-width: 660px;<br />
position: relative;<br />
background: #eaeaea;<br />
border-radius: 2px;<br />
border-bottom: 1px solid #fff;<br />
border-top: 1px solid #d0d0d0;<br />
color: #1a1a1a;<br />
padding: 20px;<br />
font-size: 12px;<br />
}<br />
#disqus_thread h3 {<br />
font-size: 14px;<br />
text-transform: uppercase;<br />
text-shadow: 0 1px 0 #fff;<br />
font-weight: 600;<br />
}<br />
#contact {<br />
position: relative;<br />
height: 940px;<br />
}<br />
#location-map {<br />
width: 100%;<br />
height: 940px;<br />
display: block;<br />
position: absolute;<br />
top: 0;<br />
}<br />
#contact .container {<br />
padding-top: 60px;<br />
}<br />
#contact #contact-details, #contact #message {<br />
background: #262626;<br />
float: none;<br />
display: block;<br />
margin: 0 0 35px;<br />
box-shadow: 0 0 25px 0 rgba(0, 0, 0, .25);<br />
}<br />
#phone-address, #work-planner {<br />
padding: 30px 40px;<br />
}<br />
#phone-address {<br />
border-bottom: 1px solid #565656;<br />
}<br />
#phone-address p, #work-planner h2, #message h2 {<br />
text-transform: uppercase;<br />
color: #fff;<br />
font-weight: 600;<br />
font-size: 14px;<br />
}<br />
#phone-address p {<br />
padding-left: 35px;<br />
}<br />
#phone-address p#phone {<br />
background: url(art/phone.png) no-repeat 2px 2px;<br />
}<br />
#phone-address p#address {<br />
background: url(art/map.png) no-repeat 2px 2px;<br />
margin: 0;<br />
}<br />
#work-planner h2, #message h2 {<br />
margin: 0 0 10px;<br />
line-height: normal;<br />
}<br />
#work-planner p {<br />
color: #9c9c9c;<br />
font-size: 13px;<br />
font-weight: 600;<br />
}<br />
#work-planner a {<br />
padding: 12px 40px 12px 12px;<br />
color: #fff;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
font-size: 12px;<br />
background: #ce462b url(art/get-started-arrow.png) no-repeat right center;<br />
margin: 0 0 10px;<br />
display: block;<br />
width: 128px;<br />
-webkit-transition: background-color .2s ease-in-out;<br />
-moz-transition: background-color .2s ease-in-out;<br />
transition: background-color .2s ease-in-out;<br />
}<br />
#work-planner a:hover {<br />
background-color: #4ea9a2;<br />
}<br />
#contact #message .wrapper {<br />
padding: 30px 40px;<br />
}<br />
#contact #message .field {<br />
display: block;<br />
position: relative;<br />
margin: 0 0 15px;<br />
}<br />
#contact #message label {<br />
position: absolute;<br />
top: 9px;<br />
left: 11px;<br />
color: #aaa;<br />
font-size: 13px;<br />
font-weight: 500;<br />
}<br />
#contact #message input, #contact #message textarea {<br />
width: 300px;<br />
max-width: 300px;<br />
background: #000;<br />
border: 0;<br />
border-bottom: 1px solid #373737;<br />
width: 100%;<br />
color: #ddd;<br />
font-size: 13px;<br />
font-weight: 500;<br />
padding: 8px 10px;<br />
}<br />
#contact #message textarea {<br />
height: 80px;<br />
}<br />
#contact #message input:focus, #contact #message textarea:focus {<br />
background: #111;<br />
outline: 0;<br />
}<br />
#contact #message button {<br />
padding: 14px 40px 14px 12px;<br />
color: #fff;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
text-align: left;<br />
font-size: 12px;<br />
background: #343434 url(art/message-arrow.png) no-repeat right center;<br />
display: block;<br />
margin: 0;<br />
width: 180px;<br />
-webkit-transition: background-color .2s ease-in-out;<br />
-moz-transition: background-color .2s ease-in-out;<br />
transition: background-color .2s ease-in-out;<br />
font-family: "proxima-nova", "HelveticaNeue", "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
}<br />
#contact #message button:hover {<br />
background-color: #666;<br />
}<br />
.contact footer {<br />
margin: 0;<br />
}<br />
footer {<br />
padding: 35px 0 20px;<br />
background: #003399;<br />
height: 130px;<br />
box-shadow: 4px 3px 25px #000;<br />
}<br />
footer h3 {<br />
font-size: 13px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
color: #fff;<br />
text-transform: uppercase;<br />
margin: 0 0 20px;<br />
}<br />
footer p {<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
}<br />
footer p a, footer p a:visited, footer p span {<br />
color: #dedede;<br />
}<br />
footer p a:hover {<br />
color: #fff;<br />
}<br />
#footer-contact p {<br />
margin-right: 40px;<br />
float: left;<br />
}<br />
#footer-project p {<br />
max-width: 180px;<br />
}<br />
#footer-newsletter {<br />
position: relative;<br />
}<br />
#footer-newsletter p {<br />
position: absolute;<br />
font-size: 11px;<br />
top: 0;<br />
right: 0;<br />
color: #7c7c7c;<br />
}<br />
#footer-newsletter input {<br />
width: 220px;<br />
height: 19px;<br />
background: #202020;<br />
border: 0;<br />
margin: 0;<br />
padding: 10px;<br />
color: #fff;<br />
font-size: 12px;<br />
-webkit-transition: background .3s ease-in-out;<br />
-moz-transition: background .3s ease-in-out;<br />
transition: background .3s ease-in-out;<br />
float: left;<br />
border-radius: 0;<br />
}<br />
#footer-newsletter input:focus {<br />
outline: 0;<br />
background: #333;<br />
}<br />
#footer-newsletter label {<br />
position: absolute;<br />
top: 49px;<br />
left: 10px;<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
}<br />
#footer-newsletter button {<br />
width: 39px;<br />
height: 39px;<br />
text-indent: -99999em;<br />
background: #202020 url(art/btn-arrow.svg) no-repeat center center;<br />
float: right;<br />
-webkit-transition: background .3s ease-in-out;<br />
-moz-transition: background .3s ease-in-out;<br />
transition: background .3s ease-in-out;<br />
}<br />
#footer-newsletter button:hover {<br />
background-color: #333;<br />
}<br />
#footer-final {<br />
margin: 15px auto;<br />
padding-top: 35px;<br />
border-top: 1px solid #313131;<br />
position: relative;<br />
}<br />
#footer-final a, #footer-final a:visited {<br />
color: #aaa;<br />
}<br />
#footer-final a:hover {<br />
color: #fff;<br />
}<br />
#footer-final p {<br />
font-weight: 600;<br />
font-size: 12px;<br />
display: block;<br />
margin: 0;<br />
}<br />
#footer-nav {<br />
text-align: center;<br />
}<br />
#footer-nav a {<br />
margin: 0 8px;<br />
}<br />
#footer-final p#footer-social {<br />
text-align: right;<br />
margin-left: 40px;<br />
}<br />
#footer-social a, #footer-social a:visited {<br />
margin: 0 0 0 16px;<br />
}<br />
.left {<br />
float: left;<br />
}<br />
.right {<br />
float: right;<br />
}<br />
span.error {<br />
color: red;<br />
font-size: 12px;<br />
}<br />
p.success {<br />
background: #009b00;<br />
padding: 5px;<br />
color: #fff;<br />
text-align: center;<br />
font-weight: 600;<br />
border-radius: 3px;<br />
}<br />
p.fail {<br />
background: red;<br />
padding: 5px;<br />
color: #fff;<br />
text-align: center;<br />
font-weight: 600;<br />
border-radius: 3px;<br />
}<br />
.success {<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
}<br />
.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.aligncenter, div.aligncenter {<br />
display: block;<br />
margin: 5px auto 5px auto;<br />
}<br />
.alignright {<br />
float: right;<br />
margin: 5px 0 20px 20px;<br />
}<br />
.alignleft {<br />
float: left;<br />
margin: 5px 20px 20px 0;<br />
}<br />
.aligncenter {<br />
display: block;<br />
margin: 5px auto 5px auto;<br />
}<br />
a img.alignright {<br />
float: right;<br />
margin: 5px 0 20px 20px;<br />
}<br />
a img.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
a img.alignleft {<br />
float: left;<br />
margin: 5px 20px 20px 0;<br />
}<br />
a img.aligncenter {<br />
display: block;<br />
margin-left: auto;<br />
margin-right: auto;<br />
}<br />
.wp-caption {<br />
background: #fff;<br />
border: 1px solid #f0f0f0;<br />
max-width: 96%;<br />
padding: 5px 3px 10px;<br />
text-align: center;<br />
}<br />
.wp-caption.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.wp-caption.alignleft {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.wp-caption.alignright {<br />
margin: 5px 0 20px 20px;<br />
}<br />
.wp-caption img {<br />
border: 0 none;<br />
height: auto;<br />
margin: 0;<br />
max-width: 98.5%;<br />
padding: 0;<br />
width: auto;<br />
}<br />
.wp-caption p.wp-caption-text {<br />
font-size: 11px;<br />
line-height: 17px;<br />
margin: 0;<br />
padding: 0 4px 5px;<br />
}<br />
.cols_2_left, .cols_2_right, .cols_3_left, .cols_3_middle, .cols_3_right {<br />
margin: 0 0 1.5em;<br />
}<br />
.cols_2_left {<br />
float: left;<br />
width: 47%}<br />
.cols_2_right {<br />
float: right;<br />
width: 47%}<br />
.cols_3_left {<br />
float: left;<br />
width: 30%}<br />
.cols_3_middle {<br />
float: left;<br />
width: 30%;<br />
margin-left: 5%}<br />
.cols_3_right {<br />
float: right;<br />
width: 30%}<br />
.container {<br />
position: relative;<br />
width: 1000px;<br />
margin: 0 auto;<br />
padding: 0;<br />
}<br />
.container.short {<br />
width: 940px;<br />
}<br />
.container .column, .container .columns {<br />
float: left;<br />
display: inline;<br />
margin-left: 10px;<br />
margin-right: 10px;<br />
}<br />
.row {<br />
margin-bottom: 20px;<br />
}<br />
.column.alpha, .columns.alpha {<br />
margin-left: 0;<br />
}<br />
.column.omega, .columns.omega {<br />
margin-right: 0;<br />
}<br />
.container .one.column, .container .one.columns {<br />
width: 40px;<br />
}<br />
.container .two.columns {<br />
width: 100px;<br />
}<br />
.container .three.columns {<br />
width: 160px;<br />
}<br />
.container .four.columns {<br />
width: 220px;<br />
}<br />
.container .five.columns {<br />
width: 180px;<br />
}<br />
.container .six.columns {<br />
width: 340px;<br />
}<br />
.container .seven.columns {<br />
width: 400px;<br />
}<br />
.container .eight.columns {<br />
width: 460px;<br />
}<br />
.container .nine.columns {<br />
width: 520px;<br />
}<br />
.container .ten.columns {<br />
width: 580px;<br />
}<br />
.container .eleven.columns {<br />
width: 640px;<br />
}<br />
.container .twelve.columns {<br />
width: 700px;<br />
}<br />
.container .thirteen.columns {<br />
width: 760px;<br />
}<br />
.container .fourteen.columns {<br />
width: 820px;<br />
}<br />
.container .fifteen.columns {<br />
width: 880px;<br />
}<br />
.container .sixteen.columns {<br />
width: 940px;<br />
}<br />
.container .one-third.column {<br />
width: 290px;<br />
}<br />
.container .two-thirds.column {<br />
width: 615px;<br />
}<br />
.container .offset-by-one {<br />
padding-left: 60px;<br />
}<br />
.container .offset-by-two {<br />
padding-left: 120px;<br />
}<br />
.container .offset-by-three {<br />
padding-left: 180px;<br />
}<br />
.container .offset-by-four {<br />
padding-left: 240px;<br />
}<br />
.container .offset-by-five {<br />
padding-left: 300px;<br />
}<br />
.container .offset-by-six {<br />
padding-left: 360px;<br />
}<br />
.container .offset-by-seven {<br />
padding-left: 420px;<br />
}<br />
.container .offset-by-eight {<br />
padding-left: 480px;<br />
}<br />
.container .offset-by-nine {<br />
padding-left: 540px;<br />
}<br />
.container .offset-by-ten {<br />
padding-left: 600px;<br />
}<br />
.container .offset-by-eleven {<br />
padding-left: 660px;<br />
}<br />
.container .offset-by-twelve {<br />
padding-left: 720px;<br />
}<br />
.container .offset-by-thirteen {<br />
padding-left: 780px;<br />
}<br />
.container .offset-by-fourteen {<br />
padding-left: 840px;<br />
}<br />
.container .offset-by-fifteen {<br />
padding-left: 900px;<br />
}<br />
@media only screen and (max-width:1049px) {<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images.two img {<br />
width: 450px;<br />
}<br />
}@media only screen and (min-width:960px) {<br />
#logo {<br />
-webkit-transform-style: preserve-3d;<br />
}<br />
#logo1 {<br />
-webkit-transform-style: preserve-3d;<br />
}<br />
.sticky #logo {<br />
-webkit-transform: scale(.75);<br />
-moz-transform: scale(.75);<br />
-ms-transform: scale(.75);<br />
-o-transform: scale(.75);<br />
transform: scale(.75);<br />
top: 0;<br />
left: -10px;<br />
}<br />
.sticky #logo1 {<br />
-webkit-transform: scale(.75);<br />
-moz-transform: scale(.75);<br />
-ms-transform: scale(.75);<br />
-o-transform: scale(.75);<br />
transform: scale(.75);<br />
top: 0;<br />
right: -1px;<br />
}<br />
<br />
}@media only screen and (min-device-width :768px) and (max-device-width:1024px) and (orientation:landscape) {<br />
#logo {<br />
-webkit-transform-style: flat;<br />
}<br />
#logo1 {<br />
-webkit-transform-style: flat;<br />
}<br />
.sticky #logo {<br />
-webkit-transform: none;<br />
-moz-transform: none;<br />
-ms-transform: none;<br />
-o-transform: none;<br />
transform: none;<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
-webkit-transform: none;<br />
-moz-transform: none;<br />
-ms-transform: none;<br />
-o-transform: none;<br />
transform: none;<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
}@media only screen and (min-width:768px) and (max-width:959px) {<br />
.container {<br />
width: 768px;<br />
}<br />
.container.short {<br />
width: 748px;<br />
}<br />
.container .column, .container .columns {<br />
margin-left: 10px;<br />
margin-right: 10px;<br />
}<br />
.column.alpha, .columns.alpha {<br />
margin-left: 0;<br />
margin-right: 10px;<br />
}<br />
.column.omega, .columns.omega {<br />
margin-right: 0;<br />
margin-left: 10px;<br />
}<br />
.alpha.omega {<br />
margin-left: 0;<br />
margin-right: 0;<br />
}<br />
.container .one.column, .container .one.columns {<br />
width: 28px;<br />
}<br />
.container .two.columns {<br />
width: 76px;<br />
}<br />
.container .three.columns {<br />
width: 124px;<br />
}<br />
.container .four.columns {<br />
width: 172px;<br />
}<br />
.container .five.columns {<br />
width: 220px;<br />
}<br />
.container .six.columns {<br />
width: 268px;<br />
}<br />
.container .seven.columns {<br />
width: 316px;<br />
}<br />
.container .eight.columns {<br />
width: 364px;<br />
}<br />
.container .nine.columns {<br />
width: 412px;<br />
}<br />
.container .ten.columns {<br />
width: 460px;<br />
}<br />
.container .eleven.columns {<br />
width: 508px;<br />
}<br />
.container .twelve.columns {<br />
width: 556px;<br />
}<br />
.container .thirteen.columns {<br />
width: 604px;<br />
}<br />
.container .fourteen.columns {<br />
width: 652px;<br />
}<br />
.container .fifteen.columns {<br />
width: 700px;<br />
}<br />
.container .sixteen.columns {<br />
width: 748px;<br />
}<br />
.container .one-third.column {<br />
width: 236px;<br />
}<br />
.container .two-thirds.column {<br />
width: 492px;<br />
}<br />
.container .offset-by-one {<br />
padding-left: 48px;<br />
}<br />
.container .offset-by-two {<br />
padding-left: 96px;<br />
}<br />
.container .offset-by-three {<br />
padding-left: 144px;<br />
}<br />
.container .offset-by-four {<br />
padding-left: 192px;<br />
}<br />
.container .offset-by-five {<br />
padding-left: 240px;<br />
}<br />
.container .offset-by-six {<br />
padding-left: 288px;<br />
}<br />
.container .offset-by-seven {<br />
padding-left: 336px;<br />
}<br />
.container .offset-by-eight {<br />
padding-left: 384px;<br />
}<br />
.container .offset-by-nine {<br />
padding-left: 432px;<br />
}<br />
.container .offset-by-ten {<br />
padding-left: 480px;<br />
}<br />
.container .offset-by-eleven {<br />
padding-left: 528px;<br />
}<br />
.container .offset-by-twelve {<br />
padding-left: 576px;<br />
}<br />
.container .offset-by-thirteen {<br />
padding-left: 624px;<br />
}<br />
.container .offset-by-fourteen {<br />
padding-left: 672px;<br />
}<br />
.container .offset-by-fifteen {<br />
padding-left: 720px;<br />
}<br />
.sticky #logo {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
nav a {<br />
padding-left: 10px;<br />
padding-right: 10px;<br />
}<br />
#footer-contact {<br />
width: 220px;<br />
}<br />
#footer-newsletter {<br />
float: right;<br />
width: 280px;<br />
}<br />
.mini-post {<br />
width: 236px;<br />
}<br />
.mini-post img {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images img {<br />
width: 100%}<br />
#case-details .images.two img {<br />
width: 350px;<br />
}<br />
#case-details, #meta .container, .single #page-header .container {<br />
padding: 0 10px;<br />
width: 748px;<br />
}<br />
.about .column-text {<br />
padding: 0 15px;<br />
}<br />
#feature h1 {<br />
font-size: 55px;<br />
}<br />
#page-header.case h1 {<br />
font-size: 40px;<br />
line-height: 34px;<br />
}<br />
#page-header.case h2 {<br />
max-width: 40%;<br />
line-height: 24px;<br />
}<br />
#blog-top #categories {<br />
width: 220px;<br />
}<br />
#blog-top form {<br />
width: 340px;<br />
}<br />
#blog-top #rss {<br />
width: 100px;<br />
}<br />
.container .seven.columns {<br />
width: 400px;<br />
}<br />
.single-work #page-header h2, .single-lab #page-header h2 {<br />
font-weight: 500;<br />
font-size: 16px;<br />
line-height: 22px;<br />
}<br />
<br />
footer {<br />
height: auto;<br />
}<br />
#wrap {<br />
margin-bottom: 0;<br />
min-height: 0;<br />
}<br />
.push {<br />
display: none;<br />
}<br />
#copyright, #footer-social {<br />
width: 150px;<br />
margin: 0!important;<br />
}<br />
#location-map {<br />
display: none;<br />
}<br />
#contact {<br />
height: auto;<br />
}<br />
#contact .container {<br />
padding-top: 10px;<br />
}<br />
#contact #contact-details {<br />
float: left;<br />
width: 340px;<br />
}<br />
#contact #message {<br />
float: right;<br />
width: 400px;<br />
}<br />
#footer-nav {<br />
width: 448px;<br />
}<br />
#processes {<br />
margin: 0 30px;<br />
}<br />
.process .text {<br />
padding: 0 15px;<br />
}<br />
.process p {<br />
font-size: 13px;<br />
line-height: 18px;<br />
}<br />
}@media only screen and (max-width:767px) {<br />
.container, .container.short {<br />
width: 300px;<br />
}<br />
.container .columns, .container .column {<br />
margin: 0;<br />
}<br />
.container .one.column, .container .one.columns, .container .two.columns, .container .three.columns, .container .four.columns, .container .five.columns, .container .six.columns, .container .seven.columns, .container .eight.columns, .container .nine.columns, .container .ten.columns, .container .eleven.columns, .container .twelve.columns, .container .thirteen.columns, .container .fourteen.columns, .container .fifteen.columns, .container .sixteen.columns, .container .one-third.column, .container .two-thirds.column {<br />
width: 300px;<br />
}<br />
.container .offset-by-one, .container .offset-by-two, .container .offset-by-three, .container .offset-by-four, .container .offset-by-five, .container .offset-by-six, .container .offset-by-seven, .container .offset-by-eight, .container .offset-by-nine, .container .offset-by-ten, .container .offset-by-eleven, .container .offset-by-twelve, .container .offset-by-thirteen, .container .offset-by-fourteen, .container .offset-by-fifteen {<br />
padding-left: 0;<br />
}<br />
.sticky #logo {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
#feature {<br />
height: 250px;<br />
}<br />
#feature article, #feature ul {<br />
display: none!important;<br />
}<br />
#feature h1 {<br />
top: 100px;<br />
font-size: 36px;<br />
line-height: 42px;<br />
}<br />
#home-content, #home-content .column, .mini-post {<br />
width: auto;<br />
float: none!important;<br />
display: block;<br />
}<br />
#home-content .column {<br />
margin: 0 0 40px;<br />
}<br />
.mini-post {<br />
margin: 0 auto 20px;<br />
width: 290px;<br />
}<br />
#tweet {<br />
padding: 40px 0 0 0;<br />
margin: 40px 0;<br />
width: auto;<br />
}<br />
#tweet .text {<br />
padding: 40px 20px 0;<br />
background-position: center top;<br />
}<br />
nav a {<br />
padding-left: 6px;<br />
padding-right: 6px;<br />
font-size: 12px;<br />
}<br />
<br />
#work article {<br />
width: 30%;<br />
margin: 10px;<br />
}<br />
#work article .image, #work article a img, .labs#work article .image {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images img, #case-details .images.two img {<br />
width: 100%;<br />
margin: 0 0 20px!important;<br />
}<br />
#page-header.case h1 {<br />
font-size: 30px;<br />
line-height: 28px;<br />
max-width: 55%}<br />
#page-header.case h2 {<br />
max-width: 50%;<br />
line-height: 24px;<br />
}<br />
.labs #page-header h1 {<br />
font-size: 46px;<br />
}<br />
#meta p {<br />
float: right;<br />
margin: 0;<br />
}<br />
#meta p:first-child {<br />
width: 50%;<br />
float: left;<br />
}<br />
#work-with-us {<br />
font-size: 18px;<br />
}<br />
#blog-top #categories {<br />
margin-bottom: 15px;<br />
}<br />
#blog-top form {<br />
width: 200px;<br />
}<br />
#blog-top input {<br />
width: 170px;<br />
}<br />
#blog-top #rss {<br />
width: 80px;<br />
float: right;<br />
}<br />
#blog article img {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#blog article {<br />
margin-bottom: 30px;<br />
}<br />
#blog article iframe {<br />
height: 270px;<br />
}<br />
#blog article .post h2 {<br />
font-size: 20px;<br />
line-height: 22px;<br />
}<br />
#blog .share {<br />
display: none;<br />
}<br />
.short-url {<br />
margin-bottom: 5px;<br />
}<br />
.categories {<br />
float: left;<br />
}<br />
.content h2 {<br />
font-size: 30px;<br />
line-height: 38px;<br />
}<br />
.content p {<br />
font-size: 14px;<br />
line-height: 22px;<br />
font-weight: 500;<br />
}<br />
<br />
footer {<br />
height: auto;<br />
}<br />
#wrap {<br />
margin-bottom: 0;<br />
min-height: 0;<br />
}<br />
.push {<br />
display: none;<br />
}<br />
#processes {<br />
margin: 0 20px;<br />
}<br />
.process .text {<br />
padding: 0 10px;<br />
}<br />
.process p {<br />
font-size: 12px;<br />
line-height: 16px;<br />
}<br />
}@media only screen and (min-width:480px) and (max-width:767px) {<br />
.container, .container.short {<br />
width: 420px;<br />
}<br />
.container .columns, .container .column {<br />
margin: 0;<br />
}<br />
.container .one.column, .container .one.columns, .container .two.columns, .container .three.columns, .container .four.columns, .container .five.columns, .container .six.columns, .container .seven.columns, .container .eight.columns, .container .nine.columns, .container .ten.columns, .container .eleven.columns, .container .twelve.columns, .container .thirteen.columns, .container .fourteen.columns, .container .fifteen.columns, .container .sixteen.columns, .container .one-third.column, .container .two-thirds.column {<br />
width: 420px;<br />
}<br />
#footer-newsletter input {<br />
width: 360px;<br />
}<br />
#blog-top form {<br />
width: 300px;<br />
}<br />
#blog-top input {<br />
width: 270px;<br />
}<br />
#blog-top #rss {<br />
width: 100px;<br />
float: right;<br />
}<br />
.categories {<br />
float: right;<br />
}<br />
.column-text {<br />
-moz-column-count: 1;<br />
-webkit-column-count: 1;<br />
column-count: 1;<br />
}<br />
}@media only screen and (min-width:320px) and (max-width:580px) {<br />
#logo, .sticky #logo {<br />
background-position: 0 -80px;<br />
top: 10px;<br />
left: 10px;<br />
}<br />
#logo1, .sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 10px;<br />
right: 1px;<br />
}<br />
header, header.sticky {<br />
height: 100px;<br />
}<br />
.sticky nav, nav {<br />
margin-top: 64px;<br />
}<br />
nav a {<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
}<br />
#feature h1 {<br />
top: 120px;<br />
font-size: 22px;<br />
line-height: 30px;<br />
}<br />
#tweet .text p {<br />
font-size: 20px;<br />
line-height: 24px;<br />
}<br />
#work article {<br />
width: 45%;<br />
margin: 6px;<br />
}<br />
#page-header {<br />
height: 200px;<br />
}<br />
#page-header h1 {<br />
font-size: 34px;<br />
}<br />
.labs #page-header h1 {<br />
font-size: 25px;<br />
}<br />
#page-header.case h2 {<br />
font-size: 16px;<br />
font-weight: 500;<br />
line-height: 20px;<br />
}<br />
#work-with-us {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#work-with-us span {<br />
background-image: none;<br />
}<br />
#contact #message input, #contact #message textarea {<br />
width: 200px;<br />
max-width: 200px;<br />
}<br />
#fresh ul {<br />
display: none;<br />
}<br />
#blog article iframe {<br />
height: 200px;<br />
}<br />
#process {<br />
display: none;<br />
}<br />
}.container:after {<br />
content: "\0020";<br />
display: block;<br />
height: 0;<br />
clear: both;<br />
visibility: hidden;<br />
}</div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl
Team:Shenzhen BGIC 0101/Downloadsl
2013-10-20T09:57:30Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #fcc;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version#">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl#">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a></nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: ;height: 200px;box-shadow: 4px 3px 125px #cff;"><br />
<h1></h1><br />
</div><br />
<br/><br />
<a name="overview"></a><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<h2>Download</h2> <br />
<div class="post-content" style="color: #ADFFCF;"><br/><br />
<br/><br/><br />
<p>Genove is based on UNIX/LINUX platform.<br/><br/><br/><br />
<p style="font-size: 1.6em;color: #38f;">How to download:</p><br/><br/><br/><br />
<p>You can download Genove from our team <a href="http://igemsoftware.github.io/Shenzhen_BGIC_0101_2013/">Github</a>.<br/><br/><br />
You may email us at <a href="mailto:luxujia@genomics.cn">luxujia@genomics.cn</a> with any questions, or if you need help during the installation process.<br />
</p><br/><br />
<br />
</div><br />
</div><br />
<br />
</div><br />
<br />
</article> <br />
<br />
</section><br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl
Team:Shenzhen BGIC 0101/Downloadsl
2013-10-20T09:56:24Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #fcc;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version#">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl#">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a></nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: ;height: 200px;box-shadow: 4px 3px 125px #cff;"><br />
<h1></h1><br />
</div><br />
<br/><br />
<a name="overview"></a><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<h2>Download</h2> <br />
<div class="post-content" style="color: #ADFFCF;"><br/><br />
<br/><br/><br />
<p>Genove is based on UNIX/LINUX platform.<br/><br/><br/><br />
<p style="font-size: 1.6em;color: #fdd;">How to download:</p><br/><br/><br/><br />
<p>You can download Genove from our team <a href="http://igemsoftware.github.io/Shenzhen_BGIC_0101_2013/">Github</a>.<br/><br/><br />
You may email us at <a href="mailto:luxujia@genomics.cn">luxujia@genomics.cn</a> with any questions, or if you need help during the installation process.<br />
</p><br/><br />
<br />
</div><br />
</div><br />
<br />
</div><br />
<br />
</article> <br />
<br />
</section><br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment
Team:Shenzhen BGIC 0101/Software Assessment
2013-10-20T09:55:06Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #fcc;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version#">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment#">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: ;height: 200px;box-shadow: 4px 3px 125px #cff;"><br />
<h1></h1><br />
</div><br />
<br/><br />
<a name="overview"></a><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<h2>Software Assessment</h2><br />
<br />
<div class="post-content" style="color: #ADFFCF;"><br/><br />
<br />
<p>Comparation<br />
Genovo focus on the whole flow of the synthesis of a new yeast chromosome with all the utilities needed. Biostudio and Gendesign turn in the direction of basic synthesis tools. Based on BioStudio and Gendesign, Genovo is more user-friendly and compositive that it has a very clear framework to help design a complete chromosome, loading all the targeted genes. It begins with pathways to grab interested genes to build the whole genome in an interface way and cut genome into pieces to be assembled for experiment. Thus, Synthetic biologist can make it from dry design to wet experiment accomplishment easily with Gennovo. With Biostudio or Gendesign, however, such task is not easy to finish, as you have to think over in details with the only basic tools provided to design, which is much the same like that you use C to process text instead of Perl. <br/><br/><br />
<img src="https://static.igem.org/mediawiki/2013/b/b3/Biostudio.png" /><br />
</p><br/><br />
<br />
</div><br />
</div><br />
<br />
</div><br />
<br />
</article> <br />
<br />
</section><br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial
Team:Shenzhen BGIC 0101/Web-based trial
2013-10-20T09:53:48Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #fcc;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial#">Web-based trial</a></div><br />
<br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a></nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: ;height: 200px;box-shadow: 4px 3px 125px #cff;"><br />
<h1></h1><br />
</div><br />
<br/><br />
<a name="overview"></a><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<h2>Web-based Trial</h2><br />
<br />
<div class="post-content" style="color: #ADFFCF;"><br/><br />
<br />
<p><br />
<br />
Please refer to this <a href="http://192.185.29.142/~luxujia/jbrowse_no_git/index.html?data=data/NeoChr/">site</a> to try out the web-based sever of Genovo</p> <br/><br />
<p><br />
<a href="http://codepad.org/tFYLEoI5 ">Here</a> is the description about the usage of Genovo' servers side and below is GUI.<br />
<br/><img src="https://static.igem.org/mediawiki/2013/3/35/Workflow.jpg" width="100%"/><br />
</p><br/><br />
<br />
</div><br />
</div><br />
<br />
</div><br />
<br />
</article> <br />
<br />
</section><br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial
Team:Shenzhen BGIC 0101/Tutorial
2013-10-20T09:52:19Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<br />
<style><br />
img{<br />
width: 100%;<br />
}<br />
#tabs {<br />
overflow: hidden;<br />
width: 70%;<br />
margin: 0;<br />
margin-left: 25%;<br />
padding: 0;<br />
list-style: none;<br />
font-size: 1.3em;<br />
<br />
font-weight: 800;<br />
}<br />
<br />
#tabs li {<br />
float: left;<br />
margin: 0 -15px 0 0;<br />
}<br />
<br />
#tabs a {<br />
float: left;<br />
position: relative;<br />
padding: 0 40px;<br />
height: 0;<br />
line-height: 30px;<br />
<br />
text-decoration: none;<br />
color: #38f; <br />
border-right: 30px solid transparent;<br />
<br />
border-bottom: 30px solid rgba(154, 249, 49, 0.71);<br />
border-bottom-color: #777\9;<br />
// opacity: .3;<br />
filter: alpha(opacity=30); <br />
}<br />
<br />
#tabs a:hover,<br />
#tabs a:focus {<br />
border-bottom-color: #2ac7e1;<br />
opacity: 1;<br />
filter: alpha(opacity=100);<br />
}<br />
<br />
#tabs a:focus {<br />
outline: 0;<br />
}<br />
<br />
#tabs #current {<br />
z-index: 3;<br />
border-bottom-color: #cff;<br />
opacity: 1;<br />
filter: alpha(opacity=100); <br />
}<br />
#tab1,#tab2,#tab3,#tab4{<br />
font-size: 16px;<br />
line-height: 19px;<br />
font-family: Trebuchet MS;<br />
font-weight: 600;<br />
color: #ccc;<br />
}<br />
#tab1,#tab2,#tab3,#tab4 img{<br />
width: 100%;<br />
}<br />
/* ----------- */<br />
#content2 {<br />
background: none repeat scroll 0 0 #CCFF99;<br />
border-top: 2px solid #3d3d3d;<br />
padding: 2em;<br />
width :55%;<br />
margin-left: 25%;<br />
<br />
}<br />
<br />
#content2 h2,<br />
#content h3,<br />
#content p {<br />
margin: 0 0 15px 0;<br />
color: #000000;<br />
} <br />
<br />
</style><br />
<br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
td,th{<br />
border-style: solid; border-width: 1px;<br />
}<br />
.tit{<br />
color: #6AA33D;<br />
}<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #fcc;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial#">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: ;height: 200px;box-shadow: 4px 3px 25px #cff;"><br />
<h1></h1><br />
</div><br />
<br/><br />
<h2 style="font-family: 'Tangerine', serif;font-size: 48px; text-shadow: 4px 4px 4px #aaa; color: #38f;<br />
letter-spacing: 0.1em;<br />
word-spacing: 0.3em;<br />
font-weight: 700;<br />
width: 30%;<br />
line-height: 36px;<br />
margin: 0;<br />
margin-left: 20%;">Tutorial</h2><br/><br />
<ul id="tabs"><br />
<li><a href="#" name="#tab1">Neochr</a></li><br />
<li><a href="#" name="#tab2">NucleoMod</a></li><br />
<li><a href="#" name="#tab3">SegmMan</a></li><br />
<li><a href="#" name="#tab4">Others</a></li> <br />
</ul><br />
<div id="content2"><br />
<div id="tab1"><br />
<p class="tit">1. NeoChr </p><br />
<p><br />
NeoChr module would assist users to grab related genes in different pathways manually, to rewire genes’ relationship logically*, and to replace genes with ortholog that score higher*. Firstly, it would allow users to define gene order and orientation in DRAG&DROP way. Secondly, decoupled these genes if have overlap and make all genes are non-redundancy. Finally, add chromosome features to build a new chromosome and show in the JBrowse. Moreover, users can drag a window in the JBrowse and delete any gene in the window.<br/><br />
Note: <br/><br />
*These function are unavailable now, please wait for version 2.<br/><br />
**You can also add any thing here including your own water mark.<br/></p><br />
<p class="tit">2. Plugin Scripts </p><br />
<p>This module contains three plugins: Decouple.pl, Add.pl and Delete.pl.</p><br />
<p class="tit">2.1 Decouple.pl</p><br />
<p>This plugin is to decouple the genes which have overlap gene regions. These overlapping genes can be decoupled if meet the following conditions: (1)If two genes have overlap gene regions, the latter gene 5’UTR does not cover the former gene initial codon (ATG); (2)Overlapping region initial coordinate is in the coding DNA sequences(CDS) of gene which is need to be decoupled; (3)The decouple site of CDS have synonymous substitute codon to replace; After decoupling, we use these non-redundancy genes to generate a GFF file and a FASTA file.</p><br />
<p class="tit">2.1.1 Internal operation </p><br />
<p>First, this plugin extracts base sequence from the genome file according to the gene order list, and records the gene order in the list. And then plugin records the annotation information according to the specie GFF file, moreover, plugin extends gene CDS upstream 600bp as 5’-UTR and downstream 100bp as 3’-UTR if the GFF file does not contain annotated these two features.<br/><br />
Second, this plugin detects the overlapping genes in the same chromosome. In case the overlapping genes are detected, it will judge whether the overlapping initial site is located in the CDS region, and identify the site is belong to phase0/1/2.<br/><br />
Third, the plugin attempts to synonymous substitute codon to break the initial codon intra the CDS. Printing information whether or not be decoupled successfully, such as:<br/><br />
<img src="https://static.igem.org/mediawiki/2013/e/e0/T1-1.png" alt="data" style="width: 750px" /><br/><br />
And non-redundancy genes are generated.<br/><br />
Finally, the plugin links non-redundancy genes to construct a new chromosome according to the gene order.<br />
</p><br />
<p class="tit">2.2.1 Example</p><br />
<p>We have two input forms to execute the plugin:<br/><br />
1. Using string format as gene order list input form:<br/><br />
perl GeneDecouple.pl --species saccharomyces_cerevisiae_chr --list_format string --gene_order="YAL054C -,YAL038W +,YBR019C -,YBR145W +,YCL040W +,YCR012W +,YCR105W +,YDL168W +,YPL017C -,YIL177C -,YIL177W-A +,YIL172C -,YIL171W-A +,” --geneset_dir ../gene_set --upstream_extend 600 --downstream_extend 100 --neo_chr_gff neochr.gff --neo_chr_fa neochr.fa<br/><br />
2. Using file format as gene order list input form:<br/><br />
erl GeneDecouple.pl --species saccharomyces_cerevisiae_chr --list_format file --gene_order gene_ordre.list --geneset_dir ../gene_set --upstream_extend 600 --downstream_extend 100 --neo_chr_gff neochr.gff --neo_chr_fa neochr.fa<br />
</p><br />
<p class="tit">2.1.3 Parameters </p><br />
<table border="1"><br />
<tr><br />
<th>Parameter</th><br />
<th>Description</th><br />
<th></th><br />
<th></th><br />
</tr><br />
<tr><br />
<th>list_format</th><br />
<th>set the input form of gene order list</th><br />
<th>string</th><br />
<th>string/file</th><br />
</tr><br />
<tr><br />
<th>gene_order</th><br />
<th>set the input gene order list file(include pathway genes and addition genes)</th><br />
<th></th><br />
<th></th><br />
</tr><br />
<tr><br />
<th>Parameter</th><br />
<th>Description</th><br />
<th>Default</th><br />
<th>Selectable range</th><br />
</tr><br />
<tr><br />
<th>geneset_dir</th><br />
<th>set the species annotation directory</th><br />
<th>600</th><br />
<th></th><br />
</tr><br />
<tr><br />
<th>upstream_extend</th><br />
<th>set the length of gene downstram(bp)</th><br />
<th>100</th><br />
<th></th><br />
</tr><br />
<tr><br />
<th>neo_chr_gff</th><br />
<th>set the name of output neochr gff file</th><br />
<th></th><br />
<th></th><br />
</tr><br />
<tr><br />
<th>neo_chr_fa</th><br />
<th>set the name of output neochr fasta file</th><br />
<th></th><br />
<th></th><br />
</tr><br />
<tr><br />
<th>help</th><br />
<th>Show help information</th><br />
<th></th><br />
<th></th><br />
</tr><br />
</table><br />
</p><br/><br />
<p class="tit">2.4.1 The format of output file</p><br />
<p>The output files are standard GFF and FASTA format files which are decoupled.<br/><br />
&nbsp;&nbsp;1. decoupled GFF file<br/><br />
<img src="https://static.igem.org/mediawiki/2013/e/e5/T1-2.png" alt="data" style="width: 750px" /><br/><br />
&nbsp;&nbsp;2.decoupled FASTA file<br/><br />
<img src="https://static.igem.org/mediawiki/2013/b/b2/T1-3.png" alt="data" style="width: 750px" /><br/><br />
<br />
<p class="tit">2.2 Add.pl </p><br />
<p>This plugin will add the LoxPsym sequence and the customized left and right telomeres, centromere and autonomously replicating sequence (ARS) into the FASTA file and GFF file which are generated by Decouple.pl.</p><br />
<p class="tit">2.2.1 Internal operation </p><br />
<p>The plugin adds LoxPsym behind the first 3bp of 3’-UTR in each gene and adds telomere, centromere and ARS according this mode:<br/><br />
<b>left_telomere + gene1 + centromere + gene2 + ARS + gene3 + right_telomere</b><br/><br />
The distance between centromere and ARS is less than 30Kb.<br/><br />
Finally, user can see the new added features chromosome according to the JBrowse.<br />
</p><br />
<p class="tit">2.2.2 Example </p><br />
<p>perl 04.Add.pl --loxp loxPsym.feat --left_telomere UTC_left.feat --right_telomere UTC_right.feat --ars chromosome_I_ARS108.feature --centromere chromosome_I_centromere.feat --chr_gff neochr.gff --chr_seq neochr.fa --neochr_seq neochr.final.fa --neochr_gff neochr.final.gff<br/><br/><br />
All the feature file format is 4 lines format, for example:<br/><br />
&nbsp;&nbsp;name = site_specific_recombination_target_region<br/><br />
&nbsp;&nbsp;type = loxPsym<br/><br />
&nbsp;&nbsp;source = BIO<br/><br />
&nbsp;&nbsp;sequence = ATAACTTCGTATAATGTACATTATACGAAGTTAT<br/><br />
Note: the first line is the detail name of feature, the second line is the type of feature, the third line is the source of feature and the last line is the sequence of feature.<br />
</p><br />
<p class="tit">2.2.3 Parameters</p><br />
<pre><br />
Parameter Description Default Selectable range<br />
loxp set the sequence of loxp ATAACTTCGTATAATGTATGCTATACGAAGTTAT <br />
left_telomere set the sequence of left telomere <br />
right_telomere set the sequence of right telomere <br />
chr_gff set the input neorchr_gff file <br />
chr_seq set the input neorchr_gff file <br />
neochr_seq set the name of output added loxps and telomeres neochr_fa file <br />
neochr_gff set the name of output added loxps and telomeres neochr_gff file <br />
</pre><br />
<br />
<p class="tit">2.2.4 The format of output</p><br />
<p>The output files are standard GFF and FASTA format of adding features chromosome.<br/><br />
1. added features GFF file<br/><br />
<img src="https://static.igem.org/mediawiki/2013/e/e0/T1-4.png" alt="data" style="width: 750px" ></a><br />
</p><br />
<br />
<p class="tit">2.3 Delete.pl </p><br />
<p>This plugin can modify the GFF and FASTA file which are generated by Add.pl according to the user drags a window in the JBrowse and delete any gene in the window.</p><br />
<p class="tit">2.3.1 Internal operation </p><br />
<p>Firstly, user uses mouse to drag a window in the added features FASTA file which is showed in the JBrowse and JBrowse displays all the genes in this window.Secondly, user decides which genes is need to be delected from the new chromosome and plugin deletes genes from GFF file and modify FASTA in the same time.</p><br />
<p class="tit">2.3.2 Example </p><br />
<p>perl 05.delete.pl --delete="YAL054C,YAL038W" --neochr_gff neochr.refine.final.gff --neochr_fa neochr.refine.final.fa --slim_gff neochr.refine.delete.gff --slim_fa neochr.refine.delete.fa </p><br />
<p class="tit">2.3.3 Parameters </p><br />
<p><pre><br />
Parameter Description Default Selectable range<br />
delete Set the to be deleted gene list <br />
neochr_gff Set the input GFF file which is generated by Add.pl <br />
neochr_fa Set the input FASTA file which is generated by Add.pl <br />
slim_gff Set the output GFF file <br />
slim_fa Set the output FASTA file </pre></p><br />
<br />
<p class="tit">2.3.4 The format of ouput</p><br />
<p>The output files are standard GFF and FASTA format of deleted genes chromosome.</p><br />
<br />
</div><br />
<div id="tab2"><br />
<p class="tit">1. NucleoMod </p><br />
<p>NucleoMod can modify CDS based on synonymous mutation. It has 5 applications. Firstly, NucleoMod is used to design CRISPR sites on NeoChr so that we can silence the wild type genes. Secondly, it can erase specific enzyme sites according to the users' selection. Thirdly, users can create an enzyme site in selected region of specific genes. Fourthly, it can optimize the codon efficiency to increase the expression level. Finally, it can smash the tandem repeat bases to reduce the synthesis difficulty.</p><br />
<p class="tit">2. Plugins</p><br />
<p>This module contains 5 plugins: CRISPR design, erase enzyme site, create enzyme site, codon optimization, repeat smash. All plugins are included in the main program.</p><br />
<p class="tit">2.1 CRISPR design</p><br />
<p>This plugin is used to design CRISPR site of NeoChr genes so that we can silence the wild type genes. We use blast+ to ensure the uniqueness of CRISPR sites. If you are using more than one plugin at the same time, this plugin will start firstly and deliver the data to next plugin. Otherwise it will generate a new fasta file for sequence and gff file for annotation.</p><br />
<p class="tit">2.1.1 Internal operation</p><br />
<p>First, this plugin extracts sequence and annotation from the NeoChr FASTA file and GFF3 file, respectively. Regular expression will be applied to find the 23bp basic structure of CRISPR site, with a head of ‘G’ then following 20 facultative bases and finally followed by ‘GG’. All the sequences and locus will be record in an array. <br/><br />
Second, the blast+ will be used to check whether the 12bp sequences (from 9th to 20th) are uniq in the wild type genome. Only uniq sites will be reserved. <br/><br />
Third, synonymous substitution method will be applied to change one base between the 9th to 20th bases of the CRISPR structure. The result will be record in GFF as an element of gene. If –verbose is set, the designed number will be report in STDOUT.<br/><br />
Finally, if this plugin is the last module, the sequence and annotation information will be recreated in FASTA and GFF format.</p><br />
<p class="tit">2.1.2 Example</p><br />
<p>We have two input forms to execute the plugin:<br/><br />
Run CRISPR design plugin only:<br/><br />
perl NucleoMod.pl -inputfa NeoChr.fa -inputgff NeoChr.gff -outputgff new_annotation.gff -outputfa new_chr.fa -crisprnum 2 -database saccharomyces_cerevisiae_chr.fa</p><br />
<p class="tit">2.1.3 Parameters</p><br />
<table><br />
<tr><td>Parameter</td><td>Description</td><td>Default</td><td>Selectable range</td></tr><br />
<tr><td>inputfa</td><td>The NeoChr sequence file in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>inputgff</td><td>The NeoChr annotation file in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputgff</td><td>Output of new chromosome annotation in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputfa</td><td>Output of new chromosome sequence in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>verbose</td><td>Output the detailed information in STDOUT</td><td>none</td><td>option</td></tr><br />
<tr><td>crisprnum</td><td>Number of CRISPR site to be design per gene</td><td></td><td>Int (>0)</td></tr><br />
<tr><td>database</td><td>The sequence of reference genome, used as blast+ database</td><td></td><td>string</td></tr><br />
<tr><td>help</td><td>Show help information</td><td></td><td></td></tr><br />
</table><br />
<p class="tit">2.1.4 The format of output file</p><br />
<p>The output files are standard GFF and FASTA format files.<br/><br />
1. GFF file<br/><br />
<img src="https://static.igem.org/mediawiki/2013/2/26/T2-1.png" /><br/><br />
2. FASTA file<br/><br />
<img src="https://static.igem.org/mediawiki/2013/d/df/T2-2.png" /><br/><br />
3. Detailed information in STDOUT<br/><br />
<img src="https://static.igem.org/mediawiki/2013/f/fb/T2-3.png" /><br />
</p><br />
<p class="tit">2.2 Erase enzyme site</p><br />
<p>Given a list of restriction enzyme information, this plugin will erase the restriction sites in every gene. If you are using more than one plugin at the same time, this plugin will start after CRISPR design and deliver the data to next plugin. Otherwise it will generate a new fasta file for sequence and gff file for annotation.</p><br />
<p class="tit">2.2.1 Internal operation</p><br />
<p>The enzyme information will be extracted. (If the –borbrickstandard parameter is set, it will also remove EcoRI, XbaI, SpeI, PstI and NotI) The recognize site will be reformatted to regular expression and searched in the CDS regions.<br />
Once a restriction site is matched, synonymous substitution method will be applied to try to erase the enzyme site. When the substitution is finished, the plugin will restart the next search from 1 base after the last matched position.<br />
If this plugin is the last module, the sequence and annotation information will be recreated in FASTA and GFF format.</p><br />
<p class="tit">2.2.2 Example</p><br />
<p>perl NucleoMod.pl -inputfa NeoChr.fa -inputgff NeoChr.gff -outputgff new_annotation.gff -outputfa new_chr.fa –biobrickstandard [-delenzymelist enzyme.list ]<br/><br />
<br/><br />
Format of enzyme.list:<br/><br />
Company enzyme_name enzyme_site …<br/><br />
Eg. NEB BamHI G/GATCC</p><br />
<p class="tit">2.2.3 Parameters</p><br />
<table><br />
<tr><td>Parameter</td><td>Description</td><td>Default</td><td>Selectable range</td></tr><br />
<tr><td>inputfa</td><td>The NeoChr sequence file in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>inputgff</td><td>The NeoChr annotation file in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputgff</td><td>Output of new chromosome annotation in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputfa</td><td>Output of new chromosome sequence in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>verbose</td><td>Output the detailed information in STDOUT</td><td>none</td><td>option</td></tr><br />
<tr><td>biobrickstandard</td><td>Erase the biobrick standard enzyme site</td><td>none</td><td>option</td></tr><br />
<tr><td>delenzymelist</td><td>The file of enzyme going to delete</td><td></td><td>string</td></tr><br />
<tr><td>detail</td><td>Show the erased enzyme site in new gff</td><td>none</td><td>option</td></tr><br />
<tr><td>help</td><td>Show help information</td><td></td><td></td></tr><br />
<br />
</table><br />
<p class="tit">2.2.4 The format of output</p><br />
<p>The output files are standard GFF and FASTA format.<br/><br />
1. GFF file<br/><br />
<br />
2. FASTA file<br/><br />
<br />
3. Detailed information in STDOUT<br/><br />
<img src="https://static.igem.org/mediawiki/2013/e/ea/T2-4.png" /><br/><br />
</p><br />
<p class="tit">2.3 Create enzyme site</p><br />
<p>Given a list of restriction enzyme information, this plugin can create a new enzyme site in specific region of selected gene. If you are using more than one plugin at the same time, this plugin will start after erase enzyme site and deliver the data to next plugin. Otherwise it will generate a new fasta file for sequence and gff file for annotation.</p><br />
<p class="tit">2.3.1 Internal operation</p><br />
<p>First, information of enzyme site will be extracted. According to 3 reading frames, a searching tree will be constructed and converted to regular expression. <br />
The plugin will search the selected regions and then change the sequence to enzyme site by synonymous substitution method.<br />
If this plugin is the last module, the sequence and annotation information will be recreated in FASTA and GFF format.</p><br />
<p class="tit">2.3.2 Example</p><br />
<p>perl NucleoMod.pl -inputfa NeoChr.fa -inputgff NeoChr.gff -outputgff new_annotation.gff -outputfa new_chr.fa -addenzymelist enzyme.list -addenzymeconfig gene_id,start_pos,end_pos,enzyme_name</p><br />
<p class="tit">2.3.3 Parameters</p><br />
<p><br />
<table><br />
<tr><td>Parameter</td><td>Description</td><td>Default</td><td>Selectable range</td></tr><br />
<tr><td>inputfa</td><td>The NeoChr sequence file in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>inputgff</td><td>The NeoChr annotation file in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputgff</td><td>Output of new chromosome annotation in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputfa</td><td>Output of new chromosome sequence in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>verbose</td><td>Output the detailed information in STDOUT</td><td>none</td><td>option</td></tr><br />
<tr><td>addenzymelist</td><td>The file of enzyme to get enzyme site information</td><td></td><td>string</td></tr><br />
<tr><td>addenzymeconfig</td><td>A array of string to specify enzyme and regions</td><td></td><td>string,int,int,string</td></tr><br />
<tr><td>help</td><td>Show help information</td><td></td><td></td></tr><br />
</table><br />
</p><br />
<p class="tit">2.3.4 The format of ouput</p><br />
<p>The output files are standard GFF and FASTA format.<br/><br />
1. GFF file<br/><br />
<br />
2. FASTA file<br/><br />
<br />
3. Detailed information in STDOUT<br/><br />
<img src="https://static.igem.org/mediawiki/2013/7/75/T2-5.png" /><br/><br />
<br />
</p><br />
<p class="tit">2.4 Codon optimization</p><br />
<p>Given a codon priority list, this plugin is used to optimize the codon so that we can increase the expression of selected genes. If you are using more than one plugin at the same time, this plugin will start after create enzyme site and deliver the data to next plugin. Otherwise it will generate a new fasta file for sequence and gff file for annotation.</p><br />
<p class="tit">2.4.1 Internal operation</p><br />
<p>The codon with same amino acid will be separated into 3 ranks, best normal and worst. Every codon of selected gene will be check whether the codon is in best rank. The codon in normal or worst will be change to best rank by synonymous substitution method.<br />
If this plugin is the last module, the sequence and annotation information will be recreated in FASTA and GFF format.</p><br />
<p class="tit">2.4.2 Example</p><br />
<p>perl NucleoMod.pl -inputfa NeoChr.fa -inputgff NeoChr.gff -outputgff new_annotation.gff -outputfa new_chr.fa -codonoptimize CodonPriority.txt -optimizeallgene [-optimizegenelist gene1,gene2,gene3 ]</p><br />
<p class="tit">2.4.3 Parameters</p><br />
<p><br />
<table><br />
<tr><td>Parameter</td><td>Description</td><td>Default</td><td>Selectable range</td></tr><br />
<tr><td>inputfa</td><td>The NeoChr sequence file in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>inputgff</td><td>The NeoChr annotation file in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputgff</td><td>Output of new chromosome annotation in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputfa</td><td>Output of new chromosome sequence in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>verbose</td><td>Output the detailed information in STDOUT</td><td>none</td><td>option</td></tr><br />
<tr><td>codonoptimize</td><td>Codon priority list to get the ranking information</td><td></td><td>string</td></tr><br />
<tr><td>optimizeallgene</td><td>Optimize all genes in inputgff</td><td></td><td>option</td></tr><br />
<tr><td>optimizegenelist</td><td>A list of gene going to optimize, separate by comma</td><td></td><td>string,string,string,...</td></tr><br />
<tr><td>detail</td><td>Show the optimization sequence in new gff</td><td>none</td><td>option</td></tr><br />
<tr><td>help</td><td>Show help information</td><td></td><td></td></tr><br />
</table><br />
</p><br />
<p class="tit">2.4.4 The format of ouput</p><br />
<p>The output files are standard GFF and FASTA format.<br/><br />
1. GFF file<br/><br />
2 .FASTA file<br/><br />
3. Detailed information in STDOUT<br/><br />
<img src="https://static.igem.org/mediawiki/2013/a/a2/T2-6.png" /><br />
</p><br />
<p class="tit">2.5 Repeat smash</p><br />
<p>This plugin go through the CDS region to find out the tandem repeat bases. Synonymous substitution method will be applied to break long tandem repeat base to reduce the synthesis difficulty. If you are using more than one plugin at the same time, this plugin will start finally and then it will generate a new fasta file for sequence and gff file for annotation.</p><br />
<p class="tit">2.5.1 Internal operation</p><br />
<p>Regular expression is used to find out the tandem repeat bases longer then specified length (usually longer than 5bp). From the third of the matched sequence, synonymous substitution method will be applied to break the tandem repeat bases. <br />
If the substitution is successful and the rest sequence is still longer than the cutoff, then it will move to next 3 bases and do the same thing. <br />
The sequence and annotation information will be recreated in FASTA and GFF format.</p><br />
<p class="tit">2.3.2 Example</p><br />
<p>perl NucleoMod.pl -inputfa NeoChr.fa -inputgff NeoChr.gff -outputgff new_annotation.gff -outputfa new_chr.fa -repeatsmash 5</p><br />
<p class="tit">2.3.3 Parameters</p><br />
<p><br />
<table><br />
<tr><td>Parameter</td><td>Description</td><td>Default</td><td>Selectable range</td></tr><br />
<tr><td>inputfa</td><td>The NeoChr sequence file in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>inputgff</td><td>The NeoChr annotation file in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputgff</td><td>Output of new chromosome annotation in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputfa</td><td>Output of new chromosome sequence in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>verbose</td><td>Output the detailed information in STDOUT</td><td>none</td><td>option</td></tr><br />
<tr><td>repeatsmash</td><td>The tandem repeat bases longer or equal to this cutoff will be smashed</td><td></td><td>int</td></tr><br />
<tr><td>detail</td><td>Show the repeat smash result in new gff</td><td>none</td><td>option</td></tr><br />
<tr><td>help</td><td>Show help information</td><td></td><td></td></tr><br />
</table><br />
</p><br />
<p class="tit">2.3.4 The format of ouput</p><br />
<p><br />
The output files are standard GFF and FASTA format.<br/><br />
1. GFF file<br/><br />
2. FASTA file<br/><br />
3. Detailed information in STDOUT<br/><br />
<img src="https://static.igem.org/mediawiki/2013/8/83/T2-7.png" /><br />
</p><br />
<br />
</div><br />
<div id="tab3"><br />
<p class="tit">3. SegmMan </p><br />
<p>This module will cut chromosome into pieces with different sizes with Gibson, Goldengate, Homologous adaptors to them so that they are able to be assembled into whole experimentally.</p><br />
<p class="tit">Plugin Scripts</p><br />
<br/><br />
<p class="tit">3-1. 01.whole2mega.pl</p><br />
<p>This utility can split the whole chromosome ( at least 90kbp long ) into about 30k segments and add homologous overlap and adaptors, so that these fragments can be integrated into whole experimentally.</p><br />
<p class="tit">Internal operation</p><br />
<p>First, this utility searches for the location of centromere and ARSs (autonomously replicating site). The minimal distance between centromere and ARS should NOT be larger than a defined megachunk which is about 30k long. <br/><br />
Second, this utility cuts out the first 30k sequence window containing the centromere and its adjacent ARS, and then adds this megachunk with two original markers and left, right telomeres.<br/><br />
Thirdly, this utility continues to cut more megachunks from the original one to both ends. But these megachunks are not independent, they all have about 1kbp overlaps. Moreover, these new splited window can be given only one marker alternately and only left or right telomere.<br/><br />
The output file will be dealed with 02.globalREmarkup.pl<br/><br />
For more information about segmentation design, please refer to the page ASSEMBLY DESIGN PRINCIPLE .</p><br />
<p class="tit">Example (command line)</p><br />
<p>perl 01.whole2mega.pl –gff sce_chrI.gff -fa sce_chr01.fa -ol 1000 -ck 30000 -m1 LEU2 -m2 URA3 -m3 HIS3 -m4 TRP1 -ot sce_chrI.mega</p><br />
<p class="tit">Parameters</p><br />
<table><tbody><br />
<tr><td></td><td></td><td>default</td><td>Option</td></tr><br />
<tr><td>gff</td><td>The gff file of the chromosome being restriction enzyme sites parsing</td><td></td><td></td></tr><br />
<tr><td>fa</td><td>The fasta file of the chromosome being restriction enzyme sites parsing<br />
(The length of the chromosome is larger than 90k)</td><td></td><td></td></tr><br />
<tr><td>ol</td><td>The length of overlap between megachunks</td><td>1000bp</td><td></td></tr><br />
<tr><td>ck</td><td>The length of megachunks</td><td>30kbp</td><td></td></tr><br />
<tr><td>m1</td><td>The first marker for selection alternately</td><td>LEU2 (1797bp)</td><td>LEU2/URA3HIS3/TRP1</td></tr><br />
<tr><td>m2</td><td>The second marker for selection alternately<br />
</td><td>URA3 (1112bp)</td><td>LEU2/URA3/HIS3/TRP1</td></tr><br />
<tr><td>m3</td><td>The first marker orinally residing in first 30k segmentation</td><td>HIS3 (1774bp)</td><td>LEU2/URA3/HIS3/TRP1</td></tr><br />
<tr><td>m4</td><td>The second marker orinally residing in first 30k segmentation</td><td>TRP1 (1467bp)</td><td>LEU2/URA3/HIS3/TRP1</td></tr><br />
<tr><td>ot</td><td>The output file </td><td>Prefix(fa filename)+ suffix(.mega)</td><td></td></tr><br />
</tbody></table><br />
<br />
<p class="tit">The format of output:</p><br />
<p>The output file is stored in /the path where you install GENOVO/Result/ 01.whole2mega.<br/><br />
Besides, there is screen output about the process state and result.<br/><br />
1. Screen output<br/><br />
2. 01.state <br/><br />
&nbsp;Store the segmentation information<br/><br />
<table><tbody><br />
<tr><td>Megachunk_ID</td><td>Corresponding location in the designed chromosome</td></tr><br />
<tr><td>Part ID</td><td>Location in the segmentation</td></tr><br />
</tbody></table><br />
<img src="https://static.igem.org/mediawiki/2013/c/c1/T3-1.png" /><br/><br />
3 *.mega<br/><br />
&nbsp;Store the fasta information of the 30k segments<br/><br />
<img src="https://static.igem.org/mediawiki/2013/f/f0/T3-2.png" /><br />
</p><br />
<p class="tit">3-2. 02.globalREmarkup.pl</p><br />
<p>This utility will parse the exited restriction enzyme sites residing in the chromosome.</p><br />
<p class="tit">Internal operation</p><br />
<p>This utility searches the exited restriction enzyme sites along the chromosome both plus strand and minus strand, after users define the list of enzymes.<br/><br />
Besides, we tried to find out all the potential restriction enzyme sites, so that maybe some unusual restriction enzyme sites can be created and let segmentation go. But because it had low efficiency, we’re still working on that.<br/><br />
The output file will be dealed with 03.mega2chunk2mini.pl<br/><br />
For more information about segmentation design, please refer to the page ASSEMBLY DESIGN PRINCIPLE .<br />
</p><br />
<p class="tit">Example (command line)</p><br />
<p>perl 02.globalREmarkup.pl -sg 01.whole2mega/sce_chrI.mega -re standard_and_IIB -ct Standard.ct –ot sce_chrI.mega.parse</p><br />
<p class="tit">Parameters</p><br />
<p><br />
<table><tbody><br />
<tr><td></td><td></td><td>default</td><td>Option</td></tr><br />
<tr><td>sg</td><td>The fasta file of the 30k segmentation, the output of 01.wh2mega.pl</td><td></td><td></td></tr><br />
<tr><td>ps</td><td>The markup file of the 30k segmentation, the output of 02.globalREmarkup.pl</td><td></td><td></td></tr><br />
<tr><td>re</td><td>The restriction enzyme sites list. It is devided by different standards, type (IIP, IIA, IIB), cost (standard, nonexpensive) and etc.</td><td>Standard_and_IIB</td><td>IIP/IIA/IIB/Standard/<br />
Nonexpensive/<br />
Standard_IIB<br />
Nonexpensive_IIB</td></tr><br />
<tr><td>a2</td><td>2k to 10k assembly strategy (Gibson or Goldengate)</td><td>Gibson</td><td>Gibson/ Goldengate</td></tr><br />
<tr><td>a10</td><td>10k to 30k assembly strategy (Gibson or Goldengate)</td><td>Goldengate</td><td>Gibson/ Goldengate</td></tr><br />
<tr><td>ckmax2</td><td>The maximum length of minichunks</td><td>2200 bp</td><td></td></tr><br />
<tr><td>ckmin2</td><td>The minimum length of minichunks </td><td>1800 bp</td><td></td></tr><br />
<tr><td>cknum</td><td>The number of minichunks in a chunk</td><td>5</td><td></td></tr><br />
<br />
</tbody></table><br />
Codon table list:<br/><br />
1 The Standard Code<br/><br />
2 The Vertebrate Mitochondrial Code<br/><br />
3 The Yeast Mitochondrial Code<br/><br />
4 The Mold, Protozoan, and Coelenterate Mitochondrial Code and the Mycoplasma/Spiroplasma Code<br/><br />
5The Invertebrate Mitochondrial Code<br/><br />
6 The Ciliate, Dasycladacean and Hexamita Nuclear Code<br/><br />
7 The Echinoderm and Flatworm Mitochondrial Code<br/><br />
8 The Euplotid Nuclear Code<br/><br />
9 The Bacterial, Archaeal and Plant Plastid Code<br/><br />
10 The Alternative Yeast Nuclear Code<br/><br />
11 The Ascidian Mitochondrial Code<br/><br />
12 The Alternative Flatworm Mitochondrial Code<br/><br />
13 Blepharisma Nuclear Code<br/><br />
14 Chlorophycean Mitochondrial Code<br/><br />
15 Trematode Mitochondrial Code<br/><br />
16 Scenedesmus Obliquus Mitochondrial Code<br/><br />
17 Thraustochytrium Mitochondrial Code<br/><br />
18 Pterobranchia Mitochondrial Code<br/><br />
19 Candidate Division SR1 and Gracilibacteria Code<br/><br />
</p><br />
<p class="tit">The format of utput</p><br />
<p>The output file is stored in /the path where you install GENOVO/Result/. 02.globalREmarkup.<br/><br />
Besides, there is screen output about the process state and result.<br/><br />
1. Screen output<br/><br />
2. *.parse<br/><br />
Store the exited enzyme recognition site in the megachunks<br/><br />
Enzyme ID Start End Recognition site Real site<br/><br />
<img src="https://static.igem.org/mediawiki/2013/b/bf/T3-3.png" /><br />
</p><br />
<p class="tit">3-3. 03.chunk_30k_10k_2k.pl</p><br />
<p>This utility can produce 2k minichunks with Gibson adaptors and 10k chunks with goldengate adaptors.</p><br />
<p class="tit">Internal operation</p><br />
<p>This utility will segmentate the megachunk produced by 03.mega2chunk2mini.pl into 2k minichunks with Gibson assembly adaptors, so that they can be put together into 10k chunks.<br/><br />
First, this bin will search the inexistent restriction enzyme sites locally, and then decide the size of the minichunks according to the requirements from users, and add two same Gibson adaptors to each sides of minichunks.<br />
Secondly, the second part of this bin will define the start and end point of the chunks as users asked and design goldengate assembly adaptors for the chunks.<br/><br />
The output file can be sent in gene synthesis company after human attention and double check.<br/><br />
For more information about segmentation design, please refer to the page ASSEMBLY DESIGN PRINCIPLE .</p><br />
<p class="tit">Example (command line)</p><br />
<p>perl 03.mega2chunk2mini.pl -re standard_and_IIB -sg 01.whole2mega/sce_chr01_0.mega -ps 02.globalREmarkup/sce_chr01_0.parse -ot 03.mega2chunk2mini</p><br />
<p class="tit">Parameters</p><br />
<p><br />
<table><tbody><br />
<tr><td></td><td></td><td>default</td><td>Option</td></tr><br />
<tr><td>sg</td><td>The fasta file of the 30k segmentation, the output of 01.wh2mega.pl</td><td></td><td></td></tr><br />
<tr><td>ps</td><td>The markup file of the 30k segmentation, the output of 02.globalREmarkup.pl</td><td></td><td></td></tr><br />
<tr><td>re</td><td>The restriction enzyme sites list. It is devided by different standards, type (IIP, IIA, IIB), cost (standard, nonexpensive) and etc.</td><td>Standard_and_IIB</td><td>IIP/IIA/IIB/Standard/<br />
Nonexpensive/<br />
Standard_IIB<br />
Nonexpensive_IIB</td></tr><br />
<tr><td>a2</td><td>2k to 10k assembly strategy (Gibson or Goldengate)</td><td>Gibson</td><td>Gibson/ Goldengate</td></tr><br />
<tr><td>a10</td><td>10k to 30k assembly strategy (Gibson or Goldengate)</td><td>Goldengate</td><td>Gibson/ Goldengate</td></tr><br />
<tr><td>ckmax2</td><td>The maximum length of minichunks</td><td>2200 bp</td><td></td></tr><br />
<tr><td>ckmin2</td><td>The minimum length of minichunks </td><td>1800 bp</td><td></td></tr><br />
<tr><td>cknum</td><td>The number of minichunks in a chunk</td><td>5</td><td></td></tr><br />
<br />
</tbody><br />
</table><br />
If parameter a2 is Gibson, then there are additional parameters:<br/><br />
<table><tbody><br />
<tr><td>ol2</td><td>The length of overlap</td><td>40 bp</td><td></td></tr><br />
<tr><td>tmax2</td><td>The maximum melting temperature of the overlap of minichunks</td><td>60℃</td><td></td></tr><br />
<tr><td>tmin2</td><td>The minimum melting temperature of the overlap of minichunks</td><td>56℃</td><td></td></tr><br />
<tr><td>fe2</td><td>The minimum free energy of the overlap of minichunks</td><td>-3</td><td></td></tr><br />
<tr><td>ex2</td><td>The type of exonuclease used for minichunks</td><td>T5</td><td>T5/T3</td></tr><br />
<tr><td>lo2</td><td>The minimum distance between minichunks overlap and loxpsym</td><td>40 bp</td><td></td></tr><br />
<tr><td>en2</td><td>The type of enzyme flanking minichunks</td><td>IIP</td><td></td></tr><br />
<tr><td>et2</td><td></td><td></td><td></td></tr><br />
<tr><td>ep2</td><td>The maximum unit price of enzyme used in minichunks digestion</td><td>0.5 $/unit</td><td></td></tr><br />
<br />
</tbody><br />
</table><br />
If parameter a10 is Goldengate, then there are additional parameters:<br/><br />
<table><tbody><br />
<tr><td>en10</td><td>The type of enzyme flanking chunks</td><td>IIB</td><td>IIA/IIB</td><tr><br />
<tr><td>et10</td><td>The temperature of enzyme used in chunks digestion</td><td>37℃</td><td></td></tr><br />
<br />
</tbody><br />
</table><br />
</p><br />
<p class="tit">The format of ouput</p><br />
<p>The output file is stored in /the path where you install GENOVO/Result/. 03.mega2chunk2mini.<br/><br />
Besides, there is screen output about the process state and result.<br/><br />
1. Screen output<br/><br />
2. *.2kstate<br/><br />
Store the minichunks states.<br/><br />
<table><tr><td>Left IIP enzyme site</td><td>Right IIP enzyme site</td><td>Start</td><td>End</td><td>Size of minichunks</td><td>Melting temperature of overlap</td></tr><br />
</table><br />
<img src="https://static.igem.org/mediawiki/2013/b/bf/T3-3.png" /><br/><br />
3. *.10kstate<br/><br />
Store the chunks states<br/><br />
<table><br />
<tr><td>Left IIB enzyme site</td><td>Right IIB enzyme site</td><td>Start</td><td>End</td>Size of chunks<td></td></tr><br />
</table><br />
<img src="https://static.igem.org/mediawiki/2013/a/ad/T3-4.png" /><br/><br />
4. *.mini<br/><br />
Store the fasta of designed minichunks.<br/><br />
<img src="https://static.igem.org/mediawiki/2013/0/0f/T3-5.png" /><br/><br />
</p><br />
<br />
<br />
</div><br />
<div id="tab4"><br />
<p class="tit">Presentation from KGML</p><br />
<p> This module will grab genes’ details in different pathways, which from KEGG with KEGG Makeup Language (KGML) file and export genes list and relationship of genes. The goal here is to visualize the pathway and rebuild it in the level of genes.</p><br />
<p class="tit">Scripts<br/>1. keggid_convert_gene.pl</p><br />
<p> This utility can convert KEGGID which in KGML file into genes’ name and rewrite KGML file.</p><br />
<p class="tit">Internal operation</p><br />
<p> First, this utility will change the pathway’s name into KEGG database names, and then open the file with the entire list of genes, push them in hash.<br/><br />
Second, this utility will read the original pathway’s xml file in and replace KEGGID with gene’s name one by one. Furthermore, it will change type element all into “gene”.<br/><br />
Thirdly, it will be the substitution of original pathway’s xml file.</p><br />
<p class="tit">Example</p><br />
<p> perl keggid_convert_gene.pl ko04010</p><br />
<p class="tit">The format of output:</p><br />
<p>It will rewrite the original pathway’s xml file, if we have following statement:<br/><br />
<entry id="30" name="ko:K08018" type="ortholog"<br/><br />
After running this scripts, it will turn into:<br/><entry id="30" name=" RAPGEF2, PDZGEF1" type="gene" </p><br />
<p class="tit">convert.py</p><br />
<p> This utility will read in KGML file which have been rewritten before, and grab genes’ information, such as genes’ name, genes’ relationship and then convert these into JSON.</p><br />
<p class="tit">Internal operation</p><br />
<p> First, this utility will use the parameter –f to determine the specified file and read it in. The output file will use the file name that put forward.<br/><br />
Second, this utility convert KGML file into JSON and grab the information of genes, such as the reactions of genes and the relationship between genes.<br/><br />
Third, this utility continue to integrate the information above into two files, ‘gene.json’ and ‘relation.json’, which can be use directly in rewrite gene’s pathway.</p><br />
<p class="tit">Example</p><br />
<p> python convert.py –f sce04111</p><br />
<p class="tit">Parameters:</p><br />
<table border='1'><tbody><br />
<tr><td></td><td>default</td></tr><br />
<tr><td>-f/--file</td><td>read KGML from FILENAME(omit '.xml'), produce two files: gene list and relation</td></tr><br />
</tbody></table><br />
<p class="tit">The format of output:</p><br />
<p>The output file is stored in the path where you running this program.<br/><br />
1. _gene.json <br/><br />
<img src="https://static.igem.org/mediawiki/2013/1/1b/T4-1.png" /><br />
type:<br/><br />
<table><tbody><br />
<tr><td>ortholog</td><td>KO (orthology group)</td></tr><br />
<tr><td>enzyme</td><td>Enzyme</td></tr><br />
<tr><td>reaction</td><td>Reaction</td></tr><br />
<tr><td>gene</td><td>gene product (mostly a protein)</td></tr><br />
<tr><td>group</td><td>a complex of gene products (mostly a protein complex)</td></tr><br />
</tbody></table><br />
geneID:the unique identification of gene<br/><br />
<table><tbody><br />
<tr><td>name</td><td>the KEGGID of this gene </td></tr><br />
<tr><td>type</td><td>the type of this gene</td></tr><br />
</tbody></table><br />
reaction:<br/><br />
<table><tbody><br />
<tr><td>name</td><td>the KEGGID of this reaction</td></tr><br />
<tr><td>reversible</td><td>true: reversible reaction; false: irreversible reaction</td></tr><br />
<tr><td>substrates</td><td>KEGGID of substrate node</td></tr><br />
<tr><td>products</td><td>the KEGGID of product node</td></tr><br />
<tr><td>related-reactions</td><td>relate to another pathway or gene</td></tr><br />
</tbody></table><br />
2. _relation.json<br />
<img src="https://static.igem.org/mediawiki/2013/c/c1/T4-2.png" /><br />
relations:<br/><br />
<table><tbody><br />
<tr><td>type</td><td>The type of this relation[ ECrel, PPrel. GErel, PCrel, maplink]</td></tr><br />
<tr><td>subtype</td><td>Interaction/relation information[activation/inhibition]</td></tr><br />
<tr><td>entry1</td><td>The first (from) entry that defines this relation</td></tr><br />
<tr><td>entry2</td><td>The second (to) entry that defines this relation</td></tr><br />
</tbody></table><br />
entry1&2:<br/><br />
<table><tbody><br />
<tr><td>entry ID</td><td>The KEGGID of node which takes part in this relation</td></tr><br />
<tr><td>type</td><td>Have only two options: [gene/group]</td></tr><br />
<tr><td>name</td><td>The KEGGID of this gene</td></tr><br />
<tr><td>group</td><td>The node is a complex of gene products (mostly a protein complex)</td></tr><br />
</tbody></table><br />
</p><br />
<br/> <p class="tit">Shortcoming</p><br />
<p>We can’t automatic acquisition KGML file in the KEGG API, all the demo we have show need to be downloaded before. You can get the entire list of one database genes through KEGG API, just like http://rest.kegg.jp/list/ko , it shows the entire list of orthology genes. The download method about KGML files shows in “How to finish this plun-in” part.<br />
Some genes will relate to another pathway but it doesn’t shows in the pathway so we are failed to grab the relationships between genes and pathways automatically. So we added two gene-pathway relations in ko04010 demo manually, TP53 gene connected with ko04115: P53 signaling pathway and NLK gene connected with ko04310: WNT signaling pathway.<br />
We look forward to the improvement of this plun-in through these disadvantages. </p><br />
<p class="tit">How to finish this plun-in?</p><br />
<p> KEGG is a database resource for understanding high-level functions and utilities of the biological system, and KGML is an XML presentation of the KEGG pathway database, which enables automatic drawing of KEGG pathways and provides facilities for computational analysis and modeling of gene/protein networks and chemical networks. Here is the data structure of KGML.<br/> <br />
<img src="https://static.igem.org/mediawiki/2013/f/fa/T4-3.png" /><br />
It’s really complex and it will bother you to understand the KGML file! Do not worry, I will show you how to understand a KGML file and then how to convert it into JSON.<br/> <br />
First, how to find or download KGML file?<br/> <br />
Method: <br/> <br />
Download KGML" link for each pathway map.<br/> <br />
If you choose a pathway with prefix “map”, you can’t find the download link in the page, that’s <br />
because it can be generating almost ko/rn/ec/org files. <br/> <br />
Such as “map04111”, it has no link for download. But if you change the “map” into “sce” in<br />
the URL, you can get the file.<br/> <br />
<a href="http://www.kegg.jp/kegg/rest/keggapi.html">KEGG API:</a><br />
Take “sce04111” as an example, you can download the KGML file via the <a href="http://rest.kegg.jp/get/sce04111/KGML">this</a>.<br/> <br />
Second, the KGML file is difficult to find out the relationship through the data structure show above.<br/> <br />
Here is the simple but straightforward tutorial to teach you how to understand a KGML file.<br/> <br />
Take “sce04111.xml” as an example. We can simplify the data structure as:<br/> <br />
<img src="https://static.igem.org/mediawiki/2013/c/c5/T4-4.png" /><br/><br />
The entry element can be path/ko/ec/rn/cpd/gl/org/group, enzyme/protein/gene will have relation and gene will also have compound and reactions. We choose one relation to be example:<br/> <br />
<img src="https://static.igem.org/mediawiki/2013/2/27/T4-5.png" /><br />
It means that gene (YCL061C) have activation effect in gene (YPL153C).By the way, through the graphics elements, we can definitely rewrite the connection between these two genes.<br/> <br />
<br />
Third, thought we know how to get KGML file and can understand it but the crucial problem is, how to grab the information of genes and convert it into JSON.<br/> <br />
Here we use Python programming Language, install the library “lxml” for processing XML and HTML, and we import JSON library for convert.<br/> <br />
<br />
Fourth, you may ask: If there have any other software to do such job, that is read KGML files, convert it and rewrite it? <br/> <br />
Of course, and we indeed tried but failed for it’s not open source or the original source is difficult for modification. <br />
Actually, if you want to do some visualize pathway job, Cytoscape is a good choice and it also have cytoscape.js for drawing.<br/> <br />
<br />
Finally, we indeed done plentiful preparatory work, maybe in the end it’s not useful in this software but it can expand our horizons. <br />
<br/> <br />
</p><br />
<br />
</div><br />
<br />
</div><br />
<br />
<script><br />
function resetTabs(){<br />
$("#content2 > div").hide(); //Hide all content<br />
$("#tabs a").attr("id",""); //Reset id's <br />
}<br />
<br />
var myUrl = window.location.href; //get URL<br />
var myUrlTab = myUrl.substring(myUrl.indexOf("#")); // For localhost/tabs.html#tab2, myUrlTab = #tab2 <br />
var myUrlTabName = myUrlTab.substring(0,4); // For the above example, myUrlTabName = #tab<br />
<br />
(function(){<br />
$("#content2 > div").hide(); // Initially hide all content<br />
$("#tabs li:first a").attr("id","current"); // Activate first tab<br />
$("#content2 > div:first").fadeIn(); // Show first tab content<br />
<br />
$("#tabs a").on("click",function(e) {<br />
e.preventDefault();<br />
if ($(this).attr("id") == "current"){ //detection for current tab<br />
return <br />
}<br />
else{ <br />
resetTabs();<br />
$(this).attr("id","current"); // Activate this<br />
$($(this).attr('name')).fadeIn(); // Show content for current tab<br />
}<br />
});<br />
<br />
for (i = 1; i <= $("#tabs li").length; i++) {<br />
if (myUrlTab == myUrlTabName + i) {<br />
resetTabs();<br />
$("a[name='"+myUrlTab+"']").attr("id","current"); // Activate url tab<br />
$(myUrlTab).fadeIn(); // Show url tab content <br />
}<br />
}<br />
})()<br />
</script><br />
<br/><br/><br/><br/><br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial
Team:Shenzhen BGIC 0101/Tutorial
2013-10-20T09:47:54Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<br />
<style><br />
img{<br />
width: 100%;<br />
}<br />
#tabs {<br />
overflow: hidden;<br />
width: 70%;<br />
margin: 0;<br />
margin-left: 25%;<br />
padding: 0;<br />
list-style: none;<br />
font-size: 1.3em;<br />
<br />
font-weight: 800;<br />
}<br />
<br />
#tabs li {<br />
float: left;<br />
margin: 0 -15px 0 0;<br />
}<br />
<br />
#tabs a {<br />
float: left;<br />
position: relative;<br />
padding: 0 40px;<br />
height: 0;<br />
line-height: 30px;<br />
<br />
text-decoration: none;<br />
color: #38f; <br />
border-right: 30px solid transparent;<br />
border-bottom: 30px solid rgba(54, 49, 49, 0.71);<br />
border-bottom-color: #777\9;<br />
// opacity: .3;<br />
filter: alpha(opacity=30); <br />
}<br />
<br />
#tabs a:hover,<br />
#tabs a:focus {<br />
border-bottom-color: #2ac7e1;<br />
opacity: 1;<br />
filter: alpha(opacity=100);<br />
}<br />
<br />
#tabs a:focus {<br />
outline: 0;<br />
}<br />
<br />
#tabs #current {<br />
z-index: 3;<br />
border-bottom-color: #3d3d3d;<br />
opacity: 1;<br />
filter: alpha(opacity=100); <br />
}<br />
#tab1,#tab2,#tab3,#tab4{<br />
font-size: 16px;<br />
line-height: 19px;<br />
font-family: Trebuchet MS;<br />
font-weight: 600;<br />
color: #ccc;<br />
}<br />
#tab1,#tab2,#tab3,#tab4 img{<br />
width: 100%;<br />
}<br />
/* ----------- */<br />
#content2 {<br />
background: none repeat scroll 0 0 #CCFF99;<br />
border-top: 2px solid #3d3d3d;<br />
padding: 2em;<br />
width :55%;<br />
margin-left: 25%;<br />
<br />
}<br />
<br />
#content2 h2,<br />
#content h3,<br />
#content p {<br />
margin: 0 0 15px 0;<br />
<br />
} <br />
<br />
</style><br />
<br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
td,th{<br />
border-style: solid; border-width: 1px;<br />
}<br />
.tit{<br />
color: #6AA33D;<br />
}<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #fcc;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial#">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: ;height: 200px;box-shadow: 4px 3px 25px #cff;"><br />
<h1></h1><br />
</div><br />
<br/><br />
<h2 style="font-family: 'Tangerine', serif;font-size: 48px; text-shadow: 4px 4px 4px #aaa; color: #38f;<br />
letter-spacing: 0.1em;<br />
word-spacing: 0.3em;<br />
font-weight: 700;<br />
width: 30%;<br />
line-height: 36px;<br />
margin: 0;<br />
margin-left: 20%;">Tutorial</h2><br/><br />
<ul id="tabs"><br />
<li><a href="#" name="#tab1">Neochr</a></li><br />
<li><a href="#" name="#tab2">NucleoMod</a></li><br />
<li><a href="#" name="#tab3">SegmMan</a></li><br />
<li><a href="#" name="#tab4">Others</a></li> <br />
</ul><br />
<div id="content2"><br />
<div id="tab1"><br />
<p class="tit">1. NeoChr </p><br />
<p><br />
NeoChr module would assist users to grab related genes in different pathways manually, to rewire genes’ relationship logically*, and to replace genes with ortholog that score higher*. Firstly, it would allow users to define gene order and orientation in DRAG&DROP way. Secondly, decoupled these genes if have overlap and make all genes are non-redundancy. Finally, add chromosome features to build a new chromosome and show in the JBrowse. Moreover, users can drag a window in the JBrowse and delete any gene in the window.<br/><br />
Note: <br/><br />
*These function are unavailable now, please wait for version 2.<br/><br />
**You can also add any thing here including your own water mark.<br/></p><br />
<p class="tit">2. Plugin Scripts </p><br />
<p>This module contains three plugins: Decouple.pl, Add.pl and Delete.pl.</p><br />
<p class="tit">2.1 Decouple.pl</p><br />
<p>This plugin is to decouple the genes which have overlap gene regions. These overlapping genes can be decoupled if meet the following conditions: (1)If two genes have overlap gene regions, the latter gene 5’UTR does not cover the former gene initial codon (ATG); (2)Overlapping region initial coordinate is in the coding DNA sequences(CDS) of gene which is need to be decoupled; (3)The decouple site of CDS have synonymous substitute codon to replace; After decoupling, we use these non-redundancy genes to generate a GFF file and a FASTA file.</p><br />
<p class="tit">2.1.1 Internal operation </p><br />
<p>First, this plugin extracts base sequence from the genome file according to the gene order list, and records the gene order in the list. And then plugin records the annotation information according to the specie GFF file, moreover, plugin extends gene CDS upstream 600bp as 5’-UTR and downstream 100bp as 3’-UTR if the GFF file does not contain annotated these two features.<br/><br />
Second, this plugin detects the overlapping genes in the same chromosome. In case the overlapping genes are detected, it will judge whether the overlapping initial site is located in the CDS region, and identify the site is belong to phase0/1/2.<br/><br />
Third, the plugin attempts to synonymous substitute codon to break the initial codon intra the CDS. Printing information whether or not be decoupled successfully, such as:<br/><br />
<img src="https://static.igem.org/mediawiki/2013/e/e0/T1-1.png" alt="data" style="width: 750px" /><br/><br />
And non-redundancy genes are generated.<br/><br />
Finally, the plugin links non-redundancy genes to construct a new chromosome according to the gene order.<br />
</p><br />
<p class="tit">2.2.1 Example</p><br />
<p>We have two input forms to execute the plugin:<br/><br />
1. Using string format as gene order list input form:<br/><br />
perl GeneDecouple.pl --species saccharomyces_cerevisiae_chr --list_format string --gene_order="YAL054C -,YAL038W +,YBR019C -,YBR145W +,YCL040W +,YCR012W +,YCR105W +,YDL168W +,YPL017C -,YIL177C -,YIL177W-A +,YIL172C -,YIL171W-A +,” --geneset_dir ../gene_set --upstream_extend 600 --downstream_extend 100 --neo_chr_gff neochr.gff --neo_chr_fa neochr.fa<br/><br />
2. Using file format as gene order list input form:<br/><br />
erl GeneDecouple.pl --species saccharomyces_cerevisiae_chr --list_format file --gene_order gene_ordre.list --geneset_dir ../gene_set --upstream_extend 600 --downstream_extend 100 --neo_chr_gff neochr.gff --neo_chr_fa neochr.fa<br />
</p><br />
<p class="tit">2.1.3 Parameters </p><br />
<table border="1"><br />
<tr><br />
<th>Parameter</th><br />
<th>Description</th><br />
<th></th><br />
<th></th><br />
</tr><br />
<tr><br />
<th>list_format</th><br />
<th>set the input form of gene order list</th><br />
<th>string</th><br />
<th>string/file</th><br />
</tr><br />
<tr><br />
<th>gene_order</th><br />
<th>set the input gene order list file(include pathway genes and addition genes)</th><br />
<th></th><br />
<th></th><br />
</tr><br />
<tr><br />
<th>Parameter</th><br />
<th>Description</th><br />
<th>Default</th><br />
<th>Selectable range</th><br />
</tr><br />
<tr><br />
<th>geneset_dir</th><br />
<th>set the species annotation directory</th><br />
<th>600</th><br />
<th></th><br />
</tr><br />
<tr><br />
<th>upstream_extend</th><br />
<th>set the length of gene downstram(bp)</th><br />
<th>100</th><br />
<th></th><br />
</tr><br />
<tr><br />
<th>neo_chr_gff</th><br />
<th>set the name of output neochr gff file</th><br />
<th></th><br />
<th></th><br />
</tr><br />
<tr><br />
<th>neo_chr_fa</th><br />
<th>set the name of output neochr fasta file</th><br />
<th></th><br />
<th></th><br />
</tr><br />
<tr><br />
<th>help</th><br />
<th>Show help information</th><br />
<th></th><br />
<th></th><br />
</tr><br />
</table><br />
</p><br/><br />
<p class="tit">2.4.1 The format of output file</p><br />
<p>The output files are standard GFF and FASTA format files which are decoupled.<br/><br />
&nbsp;&nbsp;1. decoupled GFF file<br/><br />
<img src="https://static.igem.org/mediawiki/2013/e/e5/T1-2.png" alt="data" style="width: 750px" /><br/><br />
&nbsp;&nbsp;2.decoupled FASTA file<br/><br />
<img src="https://static.igem.org/mediawiki/2013/b/b2/T1-3.png" alt="data" style="width: 750px" /><br/><br />
<br />
<p class="tit">2.2 Add.pl </p><br />
<p>This plugin will add the LoxPsym sequence and the customized left and right telomeres, centromere and autonomously replicating sequence (ARS) into the FASTA file and GFF file which are generated by Decouple.pl.</p><br />
<p class="tit">2.2.1 Internal operation </p><br />
<p>The plugin adds LoxPsym behind the first 3bp of 3’-UTR in each gene and adds telomere, centromere and ARS according this mode:<br/><br />
<b>left_telomere + gene1 + centromere + gene2 + ARS + gene3 + right_telomere</b><br/><br />
The distance between centromere and ARS is less than 30Kb.<br/><br />
Finally, user can see the new added features chromosome according to the JBrowse.<br />
</p><br />
<p class="tit">2.2.2 Example </p><br />
<p>perl 04.Add.pl --loxp loxPsym.feat --left_telomere UTC_left.feat --right_telomere UTC_right.feat --ars chromosome_I_ARS108.feature --centromere chromosome_I_centromere.feat --chr_gff neochr.gff --chr_seq neochr.fa --neochr_seq neochr.final.fa --neochr_gff neochr.final.gff<br/><br/><br />
All the feature file format is 4 lines format, for example:<br/><br />
&nbsp;&nbsp;name = site_specific_recombination_target_region<br/><br />
&nbsp;&nbsp;type = loxPsym<br/><br />
&nbsp;&nbsp;source = BIO<br/><br />
&nbsp;&nbsp;sequence = ATAACTTCGTATAATGTACATTATACGAAGTTAT<br/><br />
Note: the first line is the detail name of feature, the second line is the type of feature, the third line is the source of feature and the last line is the sequence of feature.<br />
</p><br />
<p class="tit">2.2.3 Parameters</p><br />
<pre><br />
Parameter Description Default Selectable range<br />
loxp set the sequence of loxp ATAACTTCGTATAATGTATGCTATACGAAGTTAT <br />
left_telomere set the sequence of left telomere <br />
right_telomere set the sequence of right telomere <br />
chr_gff set the input neorchr_gff file <br />
chr_seq set the input neorchr_gff file <br />
neochr_seq set the name of output added loxps and telomeres neochr_fa file <br />
neochr_gff set the name of output added loxps and telomeres neochr_gff file <br />
</pre><br />
<br />
<p class="tit">2.2.4 The format of output</p><br />
<p>The output files are standard GFF and FASTA format of adding features chromosome.<br/><br />
1. added features GFF file<br/><br />
<img src="https://static.igem.org/mediawiki/2013/e/e0/T1-4.png" alt="data" style="width: 750px" ></a><br />
</p><br />
<br />
<p class="tit">2.3 Delete.pl </p><br />
<p>This plugin can modify the GFF and FASTA file which are generated by Add.pl according to the user drags a window in the JBrowse and delete any gene in the window.</p><br />
<p class="tit">2.3.1 Internal operation </p><br />
<p>Firstly, user uses mouse to drag a window in the added features FASTA file which is showed in the JBrowse and JBrowse displays all the genes in this window.Secondly, user decides which genes is need to be delected from the new chromosome and plugin deletes genes from GFF file and modify FASTA in the same time.</p><br />
<p class="tit">2.3.2 Example </p><br />
<p>perl 05.delete.pl --delete="YAL054C,YAL038W" --neochr_gff neochr.refine.final.gff --neochr_fa neochr.refine.final.fa --slim_gff neochr.refine.delete.gff --slim_fa neochr.refine.delete.fa </p><br />
<p class="tit">2.3.3 Parameters </p><br />
<p><pre><br />
Parameter Description Default Selectable range<br />
delete Set the to be deleted gene list <br />
neochr_gff Set the input GFF file which is generated by Add.pl <br />
neochr_fa Set the input FASTA file which is generated by Add.pl <br />
slim_gff Set the output GFF file <br />
slim_fa Set the output FASTA file </pre></p><br />
<br />
<p class="tit">2.3.4 The format of ouput</p><br />
<p>The output files are standard GFF and FASTA format of deleted genes chromosome.</p><br />
<br />
</div><br />
<div id="tab2"><br />
<p class="tit">1. NucleoMod </p><br />
<p>NucleoMod can modify CDS based on synonymous mutation. It has 5 applications. Firstly, NucleoMod is used to design CRISPR sites on NeoChr so that we can silence the wild type genes. Secondly, it can erase specific enzyme sites according to the users' selection. Thirdly, users can create an enzyme site in selected region of specific genes. Fourthly, it can optimize the codon efficiency to increase the expression level. Finally, it can smash the tandem repeat bases to reduce the synthesis difficulty.</p><br />
<p class="tit">2. Plugins</p><br />
<p>This module contains 5 plugins: CRISPR design, erase enzyme site, create enzyme site, codon optimization, repeat smash. All plugins are included in the main program.</p><br />
<p class="tit">2.1 CRISPR design</p><br />
<p>This plugin is used to design CRISPR site of NeoChr genes so that we can silence the wild type genes. We use blast+ to ensure the uniqueness of CRISPR sites. If you are using more than one plugin at the same time, this plugin will start firstly and deliver the data to next plugin. Otherwise it will generate a new fasta file for sequence and gff file for annotation.</p><br />
<p class="tit">2.1.1 Internal operation</p><br />
<p>First, this plugin extracts sequence and annotation from the NeoChr FASTA file and GFF3 file, respectively. Regular expression will be applied to find the 23bp basic structure of CRISPR site, with a head of ‘G’ then following 20 facultative bases and finally followed by ‘GG’. All the sequences and locus will be record in an array. <br/><br />
Second, the blast+ will be used to check whether the 12bp sequences (from 9th to 20th) are uniq in the wild type genome. Only uniq sites will be reserved. <br/><br />
Third, synonymous substitution method will be applied to change one base between the 9th to 20th bases of the CRISPR structure. The result will be record in GFF as an element of gene. If –verbose is set, the designed number will be report in STDOUT.<br/><br />
Finally, if this plugin is the last module, the sequence and annotation information will be recreated in FASTA and GFF format.</p><br />
<p class="tit">2.1.2 Example</p><br />
<p>We have two input forms to execute the plugin:<br/><br />
Run CRISPR design plugin only:<br/><br />
perl NucleoMod.pl -inputfa NeoChr.fa -inputgff NeoChr.gff -outputgff new_annotation.gff -outputfa new_chr.fa -crisprnum 2 -database saccharomyces_cerevisiae_chr.fa</p><br />
<p class="tit">2.1.3 Parameters</p><br />
<table><br />
<tr><td>Parameter</td><td>Description</td><td>Default</td><td>Selectable range</td></tr><br />
<tr><td>inputfa</td><td>The NeoChr sequence file in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>inputgff</td><td>The NeoChr annotation file in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputgff</td><td>Output of new chromosome annotation in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputfa</td><td>Output of new chromosome sequence in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>verbose</td><td>Output the detailed information in STDOUT</td><td>none</td><td>option</td></tr><br />
<tr><td>crisprnum</td><td>Number of CRISPR site to be design per gene</td><td></td><td>Int (>0)</td></tr><br />
<tr><td>database</td><td>The sequence of reference genome, used as blast+ database</td><td></td><td>string</td></tr><br />
<tr><td>help</td><td>Show help information</td><td></td><td></td></tr><br />
</table><br />
<p class="tit">2.1.4 The format of output file</p><br />
<p>The output files are standard GFF and FASTA format files.<br/><br />
1. GFF file<br/><br />
<img src="https://static.igem.org/mediawiki/2013/2/26/T2-1.png" /><br/><br />
2. FASTA file<br/><br />
<img src="https://static.igem.org/mediawiki/2013/d/df/T2-2.png" /><br/><br />
3. Detailed information in STDOUT<br/><br />
<img src="https://static.igem.org/mediawiki/2013/f/fb/T2-3.png" /><br />
</p><br />
<p class="tit">2.2 Erase enzyme site</p><br />
<p>Given a list of restriction enzyme information, this plugin will erase the restriction sites in every gene. If you are using more than one plugin at the same time, this plugin will start after CRISPR design and deliver the data to next plugin. Otherwise it will generate a new fasta file for sequence and gff file for annotation.</p><br />
<p class="tit">2.2.1 Internal operation</p><br />
<p>The enzyme information will be extracted. (If the –borbrickstandard parameter is set, it will also remove EcoRI, XbaI, SpeI, PstI and NotI) The recognize site will be reformatted to regular expression and searched in the CDS regions.<br />
Once a restriction site is matched, synonymous substitution method will be applied to try to erase the enzyme site. When the substitution is finished, the plugin will restart the next search from 1 base after the last matched position.<br />
If this plugin is the last module, the sequence and annotation information will be recreated in FASTA and GFF format.</p><br />
<p class="tit">2.2.2 Example</p><br />
<p>perl NucleoMod.pl -inputfa NeoChr.fa -inputgff NeoChr.gff -outputgff new_annotation.gff -outputfa new_chr.fa –biobrickstandard [-delenzymelist enzyme.list ]<br/><br />
<br/><br />
Format of enzyme.list:<br/><br />
Company enzyme_name enzyme_site …<br/><br />
Eg. NEB BamHI G/GATCC</p><br />
<p class="tit">2.2.3 Parameters</p><br />
<table><br />
<tr><td>Parameter</td><td>Description</td><td>Default</td><td>Selectable range</td></tr><br />
<tr><td>inputfa</td><td>The NeoChr sequence file in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>inputgff</td><td>The NeoChr annotation file in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputgff</td><td>Output of new chromosome annotation in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputfa</td><td>Output of new chromosome sequence in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>verbose</td><td>Output the detailed information in STDOUT</td><td>none</td><td>option</td></tr><br />
<tr><td>biobrickstandard</td><td>Erase the biobrick standard enzyme site</td><td>none</td><td>option</td></tr><br />
<tr><td>delenzymelist</td><td>The file of enzyme going to delete</td><td></td><td>string</td></tr><br />
<tr><td>detail</td><td>Show the erased enzyme site in new gff</td><td>none</td><td>option</td></tr><br />
<tr><td>help</td><td>Show help information</td><td></td><td></td></tr><br />
<br />
</table><br />
<p class="tit">2.2.4 The format of output</p><br />
<p>The output files are standard GFF and FASTA format.<br/><br />
1. GFF file<br/><br />
<br />
2. FASTA file<br/><br />
<br />
3. Detailed information in STDOUT<br/><br />
<img src="https://static.igem.org/mediawiki/2013/e/ea/T2-4.png" /><br/><br />
</p><br />
<p class="tit">2.3 Create enzyme site</p><br />
<p>Given a list of restriction enzyme information, this plugin can create a new enzyme site in specific region of selected gene. If you are using more than one plugin at the same time, this plugin will start after erase enzyme site and deliver the data to next plugin. Otherwise it will generate a new fasta file for sequence and gff file for annotation.</p><br />
<p class="tit">2.3.1 Internal operation</p><br />
<p>First, information of enzyme site will be extracted. According to 3 reading frames, a searching tree will be constructed and converted to regular expression. <br />
The plugin will search the selected regions and then change the sequence to enzyme site by synonymous substitution method.<br />
If this plugin is the last module, the sequence and annotation information will be recreated in FASTA and GFF format.</p><br />
<p class="tit">2.3.2 Example</p><br />
<p>perl NucleoMod.pl -inputfa NeoChr.fa -inputgff NeoChr.gff -outputgff new_annotation.gff -outputfa new_chr.fa -addenzymelist enzyme.list -addenzymeconfig gene_id,start_pos,end_pos,enzyme_name</p><br />
<p class="tit">2.3.3 Parameters</p><br />
<p><br />
<table><br />
<tr><td>Parameter</td><td>Description</td><td>Default</td><td>Selectable range</td></tr><br />
<tr><td>inputfa</td><td>The NeoChr sequence file in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>inputgff</td><td>The NeoChr annotation file in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputgff</td><td>Output of new chromosome annotation in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputfa</td><td>Output of new chromosome sequence in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>verbose</td><td>Output the detailed information in STDOUT</td><td>none</td><td>option</td></tr><br />
<tr><td>addenzymelist</td><td>The file of enzyme to get enzyme site information</td><td></td><td>string</td></tr><br />
<tr><td>addenzymeconfig</td><td>A array of string to specify enzyme and regions</td><td></td><td>string,int,int,string</td></tr><br />
<tr><td>help</td><td>Show help information</td><td></td><td></td></tr><br />
</table><br />
</p><br />
<p class="tit">2.3.4 The format of ouput</p><br />
<p>The output files are standard GFF and FASTA format.<br/><br />
1. GFF file<br/><br />
<br />
2. FASTA file<br/><br />
<br />
3. Detailed information in STDOUT<br/><br />
<img src="https://static.igem.org/mediawiki/2013/7/75/T2-5.png" /><br/><br />
<br />
</p><br />
<p class="tit">2.4 Codon optimization</p><br />
<p>Given a codon priority list, this plugin is used to optimize the codon so that we can increase the expression of selected genes. If you are using more than one plugin at the same time, this plugin will start after create enzyme site and deliver the data to next plugin. Otherwise it will generate a new fasta file for sequence and gff file for annotation.</p><br />
<p class="tit">2.4.1 Internal operation</p><br />
<p>The codon with same amino acid will be separated into 3 ranks, best normal and worst. Every codon of selected gene will be check whether the codon is in best rank. The codon in normal or worst will be change to best rank by synonymous substitution method.<br />
If this plugin is the last module, the sequence and annotation information will be recreated in FASTA and GFF format.</p><br />
<p class="tit">2.4.2 Example</p><br />
<p>perl NucleoMod.pl -inputfa NeoChr.fa -inputgff NeoChr.gff -outputgff new_annotation.gff -outputfa new_chr.fa -codonoptimize CodonPriority.txt -optimizeallgene [-optimizegenelist gene1,gene2,gene3 ]</p><br />
<p class="tit">2.4.3 Parameters</p><br />
<p><br />
<table><br />
<tr><td>Parameter</td><td>Description</td><td>Default</td><td>Selectable range</td></tr><br />
<tr><td>inputfa</td><td>The NeoChr sequence file in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>inputgff</td><td>The NeoChr annotation file in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputgff</td><td>Output of new chromosome annotation in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputfa</td><td>Output of new chromosome sequence in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>verbose</td><td>Output the detailed information in STDOUT</td><td>none</td><td>option</td></tr><br />
<tr><td>codonoptimize</td><td>Codon priority list to get the ranking information</td><td></td><td>string</td></tr><br />
<tr><td>optimizeallgene</td><td>Optimize all genes in inputgff</td><td></td><td>option</td></tr><br />
<tr><td>optimizegenelist</td><td>A list of gene going to optimize, separate by comma</td><td></td><td>string,string,string,...</td></tr><br />
<tr><td>detail</td><td>Show the optimization sequence in new gff</td><td>none</td><td>option</td></tr><br />
<tr><td>help</td><td>Show help information</td><td></td><td></td></tr><br />
</table><br />
</p><br />
<p class="tit">2.4.4 The format of ouput</p><br />
<p>The output files are standard GFF and FASTA format.<br/><br />
1. GFF file<br/><br />
2 .FASTA file<br/><br />
3. Detailed information in STDOUT<br/><br />
<img src="https://static.igem.org/mediawiki/2013/a/a2/T2-6.png" /><br />
</p><br />
<p class="tit">2.5 Repeat smash</p><br />
<p>This plugin go through the CDS region to find out the tandem repeat bases. Synonymous substitution method will be applied to break long tandem repeat base to reduce the synthesis difficulty. If you are using more than one plugin at the same time, this plugin will start finally and then it will generate a new fasta file for sequence and gff file for annotation.</p><br />
<p class="tit">2.5.1 Internal operation</p><br />
<p>Regular expression is used to find out the tandem repeat bases longer then specified length (usually longer than 5bp). From the third of the matched sequence, synonymous substitution method will be applied to break the tandem repeat bases. <br />
If the substitution is successful and the rest sequence is still longer than the cutoff, then it will move to next 3 bases and do the same thing. <br />
The sequence and annotation information will be recreated in FASTA and GFF format.</p><br />
<p class="tit">2.3.2 Example</p><br />
<p>perl NucleoMod.pl -inputfa NeoChr.fa -inputgff NeoChr.gff -outputgff new_annotation.gff -outputfa new_chr.fa -repeatsmash 5</p><br />
<p class="tit">2.3.3 Parameters</p><br />
<p><br />
<table><br />
<tr><td>Parameter</td><td>Description</td><td>Default</td><td>Selectable range</td></tr><br />
<tr><td>inputfa</td><td>The NeoChr sequence file in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>inputgff</td><td>The NeoChr annotation file in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputgff</td><td>Output of new chromosome annotation in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputfa</td><td>Output of new chromosome sequence in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>verbose</td><td>Output the detailed information in STDOUT</td><td>none</td><td>option</td></tr><br />
<tr><td>repeatsmash</td><td>The tandem repeat bases longer or equal to this cutoff will be smashed</td><td></td><td>int</td></tr><br />
<tr><td>detail</td><td>Show the repeat smash result in new gff</td><td>none</td><td>option</td></tr><br />
<tr><td>help</td><td>Show help information</td><td></td><td></td></tr><br />
</table><br />
</p><br />
<p class="tit">2.3.4 The format of ouput</p><br />
<p><br />
The output files are standard GFF and FASTA format.<br/><br />
1. GFF file<br/><br />
2. FASTA file<br/><br />
3. Detailed information in STDOUT<br/><br />
<img src="https://static.igem.org/mediawiki/2013/8/83/T2-7.png" /><br />
</p><br />
<br />
</div><br />
<div id="tab3"><br />
<p class="tit">3. SegmMan </p><br />
<p>This module will cut chromosome into pieces with different sizes with Gibson, Goldengate, Homologous adaptors to them so that they are able to be assembled into whole experimentally.</p><br />
<p class="tit">Plugin Scripts</p><br />
<br/><br />
<p class="tit">3-1. 01.whole2mega.pl</p><br />
<p>This utility can split the whole chromosome ( at least 90kbp long ) into about 30k segments and add homologous overlap and adaptors, so that these fragments can be integrated into whole experimentally.</p><br />
<p class="tit">Internal operation</p><br />
<p>First, this utility searches for the location of centromere and ARSs (autonomously replicating site). The minimal distance between centromere and ARS should NOT be larger than a defined megachunk which is about 30k long. <br/><br />
Second, this utility cuts out the first 30k sequence window containing the centromere and its adjacent ARS, and then adds this megachunk with two original markers and left, right telomeres.<br/><br />
Thirdly, this utility continues to cut more megachunks from the original one to both ends. But these megachunks are not independent, they all have about 1kbp overlaps. Moreover, these new splited window can be given only one marker alternately and only left or right telomere.<br/><br />
The output file will be dealed with 02.globalREmarkup.pl<br/><br />
For more information about segmentation design, please refer to the page ASSEMBLY DESIGN PRINCIPLE .</p><br />
<p class="tit">Example (command line)</p><br />
<p>perl 01.whole2mega.pl –gff sce_chrI.gff -fa sce_chr01.fa -ol 1000 -ck 30000 -m1 LEU2 -m2 URA3 -m3 HIS3 -m4 TRP1 -ot sce_chrI.mega</p><br />
<p class="tit">Parameters</p><br />
<table><tbody><br />
<tr><td></td><td></td><td>default</td><td>Option</td></tr><br />
<tr><td>gff</td><td>The gff file of the chromosome being restriction enzyme sites parsing</td><td></td><td></td></tr><br />
<tr><td>fa</td><td>The fasta file of the chromosome being restriction enzyme sites parsing<br />
(The length of the chromosome is larger than 90k)</td><td></td><td></td></tr><br />
<tr><td>ol</td><td>The length of overlap between megachunks</td><td>1000bp</td><td></td></tr><br />
<tr><td>ck</td><td>The length of megachunks</td><td>30kbp</td><td></td></tr><br />
<tr><td>m1</td><td>The first marker for selection alternately</td><td>LEU2 (1797bp)</td><td>LEU2/URA3HIS3/TRP1</td></tr><br />
<tr><td>m2</td><td>The second marker for selection alternately<br />
</td><td>URA3 (1112bp)</td><td>LEU2/URA3/HIS3/TRP1</td></tr><br />
<tr><td>m3</td><td>The first marker orinally residing in first 30k segmentation</td><td>HIS3 (1774bp)</td><td>LEU2/URA3/HIS3/TRP1</td></tr><br />
<tr><td>m4</td><td>The second marker orinally residing in first 30k segmentation</td><td>TRP1 (1467bp)</td><td>LEU2/URA3/HIS3/TRP1</td></tr><br />
<tr><td>ot</td><td>The output file </td><td>Prefix(fa filename)+ suffix(.mega)</td><td></td></tr><br />
</tbody></table><br />
<br />
<p class="tit">The format of output:</p><br />
<p>The output file is stored in /the path where you install GENOVO/Result/ 01.whole2mega.<br/><br />
Besides, there is screen output about the process state and result.<br/><br />
1. Screen output<br/><br />
2. 01.state <br/><br />
&nbsp;Store the segmentation information<br/><br />
<table><tbody><br />
<tr><td>Megachunk_ID</td><td>Corresponding location in the designed chromosome</td></tr><br />
<tr><td>Part ID</td><td>Location in the segmentation</td></tr><br />
</tbody></table><br />
<img src="https://static.igem.org/mediawiki/2013/c/c1/T3-1.png" /><br/><br />
3 *.mega<br/><br />
&nbsp;Store the fasta information of the 30k segments<br/><br />
<img src="https://static.igem.org/mediawiki/2013/f/f0/T3-2.png" /><br />
</p><br />
<p class="tit">3-2. 02.globalREmarkup.pl</p><br />
<p>This utility will parse the exited restriction enzyme sites residing in the chromosome.</p><br />
<p class="tit">Internal operation</p><br />
<p>This utility searches the exited restriction enzyme sites along the chromosome both plus strand and minus strand, after users define the list of enzymes.<br/><br />
Besides, we tried to find out all the potential restriction enzyme sites, so that maybe some unusual restriction enzyme sites can be created and let segmentation go. But because it had low efficiency, we’re still working on that.<br/><br />
The output file will be dealed with 03.mega2chunk2mini.pl<br/><br />
For more information about segmentation design, please refer to the page ASSEMBLY DESIGN PRINCIPLE .<br />
</p><br />
<p class="tit">Example (command line)</p><br />
<p>perl 02.globalREmarkup.pl -sg 01.whole2mega/sce_chrI.mega -re standard_and_IIB -ct Standard.ct –ot sce_chrI.mega.parse</p><br />
<p class="tit">Parameters</p><br />
<p><br />
<table><tbody><br />
<tr><td></td><td></td><td>default</td><td>Option</td></tr><br />
<tr><td>sg</td><td>The fasta file of the 30k segmentation, the output of 01.wh2mega.pl</td><td></td><td></td></tr><br />
<tr><td>ps</td><td>The markup file of the 30k segmentation, the output of 02.globalREmarkup.pl</td><td></td><td></td></tr><br />
<tr><td>re</td><td>The restriction enzyme sites list. It is devided by different standards, type (IIP, IIA, IIB), cost (standard, nonexpensive) and etc.</td><td>Standard_and_IIB</td><td>IIP/IIA/IIB/Standard/<br />
Nonexpensive/<br />
Standard_IIB<br />
Nonexpensive_IIB</td></tr><br />
<tr><td>a2</td><td>2k to 10k assembly strategy (Gibson or Goldengate)</td><td>Gibson</td><td>Gibson/ Goldengate</td></tr><br />
<tr><td>a10</td><td>10k to 30k assembly strategy (Gibson or Goldengate)</td><td>Goldengate</td><td>Gibson/ Goldengate</td></tr><br />
<tr><td>ckmax2</td><td>The maximum length of minichunks</td><td>2200 bp</td><td></td></tr><br />
<tr><td>ckmin2</td><td>The minimum length of minichunks </td><td>1800 bp</td><td></td></tr><br />
<tr><td>cknum</td><td>The number of minichunks in a chunk</td><td>5</td><td></td></tr><br />
<br />
</tbody></table><br />
Codon table list:<br/><br />
1 The Standard Code<br/><br />
2 The Vertebrate Mitochondrial Code<br/><br />
3 The Yeast Mitochondrial Code<br/><br />
4 The Mold, Protozoan, and Coelenterate Mitochondrial Code and the Mycoplasma/Spiroplasma Code<br/><br />
5The Invertebrate Mitochondrial Code<br/><br />
6 The Ciliate, Dasycladacean and Hexamita Nuclear Code<br/><br />
7 The Echinoderm and Flatworm Mitochondrial Code<br/><br />
8 The Euplotid Nuclear Code<br/><br />
9 The Bacterial, Archaeal and Plant Plastid Code<br/><br />
10 The Alternative Yeast Nuclear Code<br/><br />
11 The Ascidian Mitochondrial Code<br/><br />
12 The Alternative Flatworm Mitochondrial Code<br/><br />
13 Blepharisma Nuclear Code<br/><br />
14 Chlorophycean Mitochondrial Code<br/><br />
15 Trematode Mitochondrial Code<br/><br />
16 Scenedesmus Obliquus Mitochondrial Code<br/><br />
17 Thraustochytrium Mitochondrial Code<br/><br />
18 Pterobranchia Mitochondrial Code<br/><br />
19 Candidate Division SR1 and Gracilibacteria Code<br/><br />
</p><br />
<p class="tit">The format of utput</p><br />
<p>The output file is stored in /the path where you install GENOVO/Result/. 02.globalREmarkup.<br/><br />
Besides, there is screen output about the process state and result.<br/><br />
1. Screen output<br/><br />
2. *.parse<br/><br />
Store the exited enzyme recognition site in the megachunks<br/><br />
Enzyme ID Start End Recognition site Real site<br/><br />
<img src="https://static.igem.org/mediawiki/2013/b/bf/T3-3.png" /><br />
</p><br />
<p class="tit">3-3. 03.chunk_30k_10k_2k.pl</p><br />
<p>This utility can produce 2k minichunks with Gibson adaptors and 10k chunks with goldengate adaptors.</p><br />
<p class="tit">Internal operation</p><br />
<p>This utility will segmentate the megachunk produced by 03.mega2chunk2mini.pl into 2k minichunks with Gibson assembly adaptors, so that they can be put together into 10k chunks.<br/><br />
First, this bin will search the inexistent restriction enzyme sites locally, and then decide the size of the minichunks according to the requirements from users, and add two same Gibson adaptors to each sides of minichunks.<br />
Secondly, the second part of this bin will define the start and end point of the chunks as users asked and design goldengate assembly adaptors for the chunks.<br/><br />
The output file can be sent in gene synthesis company after human attention and double check.<br/><br />
For more information about segmentation design, please refer to the page ASSEMBLY DESIGN PRINCIPLE .</p><br />
<p class="tit">Example (command line)</p><br />
<p>perl 03.mega2chunk2mini.pl -re standard_and_IIB -sg 01.whole2mega/sce_chr01_0.mega -ps 02.globalREmarkup/sce_chr01_0.parse -ot 03.mega2chunk2mini</p><br />
<p class="tit">Parameters</p><br />
<p><br />
<table><tbody><br />
<tr><td></td><td></td><td>default</td><td>Option</td></tr><br />
<tr><td>sg</td><td>The fasta file of the 30k segmentation, the output of 01.wh2mega.pl</td><td></td><td></td></tr><br />
<tr><td>ps</td><td>The markup file of the 30k segmentation, the output of 02.globalREmarkup.pl</td><td></td><td></td></tr><br />
<tr><td>re</td><td>The restriction enzyme sites list. It is devided by different standards, type (IIP, IIA, IIB), cost (standard, nonexpensive) and etc.</td><td>Standard_and_IIB</td><td>IIP/IIA/IIB/Standard/<br />
Nonexpensive/<br />
Standard_IIB<br />
Nonexpensive_IIB</td></tr><br />
<tr><td>a2</td><td>2k to 10k assembly strategy (Gibson or Goldengate)</td><td>Gibson</td><td>Gibson/ Goldengate</td></tr><br />
<tr><td>a10</td><td>10k to 30k assembly strategy (Gibson or Goldengate)</td><td>Goldengate</td><td>Gibson/ Goldengate</td></tr><br />
<tr><td>ckmax2</td><td>The maximum length of minichunks</td><td>2200 bp</td><td></td></tr><br />
<tr><td>ckmin2</td><td>The minimum length of minichunks </td><td>1800 bp</td><td></td></tr><br />
<tr><td>cknum</td><td>The number of minichunks in a chunk</td><td>5</td><td></td></tr><br />
<br />
</tbody><br />
</table><br />
If parameter a2 is Gibson, then there are additional parameters:<br/><br />
<table><tbody><br />
<tr><td>ol2</td><td>The length of overlap</td><td>40 bp</td><td></td></tr><br />
<tr><td>tmax2</td><td>The maximum melting temperature of the overlap of minichunks</td><td>60℃</td><td></td></tr><br />
<tr><td>tmin2</td><td>The minimum melting temperature of the overlap of minichunks</td><td>56℃</td><td></td></tr><br />
<tr><td>fe2</td><td>The minimum free energy of the overlap of minichunks</td><td>-3</td><td></td></tr><br />
<tr><td>ex2</td><td>The type of exonuclease used for minichunks</td><td>T5</td><td>T5/T3</td></tr><br />
<tr><td>lo2</td><td>The minimum distance between minichunks overlap and loxpsym</td><td>40 bp</td><td></td></tr><br />
<tr><td>en2</td><td>The type of enzyme flanking minichunks</td><td>IIP</td><td></td></tr><br />
<tr><td>et2</td><td></td><td></td><td></td></tr><br />
<tr><td>ep2</td><td>The maximum unit price of enzyme used in minichunks digestion</td><td>0.5 $/unit</td><td></td></tr><br />
<br />
</tbody><br />
</table><br />
If parameter a10 is Goldengate, then there are additional parameters:<br/><br />
<table><tbody><br />
<tr><td>en10</td><td>The type of enzyme flanking chunks</td><td>IIB</td><td>IIA/IIB</td><tr><br />
<tr><td>et10</td><td>The temperature of enzyme used in chunks digestion</td><td>37℃</td><td></td></tr><br />
<br />
</tbody><br />
</table><br />
</p><br />
<p class="tit">The format of ouput</p><br />
<p>The output file is stored in /the path where you install GENOVO/Result/. 03.mega2chunk2mini.<br/><br />
Besides, there is screen output about the process state and result.<br/><br />
1. Screen output<br/><br />
2. *.2kstate<br/><br />
Store the minichunks states.<br/><br />
<table><tr><td>Left IIP enzyme site</td><td>Right IIP enzyme site</td><td>Start</td><td>End</td><td>Size of minichunks</td><td>Melting temperature of overlap</td></tr><br />
</table><br />
<img src="https://static.igem.org/mediawiki/2013/b/bf/T3-3.png" /><br/><br />
3. *.10kstate<br/><br />
Store the chunks states<br/><br />
<table><br />
<tr><td>Left IIB enzyme site</td><td>Right IIB enzyme site</td><td>Start</td><td>End</td>Size of chunks<td></td></tr><br />
</table><br />
<img src="https://static.igem.org/mediawiki/2013/a/ad/T3-4.png" /><br/><br />
4. *.mini<br/><br />
Store the fasta of designed minichunks.<br/><br />
<img src="https://static.igem.org/mediawiki/2013/0/0f/T3-5.png" /><br/><br />
</p><br />
<br />
<br />
</div><br />
<div id="tab4"><br />
<p class="tit">Presentation from KGML</p><br />
<p> This module will grab genes’ details in different pathways, which from KEGG with KEGG Makeup Language (KGML) file and export genes list and relationship of genes. The goal here is to visualize the pathway and rebuild it in the level of genes.</p><br />
<p class="tit">Scripts<br/>1. keggid_convert_gene.pl</p><br />
<p> This utility can convert KEGGID which in KGML file into genes’ name and rewrite KGML file.</p><br />
<p class="tit">Internal operation</p><br />
<p> First, this utility will change the pathway’s name into KEGG database names, and then open the file with the entire list of genes, push them in hash.<br/><br />
Second, this utility will read the original pathway’s xml file in and replace KEGGID with gene’s name one by one. Furthermore, it will change type element all into “gene”.<br/><br />
Thirdly, it will be the substitution of original pathway’s xml file.</p><br />
<p class="tit">Example</p><br />
<p> perl keggid_convert_gene.pl ko04010</p><br />
<p class="tit">The format of output:</p><br />
<p>It will rewrite the original pathway’s xml file, if we have following statement:<br/><br />
<entry id="30" name="ko:K08018" type="ortholog"<br/><br />
After running this scripts, it will turn into:<br/><entry id="30" name=" RAPGEF2, PDZGEF1" type="gene" </p><br />
<p class="tit">convert.py</p><br />
<p> This utility will read in KGML file which have been rewritten before, and grab genes’ information, such as genes’ name, genes’ relationship and then convert these into JSON.</p><br />
<p class="tit">Internal operation</p><br />
<p> First, this utility will use the parameter –f to determine the specified file and read it in. The output file will use the file name that put forward.<br/><br />
Second, this utility convert KGML file into JSON and grab the information of genes, such as the reactions of genes and the relationship between genes.<br/><br />
Third, this utility continue to integrate the information above into two files, ‘gene.json’ and ‘relation.json’, which can be use directly in rewrite gene’s pathway.</p><br />
<p class="tit">Example</p><br />
<p> python convert.py –f sce04111</p><br />
<p class="tit">Parameters:</p><br />
<table border='1'><tbody><br />
<tr><td></td><td>default</td></tr><br />
<tr><td>-f/--file</td><td>read KGML from FILENAME(omit '.xml'), produce two files: gene list and relation</td></tr><br />
</tbody></table><br />
<p class="tit">The format of output:</p><br />
<p>The output file is stored in the path where you running this program.<br/><br />
1. _gene.json <br/><br />
<img src="https://static.igem.org/mediawiki/2013/1/1b/T4-1.png" /><br />
type:<br/><br />
<table><tbody><br />
<tr><td>ortholog</td><td>KO (orthology group)</td></tr><br />
<tr><td>enzyme</td><td>Enzyme</td></tr><br />
<tr><td>reaction</td><td>Reaction</td></tr><br />
<tr><td>gene</td><td>gene product (mostly a protein)</td></tr><br />
<tr><td>group</td><td>a complex of gene products (mostly a protein complex)</td></tr><br />
</tbody></table><br />
geneID:the unique identification of gene<br/><br />
<table><tbody><br />
<tr><td>name</td><td>the KEGGID of this gene </td></tr><br />
<tr><td>type</td><td>the type of this gene</td></tr><br />
</tbody></table><br />
reaction:<br/><br />
<table><tbody><br />
<tr><td>name</td><td>the KEGGID of this reaction</td></tr><br />
<tr><td>reversible</td><td>true: reversible reaction; false: irreversible reaction</td></tr><br />
<tr><td>substrates</td><td>KEGGID of substrate node</td></tr><br />
<tr><td>products</td><td>the KEGGID of product node</td></tr><br />
<tr><td>related-reactions</td><td>relate to another pathway or gene</td></tr><br />
</tbody></table><br />
2. _relation.json<br />
<img src="https://static.igem.org/mediawiki/2013/c/c1/T4-2.png" /><br />
relations:<br/><br />
<table><tbody><br />
<tr><td>type</td><td>The type of this relation[ ECrel, PPrel. GErel, PCrel, maplink]</td></tr><br />
<tr><td>subtype</td><td>Interaction/relation information[activation/inhibition]</td></tr><br />
<tr><td>entry1</td><td>The first (from) entry that defines this relation</td></tr><br />
<tr><td>entry2</td><td>The second (to) entry that defines this relation</td></tr><br />
</tbody></table><br />
entry1&2:<br/><br />
<table><tbody><br />
<tr><td>entry ID</td><td>The KEGGID of node which takes part in this relation</td></tr><br />
<tr><td>type</td><td>Have only two options: [gene/group]</td></tr><br />
<tr><td>name</td><td>The KEGGID of this gene</td></tr><br />
<tr><td>group</td><td>The node is a complex of gene products (mostly a protein complex)</td></tr><br />
</tbody></table><br />
</p><br />
<br/> <p class="tit">Shortcoming</p><br />
<p>We can’t automatic acquisition KGML file in the KEGG API, all the demo we have show need to be downloaded before. You can get the entire list of one database genes through KEGG API, just like http://rest.kegg.jp/list/ko , it shows the entire list of orthology genes. The download method about KGML files shows in “How to finish this plun-in” part.<br />
Some genes will relate to another pathway but it doesn’t shows in the pathway so we are failed to grab the relationships between genes and pathways automatically. So we added two gene-pathway relations in ko04010 demo manually, TP53 gene connected with ko04115: P53 signaling pathway and NLK gene connected with ko04310: WNT signaling pathway.<br />
We look forward to the improvement of this plun-in through these disadvantages. </p><br />
<p class="tit">How to finish this plun-in?</p><br />
<p> KEGG is a database resource for understanding high-level functions and utilities of the biological system, and KGML is an XML presentation of the KEGG pathway database, which enables automatic drawing of KEGG pathways and provides facilities for computational analysis and modeling of gene/protein networks and chemical networks. Here is the data structure of KGML.<br/> <br />
<img src="https://static.igem.org/mediawiki/2013/f/fa/T4-3.png" /><br />
It’s really complex and it will bother you to understand the KGML file! Do not worry, I will show you how to understand a KGML file and then how to convert it into JSON.<br/> <br />
First, how to find or download KGML file?<br/> <br />
Method: <br/> <br />
Download KGML" link for each pathway map.<br/> <br />
If you choose a pathway with prefix “map”, you can’t find the download link in the page, that’s <br />
because it can be generating almost ko/rn/ec/org files. <br/> <br />
Such as “map04111”, it has no link for download. But if you change the “map” into “sce” in<br />
the URL, you can get the file.<br/> <br />
<a href="http://www.kegg.jp/kegg/rest/keggapi.html">KEGG API:</a><br />
Take “sce04111” as an example, you can download the KGML file via the <a href="http://rest.kegg.jp/get/sce04111/KGML">this</a>.<br/> <br />
Second, the KGML file is difficult to find out the relationship through the data structure show above.<br/> <br />
Here is the simple but straightforward tutorial to teach you how to understand a KGML file.<br/> <br />
Take “sce04111.xml” as an example. We can simplify the data structure as:<br/> <br />
<img src="https://static.igem.org/mediawiki/2013/c/c5/T4-4.png" /><br/><br />
The entry element can be path/ko/ec/rn/cpd/gl/org/group, enzyme/protein/gene will have relation and gene will also have compound and reactions. We choose one relation to be example:<br/> <br />
<img src="https://static.igem.org/mediawiki/2013/2/27/T4-5.png" /><br />
It means that gene (YCL061C) have activation effect in gene (YPL153C).By the way, through the graphics elements, we can definitely rewrite the connection between these two genes.<br/> <br />
<br />
Third, thought we know how to get KGML file and can understand it but the crucial problem is, how to grab the information of genes and convert it into JSON.<br/> <br />
Here we use Python programming Language, install the library “lxml” for processing XML and HTML, and we import JSON library for convert.<br/> <br />
<br />
Fourth, you may ask: If there have any other software to do such job, that is read KGML files, convert it and rewrite it? <br/> <br />
Of course, and we indeed tried but failed for it’s not open source or the original source is difficult for modification. <br />
Actually, if you want to do some visualize pathway job, Cytoscape is a good choice and it also have cytoscape.js for drawing.<br/> <br />
<br />
Finally, we indeed done plentiful preparatory work, maybe in the end it’s not useful in this software but it can expand our horizons. <br />
<br/> <br />
</p><br />
<br />
</div><br />
<br />
</div><br />
<br />
<script><br />
function resetTabs(){<br />
$("#content2 > div").hide(); //Hide all content<br />
$("#tabs a").attr("id",""); //Reset id's <br />
}<br />
<br />
var myUrl = window.location.href; //get URL<br />
var myUrlTab = myUrl.substring(myUrl.indexOf("#")); // For localhost/tabs.html#tab2, myUrlTab = #tab2 <br />
var myUrlTabName = myUrlTab.substring(0,4); // For the above example, myUrlTabName = #tab<br />
<br />
(function(){<br />
$("#content2 > div").hide(); // Initially hide all content<br />
$("#tabs li:first a").attr("id","current"); // Activate first tab<br />
$("#content2 > div:first").fadeIn(); // Show first tab content<br />
<br />
$("#tabs a").on("click",function(e) {<br />
e.preventDefault();<br />
if ($(this).attr("id") == "current"){ //detection for current tab<br />
return <br />
}<br />
else{ <br />
resetTabs();<br />
$(this).attr("id","current"); // Activate this<br />
$($(this).attr('name')).fadeIn(); // Show content for current tab<br />
}<br />
});<br />
<br />
for (i = 1; i <= $("#tabs li").length; i++) {<br />
if (myUrlTab == myUrlTabName + i) {<br />
resetTabs();<br />
$("a[name='"+myUrlTab+"']").attr("id","current"); // Activate url tab<br />
$(myUrlTab).fadeIn(); // Show url tab content <br />
}<br />
}<br />
})()<br />
</script><br />
<br/><br/><br/><br/><br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial
Team:Shenzhen BGIC 0101/Tutorial
2013-10-20T09:45:25Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<br />
<style><br />
img{<br />
width: 100%;<br />
}<br />
#tabs {<br />
overflow: hidden;<br />
width: 70%;<br />
margin: 0;<br />
margin-left: 25%;<br />
padding: 0;<br />
list-style: none;<br />
font-size: 1.3em;<br />
<br />
font-weight: 800;<br />
}<br />
<br />
#tabs li {<br />
float: left;<br />
margin: 0 -15px 0 0;<br />
}<br />
<br />
#tabs a {<br />
float: left;<br />
position: relative;<br />
padding: 0 40px;<br />
height: 0;<br />
line-height: 30px;<br />
<br />
text-decoration: none;<br />
color: #38f; <br />
border-right: 30px solid transparent;<br />
border-bottom: 30px solid rgba(54, 49, 49, 0.71);<br />
border-bottom-color: #777\9;<br />
// opacity: .3;<br />
filter: alpha(opacity=30); <br />
}<br />
<br />
#tabs a:hover,<br />
#tabs a:focus {<br />
border-bottom-color: #2ac7e1;<br />
opacity: 1;<br />
filter: alpha(opacity=100);<br />
}<br />
<br />
#tabs a:focus {<br />
outline: 0;<br />
}<br />
<br />
#tabs #current {<br />
z-index: 3;<br />
border-bottom-color: #3d3d3d;<br />
opacity: 1;<br />
filter: alpha(opacity=100); <br />
}<br />
#tab1,#tab2,#tab3,#tab4{<br />
font-size: 16px;<br />
line-height: 19px;<br />
font-family: Trebuchet MS;<br />
font-weight: 600;<br />
color: #ccc;<br />
}<br />
#tab1,#tab2,#tab3,#tab4 img{<br />
width: 100%;<br />
}<br />
/* ----------- */<br />
#content2 {<br />
background: rgba(29, 28, 28, 0.79);<br />
border-top: 2px solid #3d3d3d;<br />
padding: 2em;<br />
width :55%;<br />
margin-left: 25%;<br />
<br />
}<br />
<br />
#content2 h2,<br />
#content h3,<br />
#content p {<br />
margin: 0 0 15px 0;<br />
<br />
} <br />
<br />
</style><br />
<br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
td,th{<br />
border-style: solid; border-width: 1px;<br />
}<br />
.tit{<br />
color: #6AA33D;<br />
}<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #fcc;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial#">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: ;height: 200px;box-shadow: 4px 3px 25px #cff;"><br />
<h1></h1><br />
</div><br />
<br/><br />
<h2 style="font-family: 'Tangerine', serif;font-size: 48px; text-shadow: 4px 4px 4px #aaa; color: #38f;<br />
letter-spacing: 0.1em;<br />
word-spacing: 0.3em;<br />
font-weight: 700;<br />
width: 30%;<br />
line-height: 36px;<br />
margin: 0;<br />
margin-left: 20%;">Tutorial</h2><br/><br />
<ul id="tabs"><br />
<li><a href="#" name="#tab1">Neochr</a></li><br />
<li><a href="#" name="#tab2">NucleoMod</a></li><br />
<li><a href="#" name="#tab3">SegmMan</a></li><br />
<li><a href="#" name="#tab4">Others</a></li> <br />
</ul><br />
<div id="content2"><br />
<div id="tab1"><br />
<p class="tit">1. NeoChr </p><br />
<p><br />
NeoChr module would assist users to grab related genes in different pathways manually, to rewire genes’ relationship logically*, and to replace genes with ortholog that score higher*. Firstly, it would allow users to define gene order and orientation in DRAG&DROP way. Secondly, decoupled these genes if have overlap and make all genes are non-redundancy. Finally, add chromosome features to build a new chromosome and show in the JBrowse. Moreover, users can drag a window in the JBrowse and delete any gene in the window.<br/><br />
Note: <br/><br />
*These function are unavailable now, please wait for version 2.<br/><br />
**You can also add any thing here including your own water mark.<br/></p><br />
<p class="tit">2. Plugin Scripts </p><br />
<p>This module contains three plugins: Decouple.pl, Add.pl and Delete.pl.</p><br />
<p class="tit">2.1 Decouple.pl</p><br />
<p>This plugin is to decouple the genes which have overlap gene regions. These overlapping genes can be decoupled if meet the following conditions: (1)If two genes have overlap gene regions, the latter gene 5’UTR does not cover the former gene initial codon (ATG); (2)Overlapping region initial coordinate is in the coding DNA sequences(CDS) of gene which is need to be decoupled; (3)The decouple site of CDS have synonymous substitute codon to replace; After decoupling, we use these non-redundancy genes to generate a GFF file and a FASTA file.</p><br />
<p class="tit">2.1.1 Internal operation </p><br />
<p>First, this plugin extracts base sequence from the genome file according to the gene order list, and records the gene order in the list. And then plugin records the annotation information according to the specie GFF file, moreover, plugin extends gene CDS upstream 600bp as 5’-UTR and downstream 100bp as 3’-UTR if the GFF file does not contain annotated these two features.<br/><br />
Second, this plugin detects the overlapping genes in the same chromosome. In case the overlapping genes are detected, it will judge whether the overlapping initial site is located in the CDS region, and identify the site is belong to phase0/1/2.<br/><br />
Third, the plugin attempts to synonymous substitute codon to break the initial codon intra the CDS. Printing information whether or not be decoupled successfully, such as:<br/><br />
<img src="https://static.igem.org/mediawiki/2013/e/e0/T1-1.png" alt="data" style="width: 750px" /><br/><br />
And non-redundancy genes are generated.<br/><br />
Finally, the plugin links non-redundancy genes to construct a new chromosome according to the gene order.<br />
</p><br />
<p class="tit">2.2.1 Example</p><br />
<p>We have two input forms to execute the plugin:<br/><br />
1. Using string format as gene order list input form:<br/><br />
perl GeneDecouple.pl --species saccharomyces_cerevisiae_chr --list_format string --gene_order="YAL054C -,YAL038W +,YBR019C -,YBR145W +,YCL040W +,YCR012W +,YCR105W +,YDL168W +,YPL017C -,YIL177C -,YIL177W-A +,YIL172C -,YIL171W-A +,” --geneset_dir ../gene_set --upstream_extend 600 --downstream_extend 100 --neo_chr_gff neochr.gff --neo_chr_fa neochr.fa<br/><br />
2. Using file format as gene order list input form:<br/><br />
erl GeneDecouple.pl --species saccharomyces_cerevisiae_chr --list_format file --gene_order gene_ordre.list --geneset_dir ../gene_set --upstream_extend 600 --downstream_extend 100 --neo_chr_gff neochr.gff --neo_chr_fa neochr.fa<br />
</p><br />
<p class="tit">2.1.3 Parameters </p><br />
<table border="1"><br />
<tr><br />
<th>Parameter</th><br />
<th>Description</th><br />
<th></th><br />
<th></th><br />
</tr><br />
<tr><br />
<th>list_format</th><br />
<th>set the input form of gene order list</th><br />
<th>string</th><br />
<th>string/file</th><br />
</tr><br />
<tr><br />
<th>gene_order</th><br />
<th>set the input gene order list file(include pathway genes and addition genes)</th><br />
<th></th><br />
<th></th><br />
</tr><br />
<tr><br />
<th>Parameter</th><br />
<th>Description</th><br />
<th>Default</th><br />
<th>Selectable range</th><br />
</tr><br />
<tr><br />
<th>geneset_dir</th><br />
<th>set the species annotation directory</th><br />
<th>600</th><br />
<th></th><br />
</tr><br />
<tr><br />
<th>upstream_extend</th><br />
<th>set the length of gene downstram(bp)</th><br />
<th>100</th><br />
<th></th><br />
</tr><br />
<tr><br />
<th>neo_chr_gff</th><br />
<th>set the name of output neochr gff file</th><br />
<th></th><br />
<th></th><br />
</tr><br />
<tr><br />
<th>neo_chr_fa</th><br />
<th>set the name of output neochr fasta file</th><br />
<th></th><br />
<th></th><br />
</tr><br />
<tr><br />
<th>help</th><br />
<th>Show help information</th><br />
<th></th><br />
<th></th><br />
</tr><br />
</table><br />
</p><br/><br />
<p class="tit">2.4.1 The format of output file</p><br />
<p>The output files are standard GFF and FASTA format files which are decoupled.<br/><br />
&nbsp;&nbsp;1. decoupled GFF file<br/><br />
<img src="https://static.igem.org/mediawiki/2013/e/e5/T1-2.png" alt="data" style="width: 750px" /><br/><br />
&nbsp;&nbsp;2.decoupled FASTA file<br/><br />
<img src="https://static.igem.org/mediawiki/2013/b/b2/T1-3.png" alt="data" style="width: 750px" /><br/><br />
<br />
<p class="tit">2.2 Add.pl </p><br />
<p>This plugin will add the LoxPsym sequence and the customized left and right telomeres, centromere and autonomously replicating sequence (ARS) into the FASTA file and GFF file which are generated by Decouple.pl.</p><br />
<p class="tit">2.2.1 Internal operation </p><br />
<p>The plugin adds LoxPsym behind the first 3bp of 3’-UTR in each gene and adds telomere, centromere and ARS according this mode:<br/><br />
<b>left_telomere + gene1 + centromere + gene2 + ARS + gene3 + right_telomere</b><br/><br />
The distance between centromere and ARS is less than 30Kb.<br/><br />
Finally, user can see the new added features chromosome according to the JBrowse.<br />
</p><br />
<p class="tit">2.2.2 Example </p><br />
<p>perl 04.Add.pl --loxp loxPsym.feat --left_telomere UTC_left.feat --right_telomere UTC_right.feat --ars chromosome_I_ARS108.feature --centromere chromosome_I_centromere.feat --chr_gff neochr.gff --chr_seq neochr.fa --neochr_seq neochr.final.fa --neochr_gff neochr.final.gff<br/><br/><br />
All the feature file format is 4 lines format, for example:<br/><br />
&nbsp;&nbsp;name = site_specific_recombination_target_region<br/><br />
&nbsp;&nbsp;type = loxPsym<br/><br />
&nbsp;&nbsp;source = BIO<br/><br />
&nbsp;&nbsp;sequence = ATAACTTCGTATAATGTACATTATACGAAGTTAT<br/><br />
Note: the first line is the detail name of feature, the second line is the type of feature, the third line is the source of feature and the last line is the sequence of feature.<br />
</p><br />
<p class="tit">2.2.3 Parameters</p><br />
<pre><br />
Parameter Description Default Selectable range<br />
loxp set the sequence of loxp ATAACTTCGTATAATGTATGCTATACGAAGTTAT <br />
left_telomere set the sequence of left telomere <br />
right_telomere set the sequence of right telomere <br />
chr_gff set the input neorchr_gff file <br />
chr_seq set the input neorchr_gff file <br />
neochr_seq set the name of output added loxps and telomeres neochr_fa file <br />
neochr_gff set the name of output added loxps and telomeres neochr_gff file <br />
</pre><br />
<br />
<p class="tit">2.2.4 The format of output</p><br />
<p>The output files are standard GFF and FASTA format of adding features chromosome.<br/><br />
1. added features GFF file<br/><br />
<img src="https://static.igem.org/mediawiki/2013/e/e0/T1-4.png" alt="data" style="width: 750px" ></a><br />
</p><br />
<br />
<p class="tit">2.3 Delete.pl </p><br />
<p>This plugin can modify the GFF and FASTA file which are generated by Add.pl according to the user drags a window in the JBrowse and delete any gene in the window.</p><br />
<p class="tit">2.3.1 Internal operation </p><br />
<p>Firstly, user uses mouse to drag a window in the added features FASTA file which is showed in the JBrowse and JBrowse displays all the genes in this window.Secondly, user decides which genes is need to be delected from the new chromosome and plugin deletes genes from GFF file and modify FASTA in the same time.</p><br />
<p class="tit">2.3.2 Example </p><br />
<p>perl 05.delete.pl --delete="YAL054C,YAL038W" --neochr_gff neochr.refine.final.gff --neochr_fa neochr.refine.final.fa --slim_gff neochr.refine.delete.gff --slim_fa neochr.refine.delete.fa </p><br />
<p class="tit">2.3.3 Parameters </p><br />
<p><pre><br />
Parameter Description Default Selectable range<br />
delete Set the to be deleted gene list <br />
neochr_gff Set the input GFF file which is generated by Add.pl <br />
neochr_fa Set the input FASTA file which is generated by Add.pl <br />
slim_gff Set the output GFF file <br />
slim_fa Set the output FASTA file </pre></p><br />
<br />
<p class="tit">2.3.4 The format of ouput</p><br />
<p>The output files are standard GFF and FASTA format of deleted genes chromosome.</p><br />
<br />
</div><br />
<div id="tab2"><br />
<p class="tit">1. NucleoMod </p><br />
<p>NucleoMod can modify CDS based on synonymous mutation. It has 5 applications. Firstly, NucleoMod is used to design CRISPR sites on NeoChr so that we can silence the wild type genes. Secondly, it can erase specific enzyme sites according to the users' selection. Thirdly, users can create an enzyme site in selected region of specific genes. Fourthly, it can optimize the codon efficiency to increase the expression level. Finally, it can smash the tandem repeat bases to reduce the synthesis difficulty.</p><br />
<p class="tit">2. Plugins</p><br />
<p>This module contains 5 plugins: CRISPR design, erase enzyme site, create enzyme site, codon optimization, repeat smash. All plugins are included in the main program.</p><br />
<p class="tit">2.1 CRISPR design</p><br />
<p>This plugin is used to design CRISPR site of NeoChr genes so that we can silence the wild type genes. We use blast+ to ensure the uniqueness of CRISPR sites. If you are using more than one plugin at the same time, this plugin will start firstly and deliver the data to next plugin. Otherwise it will generate a new fasta file for sequence and gff file for annotation.</p><br />
<p class="tit">2.1.1 Internal operation</p><br />
<p>First, this plugin extracts sequence and annotation from the NeoChr FASTA file and GFF3 file, respectively. Regular expression will be applied to find the 23bp basic structure of CRISPR site, with a head of ‘G’ then following 20 facultative bases and finally followed by ‘GG’. All the sequences and locus will be record in an array. <br/><br />
Second, the blast+ will be used to check whether the 12bp sequences (from 9th to 20th) are uniq in the wild type genome. Only uniq sites will be reserved. <br/><br />
Third, synonymous substitution method will be applied to change one base between the 9th to 20th bases of the CRISPR structure. The result will be record in GFF as an element of gene. If –verbose is set, the designed number will be report in STDOUT.<br/><br />
Finally, if this plugin is the last module, the sequence and annotation information will be recreated in FASTA and GFF format.</p><br />
<p class="tit">2.1.2 Example</p><br />
<p>We have two input forms to execute the plugin:<br/><br />
Run CRISPR design plugin only:<br/><br />
perl NucleoMod.pl -inputfa NeoChr.fa -inputgff NeoChr.gff -outputgff new_annotation.gff -outputfa new_chr.fa -crisprnum 2 -database saccharomyces_cerevisiae_chr.fa</p><br />
<p class="tit">2.1.3 Parameters</p><br />
<table><br />
<tr><td>Parameter</td><td>Description</td><td>Default</td><td>Selectable range</td></tr><br />
<tr><td>inputfa</td><td>The NeoChr sequence file in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>inputgff</td><td>The NeoChr annotation file in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputgff</td><td>Output of new chromosome annotation in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputfa</td><td>Output of new chromosome sequence in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>verbose</td><td>Output the detailed information in STDOUT</td><td>none</td><td>option</td></tr><br />
<tr><td>crisprnum</td><td>Number of CRISPR site to be design per gene</td><td></td><td>Int (>0)</td></tr><br />
<tr><td>database</td><td>The sequence of reference genome, used as blast+ database</td><td></td><td>string</td></tr><br />
<tr><td>help</td><td>Show help information</td><td></td><td></td></tr><br />
</table><br />
<p class="tit">2.1.4 The format of output file</p><br />
<p>The output files are standard GFF and FASTA format files.<br/><br />
1. GFF file<br/><br />
<img src="https://static.igem.org/mediawiki/2013/2/26/T2-1.png" /><br/><br />
2. FASTA file<br/><br />
<img src="https://static.igem.org/mediawiki/2013/d/df/T2-2.png" /><br/><br />
3. Detailed information in STDOUT<br/><br />
<img src="https://static.igem.org/mediawiki/2013/f/fb/T2-3.png" /><br />
</p><br />
<p class="tit">2.2 Erase enzyme site</p><br />
<p>Given a list of restriction enzyme information, this plugin will erase the restriction sites in every gene. If you are using more than one plugin at the same time, this plugin will start after CRISPR design and deliver the data to next plugin. Otherwise it will generate a new fasta file for sequence and gff file for annotation.</p><br />
<p class="tit">2.2.1 Internal operation</p><br />
<p>The enzyme information will be extracted. (If the –borbrickstandard parameter is set, it will also remove EcoRI, XbaI, SpeI, PstI and NotI) The recognize site will be reformatted to regular expression and searched in the CDS regions.<br />
Once a restriction site is matched, synonymous substitution method will be applied to try to erase the enzyme site. When the substitution is finished, the plugin will restart the next search from 1 base after the last matched position.<br />
If this plugin is the last module, the sequence and annotation information will be recreated in FASTA and GFF format.</p><br />
<p class="tit">2.2.2 Example</p><br />
<p>perl NucleoMod.pl -inputfa NeoChr.fa -inputgff NeoChr.gff -outputgff new_annotation.gff -outputfa new_chr.fa –biobrickstandard [-delenzymelist enzyme.list ]<br/><br />
<br/><br />
Format of enzyme.list:<br/><br />
Company enzyme_name enzyme_site …<br/><br />
Eg. NEB BamHI G/GATCC</p><br />
<p class="tit">2.2.3 Parameters</p><br />
<table><br />
<tr><td>Parameter</td><td>Description</td><td>Default</td><td>Selectable range</td></tr><br />
<tr><td>inputfa</td><td>The NeoChr sequence file in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>inputgff</td><td>The NeoChr annotation file in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputgff</td><td>Output of new chromosome annotation in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputfa</td><td>Output of new chromosome sequence in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>verbose</td><td>Output the detailed information in STDOUT</td><td>none</td><td>option</td></tr><br />
<tr><td>biobrickstandard</td><td>Erase the biobrick standard enzyme site</td><td>none</td><td>option</td></tr><br />
<tr><td>delenzymelist</td><td>The file of enzyme going to delete</td><td></td><td>string</td></tr><br />
<tr><td>detail</td><td>Show the erased enzyme site in new gff</td><td>none</td><td>option</td></tr><br />
<tr><td>help</td><td>Show help information</td><td></td><td></td></tr><br />
<br />
</table><br />
<p class="tit">2.2.4 The format of output</p><br />
<p>The output files are standard GFF and FASTA format.<br/><br />
1. GFF file<br/><br />
<br />
2. FASTA file<br/><br />
<br />
3. Detailed information in STDOUT<br/><br />
<img src="https://static.igem.org/mediawiki/2013/e/ea/T2-4.png" /><br/><br />
</p><br />
<p class="tit">2.3 Create enzyme site</p><br />
<p>Given a list of restriction enzyme information, this plugin can create a new enzyme site in specific region of selected gene. If you are using more than one plugin at the same time, this plugin will start after erase enzyme site and deliver the data to next plugin. Otherwise it will generate a new fasta file for sequence and gff file for annotation.</p><br />
<p class="tit">2.3.1 Internal operation</p><br />
<p>First, information of enzyme site will be extracted. According to 3 reading frames, a searching tree will be constructed and converted to regular expression. <br />
The plugin will search the selected regions and then change the sequence to enzyme site by synonymous substitution method.<br />
If this plugin is the last module, the sequence and annotation information will be recreated in FASTA and GFF format.</p><br />
<p class="tit">2.3.2 Example</p><br />
<p>perl NucleoMod.pl -inputfa NeoChr.fa -inputgff NeoChr.gff -outputgff new_annotation.gff -outputfa new_chr.fa -addenzymelist enzyme.list -addenzymeconfig gene_id,start_pos,end_pos,enzyme_name</p><br />
<p class="tit">2.3.3 Parameters</p><br />
<p><br />
<table><br />
<tr><td>Parameter</td><td>Description</td><td>Default</td><td>Selectable range</td></tr><br />
<tr><td>inputfa</td><td>The NeoChr sequence file in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>inputgff</td><td>The NeoChr annotation file in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputgff</td><td>Output of new chromosome annotation in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputfa</td><td>Output of new chromosome sequence in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>verbose</td><td>Output the detailed information in STDOUT</td><td>none</td><td>option</td></tr><br />
<tr><td>addenzymelist</td><td>The file of enzyme to get enzyme site information</td><td></td><td>string</td></tr><br />
<tr><td>addenzymeconfig</td><td>A array of string to specify enzyme and regions</td><td></td><td>string,int,int,string</td></tr><br />
<tr><td>help</td><td>Show help information</td><td></td><td></td></tr><br />
</table><br />
</p><br />
<p class="tit">2.3.4 The format of ouput</p><br />
<p>The output files are standard GFF and FASTA format.<br/><br />
1. GFF file<br/><br />
<br />
2. FASTA file<br/><br />
<br />
3. Detailed information in STDOUT<br/><br />
<img src="https://static.igem.org/mediawiki/2013/7/75/T2-5.png" /><br/><br />
<br />
</p><br />
<p class="tit">2.4 Codon optimization</p><br />
<p>Given a codon priority list, this plugin is used to optimize the codon so that we can increase the expression of selected genes. If you are using more than one plugin at the same time, this plugin will start after create enzyme site and deliver the data to next plugin. Otherwise it will generate a new fasta file for sequence and gff file for annotation.</p><br />
<p class="tit">2.4.1 Internal operation</p><br />
<p>The codon with same amino acid will be separated into 3 ranks, best normal and worst. Every codon of selected gene will be check whether the codon is in best rank. The codon in normal or worst will be change to best rank by synonymous substitution method.<br />
If this plugin is the last module, the sequence and annotation information will be recreated in FASTA and GFF format.</p><br />
<p class="tit">2.4.2 Example</p><br />
<p>perl NucleoMod.pl -inputfa NeoChr.fa -inputgff NeoChr.gff -outputgff new_annotation.gff -outputfa new_chr.fa -codonoptimize CodonPriority.txt -optimizeallgene [-optimizegenelist gene1,gene2,gene3 ]</p><br />
<p class="tit">2.4.3 Parameters</p><br />
<p><br />
<table><br />
<tr><td>Parameter</td><td>Description</td><td>Default</td><td>Selectable range</td></tr><br />
<tr><td>inputfa</td><td>The NeoChr sequence file in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>inputgff</td><td>The NeoChr annotation file in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputgff</td><td>Output of new chromosome annotation in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputfa</td><td>Output of new chromosome sequence in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>verbose</td><td>Output the detailed information in STDOUT</td><td>none</td><td>option</td></tr><br />
<tr><td>codonoptimize</td><td>Codon priority list to get the ranking information</td><td></td><td>string</td></tr><br />
<tr><td>optimizeallgene</td><td>Optimize all genes in inputgff</td><td></td><td>option</td></tr><br />
<tr><td>optimizegenelist</td><td>A list of gene going to optimize, separate by comma</td><td></td><td>string,string,string,...</td></tr><br />
<tr><td>detail</td><td>Show the optimization sequence in new gff</td><td>none</td><td>option</td></tr><br />
<tr><td>help</td><td>Show help information</td><td></td><td></td></tr><br />
</table><br />
</p><br />
<p class="tit">2.4.4 The format of ouput</p><br />
<p>The output files are standard GFF and FASTA format.<br/><br />
1. GFF file<br/><br />
2 .FASTA file<br/><br />
3. Detailed information in STDOUT<br/><br />
<img src="https://static.igem.org/mediawiki/2013/a/a2/T2-6.png" /><br />
</p><br />
<p class="tit">2.5 Repeat smash</p><br />
<p>This plugin go through the CDS region to find out the tandem repeat bases. Synonymous substitution method will be applied to break long tandem repeat base to reduce the synthesis difficulty. If you are using more than one plugin at the same time, this plugin will start finally and then it will generate a new fasta file for sequence and gff file for annotation.</p><br />
<p class="tit">2.5.1 Internal operation</p><br />
<p>Regular expression is used to find out the tandem repeat bases longer then specified length (usually longer than 5bp). From the third of the matched sequence, synonymous substitution method will be applied to break the tandem repeat bases. <br />
If the substitution is successful and the rest sequence is still longer than the cutoff, then it will move to next 3 bases and do the same thing. <br />
The sequence and annotation information will be recreated in FASTA and GFF format.</p><br />
<p class="tit">2.3.2 Example</p><br />
<p>perl NucleoMod.pl -inputfa NeoChr.fa -inputgff NeoChr.gff -outputgff new_annotation.gff -outputfa new_chr.fa -repeatsmash 5</p><br />
<p class="tit">2.3.3 Parameters</p><br />
<p><br />
<table><br />
<tr><td>Parameter</td><td>Description</td><td>Default</td><td>Selectable range</td></tr><br />
<tr><td>inputfa</td><td>The NeoChr sequence file in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>inputgff</td><td>The NeoChr annotation file in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputgff</td><td>Output of new chromosome annotation in GFF3 format</td><td></td><td>string</td></tr><br />
<tr><td>outputfa</td><td>Output of new chromosome sequence in FASTA format</td><td></td><td>string</td></tr><br />
<tr><td>verbose</td><td>Output the detailed information in STDOUT</td><td>none</td><td>option</td></tr><br />
<tr><td>repeatsmash</td><td>The tandem repeat bases longer or equal to this cutoff will be smashed</td><td></td><td>int</td></tr><br />
<tr><td>detail</td><td>Show the repeat smash result in new gff</td><td>none</td><td>option</td></tr><br />
<tr><td>help</td><td>Show help information</td><td></td><td></td></tr><br />
</table><br />
</p><br />
<p class="tit">2.3.4 The format of ouput</p><br />
<p><br />
The output files are standard GFF and FASTA format.<br/><br />
1. GFF file<br/><br />
2. FASTA file<br/><br />
3. Detailed information in STDOUT<br/><br />
<img src="https://static.igem.org/mediawiki/2013/8/83/T2-7.png" /><br />
</p><br />
<br />
</div><br />
<div id="tab3"><br />
<p class="tit">3. SegmMan </p><br />
<p>This module will cut chromosome into pieces with different sizes with Gibson, Goldengate, Homologous adaptors to them so that they are able to be assembled into whole experimentally.</p><br />
<p class="tit">Plugin Scripts</p><br />
<br/><br />
<p class="tit">3-1. 01.whole2mega.pl</p><br />
<p>This utility can split the whole chromosome ( at least 90kbp long ) into about 30k segments and add homologous overlap and adaptors, so that these fragments can be integrated into whole experimentally.</p><br />
<p class="tit">Internal operation</p><br />
<p>First, this utility searches for the location of centromere and ARSs (autonomously replicating site). The minimal distance between centromere and ARS should NOT be larger than a defined megachunk which is about 30k long. <br/><br />
Second, this utility cuts out the first 30k sequence window containing the centromere and its adjacent ARS, and then adds this megachunk with two original markers and left, right telomeres.<br/><br />
Thirdly, this utility continues to cut more megachunks from the original one to both ends. But these megachunks are not independent, they all have about 1kbp overlaps. Moreover, these new splited window can be given only one marker alternately and only left or right telomere.<br/><br />
The output file will be dealed with 02.globalREmarkup.pl<br/><br />
For more information about segmentation design, please refer to the page ASSEMBLY DESIGN PRINCIPLE .</p><br />
<p class="tit">Example (command line)</p><br />
<p>perl 01.whole2mega.pl –gff sce_chrI.gff -fa sce_chr01.fa -ol 1000 -ck 30000 -m1 LEU2 -m2 URA3 -m3 HIS3 -m4 TRP1 -ot sce_chrI.mega</p><br />
<p class="tit">Parameters</p><br />
<table><tbody><br />
<tr><td></td><td></td><td>default</td><td>Option</td></tr><br />
<tr><td>gff</td><td>The gff file of the chromosome being restriction enzyme sites parsing</td><td></td><td></td></tr><br />
<tr><td>fa</td><td>The fasta file of the chromosome being restriction enzyme sites parsing<br />
(The length of the chromosome is larger than 90k)</td><td></td><td></td></tr><br />
<tr><td>ol</td><td>The length of overlap between megachunks</td><td>1000bp</td><td></td></tr><br />
<tr><td>ck</td><td>The length of megachunks</td><td>30kbp</td><td></td></tr><br />
<tr><td>m1</td><td>The first marker for selection alternately</td><td>LEU2 (1797bp)</td><td>LEU2/URA3HIS3/TRP1</td></tr><br />
<tr><td>m2</td><td>The second marker for selection alternately<br />
</td><td>URA3 (1112bp)</td><td>LEU2/URA3/HIS3/TRP1</td></tr><br />
<tr><td>m3</td><td>The first marker orinally residing in first 30k segmentation</td><td>HIS3 (1774bp)</td><td>LEU2/URA3/HIS3/TRP1</td></tr><br />
<tr><td>m4</td><td>The second marker orinally residing in first 30k segmentation</td><td>TRP1 (1467bp)</td><td>LEU2/URA3/HIS3/TRP1</td></tr><br />
<tr><td>ot</td><td>The output file </td><td>Prefix(fa filename)+ suffix(.mega)</td><td></td></tr><br />
</tbody></table><br />
<br />
<p class="tit">The format of output:</p><br />
<p>The output file is stored in /the path where you install GENOVO/Result/ 01.whole2mega.<br/><br />
Besides, there is screen output about the process state and result.<br/><br />
1. Screen output<br/><br />
2. 01.state <br/><br />
&nbsp;Store the segmentation information<br/><br />
<table><tbody><br />
<tr><td>Megachunk_ID</td><td>Corresponding location in the designed chromosome</td></tr><br />
<tr><td>Part ID</td><td>Location in the segmentation</td></tr><br />
</tbody></table><br />
<img src="https://static.igem.org/mediawiki/2013/c/c1/T3-1.png" /><br/><br />
3 *.mega<br/><br />
&nbsp;Store the fasta information of the 30k segments<br/><br />
<img src="https://static.igem.org/mediawiki/2013/f/f0/T3-2.png" /><br />
</p><br />
<p class="tit">3-2. 02.globalREmarkup.pl</p><br />
<p>This utility will parse the exited restriction enzyme sites residing in the chromosome.</p><br />
<p class="tit">Internal operation</p><br />
<p>This utility searches the exited restriction enzyme sites along the chromosome both plus strand and minus strand, after users define the list of enzymes.<br/><br />
Besides, we tried to find out all the potential restriction enzyme sites, so that maybe some unusual restriction enzyme sites can be created and let segmentation go. But because it had low efficiency, we’re still working on that.<br/><br />
The output file will be dealed with 03.mega2chunk2mini.pl<br/><br />
For more information about segmentation design, please refer to the page ASSEMBLY DESIGN PRINCIPLE .<br />
</p><br />
<p class="tit">Example (command line)</p><br />
<p>perl 02.globalREmarkup.pl -sg 01.whole2mega/sce_chrI.mega -re standard_and_IIB -ct Standard.ct –ot sce_chrI.mega.parse</p><br />
<p class="tit">Parameters</p><br />
<p><br />
<table><tbody><br />
<tr><td></td><td></td><td>default</td><td>Option</td></tr><br />
<tr><td>sg</td><td>The fasta file of the 30k segmentation, the output of 01.wh2mega.pl</td><td></td><td></td></tr><br />
<tr><td>ps</td><td>The markup file of the 30k segmentation, the output of 02.globalREmarkup.pl</td><td></td><td></td></tr><br />
<tr><td>re</td><td>The restriction enzyme sites list. It is devided by different standards, type (IIP, IIA, IIB), cost (standard, nonexpensive) and etc.</td><td>Standard_and_IIB</td><td>IIP/IIA/IIB/Standard/<br />
Nonexpensive/<br />
Standard_IIB<br />
Nonexpensive_IIB</td></tr><br />
<tr><td>a2</td><td>2k to 10k assembly strategy (Gibson or Goldengate)</td><td>Gibson</td><td>Gibson/ Goldengate</td></tr><br />
<tr><td>a10</td><td>10k to 30k assembly strategy (Gibson or Goldengate)</td><td>Goldengate</td><td>Gibson/ Goldengate</td></tr><br />
<tr><td>ckmax2</td><td>The maximum length of minichunks</td><td>2200 bp</td><td></td></tr><br />
<tr><td>ckmin2</td><td>The minimum length of minichunks </td><td>1800 bp</td><td></td></tr><br />
<tr><td>cknum</td><td>The number of minichunks in a chunk</td><td>5</td><td></td></tr><br />
<br />
</tbody></table><br />
Codon table list:<br/><br />
1 The Standard Code<br/><br />
2 The Vertebrate Mitochondrial Code<br/><br />
3 The Yeast Mitochondrial Code<br/><br />
4 The Mold, Protozoan, and Coelenterate Mitochondrial Code and the Mycoplasma/Spiroplasma Code<br/><br />
5The Invertebrate Mitochondrial Code<br/><br />
6 The Ciliate, Dasycladacean and Hexamita Nuclear Code<br/><br />
7 The Echinoderm and Flatworm Mitochondrial Code<br/><br />
8 The Euplotid Nuclear Code<br/><br />
9 The Bacterial, Archaeal and Plant Plastid Code<br/><br />
10 The Alternative Yeast Nuclear Code<br/><br />
11 The Ascidian Mitochondrial Code<br/><br />
12 The Alternative Flatworm Mitochondrial Code<br/><br />
13 Blepharisma Nuclear Code<br/><br />
14 Chlorophycean Mitochondrial Code<br/><br />
15 Trematode Mitochondrial Code<br/><br />
16 Scenedesmus Obliquus Mitochondrial Code<br/><br />
17 Thraustochytrium Mitochondrial Code<br/><br />
18 Pterobranchia Mitochondrial Code<br/><br />
19 Candidate Division SR1 and Gracilibacteria Code<br/><br />
</p><br />
<p class="tit">The format of utput</p><br />
<p>The output file is stored in /the path where you install GENOVO/Result/. 02.globalREmarkup.<br/><br />
Besides, there is screen output about the process state and result.<br/><br />
1. Screen output<br/><br />
2. *.parse<br/><br />
Store the exited enzyme recognition site in the megachunks<br/><br />
Enzyme ID Start End Recognition site Real site<br/><br />
<img src="https://static.igem.org/mediawiki/2013/b/bf/T3-3.png" /><br />
</p><br />
<p class="tit">3-3. 03.chunk_30k_10k_2k.pl</p><br />
<p>This utility can produce 2k minichunks with Gibson adaptors and 10k chunks with goldengate adaptors.</p><br />
<p class="tit">Internal operation</p><br />
<p>This utility will segmentate the megachunk produced by 03.mega2chunk2mini.pl into 2k minichunks with Gibson assembly adaptors, so that they can be put together into 10k chunks.<br/><br />
First, this bin will search the inexistent restriction enzyme sites locally, and then decide the size of the minichunks according to the requirements from users, and add two same Gibson adaptors to each sides of minichunks.<br />
Secondly, the second part of this bin will define the start and end point of the chunks as users asked and design goldengate assembly adaptors for the chunks.<br/><br />
The output file can be sent in gene synthesis company after human attention and double check.<br/><br />
For more information about segmentation design, please refer to the page ASSEMBLY DESIGN PRINCIPLE .</p><br />
<p class="tit">Example (command line)</p><br />
<p>perl 03.mega2chunk2mini.pl -re standard_and_IIB -sg 01.whole2mega/sce_chr01_0.mega -ps 02.globalREmarkup/sce_chr01_0.parse -ot 03.mega2chunk2mini</p><br />
<p class="tit">Parameters</p><br />
<p><br />
<table><tbody><br />
<tr><td></td><td></td><td>default</td><td>Option</td></tr><br />
<tr><td>sg</td><td>The fasta file of the 30k segmentation, the output of 01.wh2mega.pl</td><td></td><td></td></tr><br />
<tr><td>ps</td><td>The markup file of the 30k segmentation, the output of 02.globalREmarkup.pl</td><td></td><td></td></tr><br />
<tr><td>re</td><td>The restriction enzyme sites list. It is devided by different standards, type (IIP, IIA, IIB), cost (standard, nonexpensive) and etc.</td><td>Standard_and_IIB</td><td>IIP/IIA/IIB/Standard/<br />
Nonexpensive/<br />
Standard_IIB<br />
Nonexpensive_IIB</td></tr><br />
<tr><td>a2</td><td>2k to 10k assembly strategy (Gibson or Goldengate)</td><td>Gibson</td><td>Gibson/ Goldengate</td></tr><br />
<tr><td>a10</td><td>10k to 30k assembly strategy (Gibson or Goldengate)</td><td>Goldengate</td><td>Gibson/ Goldengate</td></tr><br />
<tr><td>ckmax2</td><td>The maximum length of minichunks</td><td>2200 bp</td><td></td></tr><br />
<tr><td>ckmin2</td><td>The minimum length of minichunks </td><td>1800 bp</td><td></td></tr><br />
<tr><td>cknum</td><td>The number of minichunks in a chunk</td><td>5</td><td></td></tr><br />
<br />
</tbody><br />
</table><br />
If parameter a2 is Gibson, then there are additional parameters:<br/><br />
<table><tbody><br />
<tr><td>ol2</td><td>The length of overlap</td><td>40 bp</td><td></td></tr><br />
<tr><td>tmax2</td><td>The maximum melting temperature of the overlap of minichunks</td><td>60℃</td><td></td></tr><br />
<tr><td>tmin2</td><td>The minimum melting temperature of the overlap of minichunks</td><td>56℃</td><td></td></tr><br />
<tr><td>fe2</td><td>The minimum free energy of the overlap of minichunks</td><td>-3</td><td></td></tr><br />
<tr><td>ex2</td><td>The type of exonuclease used for minichunks</td><td>T5</td><td>T5/T3</td></tr><br />
<tr><td>lo2</td><td>The minimum distance between minichunks overlap and loxpsym</td><td>40 bp</td><td></td></tr><br />
<tr><td>en2</td><td>The type of enzyme flanking minichunks</td><td>IIP</td><td></td></tr><br />
<tr><td>et2</td><td></td><td></td><td></td></tr><br />
<tr><td>ep2</td><td>The maximum unit price of enzyme used in minichunks digestion</td><td>0.5 $/unit</td><td></td></tr><br />
<br />
</tbody><br />
</table><br />
If parameter a10 is Goldengate, then there are additional parameters:<br/><br />
<table><tbody><br />
<tr><td>en10</td><td>The type of enzyme flanking chunks</td><td>IIB</td><td>IIA/IIB</td><tr><br />
<tr><td>et10</td><td>The temperature of enzyme used in chunks digestion</td><td>37℃</td><td></td></tr><br />
<br />
</tbody><br />
</table><br />
</p><br />
<p class="tit">The format of ouput</p><br />
<p>The output file is stored in /the path where you install GENOVO/Result/. 03.mega2chunk2mini.<br/><br />
Besides, there is screen output about the process state and result.<br/><br />
1. Screen output<br/><br />
2. *.2kstate<br/><br />
Store the minichunks states.<br/><br />
<table><tr><td>Left IIP enzyme site</td><td>Right IIP enzyme site</td><td>Start</td><td>End</td><td>Size of minichunks</td><td>Melting temperature of overlap</td></tr><br />
</table><br />
<img src="https://static.igem.org/mediawiki/2013/b/bf/T3-3.png" /><br/><br />
3. *.10kstate<br/><br />
Store the chunks states<br/><br />
<table><br />
<tr><td>Left IIB enzyme site</td><td>Right IIB enzyme site</td><td>Start</td><td>End</td>Size of chunks<td></td></tr><br />
</table><br />
<img src="https://static.igem.org/mediawiki/2013/a/ad/T3-4.png" /><br/><br />
4. *.mini<br/><br />
Store the fasta of designed minichunks.<br/><br />
<img src="https://static.igem.org/mediawiki/2013/0/0f/T3-5.png" /><br/><br />
</p><br />
<br />
<br />
</div><br />
<div id="tab4"><br />
<p class="tit">Presentation from KGML</p><br />
<p> This module will grab genes’ details in different pathways, which from KEGG with KEGG Makeup Language (KGML) file and export genes list and relationship of genes. The goal here is to visualize the pathway and rebuild it in the level of genes.</p><br />
<p class="tit">Scripts<br/>1. keggid_convert_gene.pl</p><br />
<p> This utility can convert KEGGID which in KGML file into genes’ name and rewrite KGML file.</p><br />
<p class="tit">Internal operation</p><br />
<p> First, this utility will change the pathway’s name into KEGG database names, and then open the file with the entire list of genes, push them in hash.<br/><br />
Second, this utility will read the original pathway’s xml file in and replace KEGGID with gene’s name one by one. Furthermore, it will change type element all into “gene”.<br/><br />
Thirdly, it will be the substitution of original pathway’s xml file.</p><br />
<p class="tit">Example</p><br />
<p> perl keggid_convert_gene.pl ko04010</p><br />
<p class="tit">The format of output:</p><br />
<p>It will rewrite the original pathway’s xml file, if we have following statement:<br/><br />
<entry id="30" name="ko:K08018" type="ortholog"<br/><br />
After running this scripts, it will turn into:<br/><entry id="30" name=" RAPGEF2, PDZGEF1" type="gene" </p><br />
<p class="tit">convert.py</p><br />
<p> This utility will read in KGML file which have been rewritten before, and grab genes’ information, such as genes’ name, genes’ relationship and then convert these into JSON.</p><br />
<p class="tit">Internal operation</p><br />
<p> First, this utility will use the parameter –f to determine the specified file and read it in. The output file will use the file name that put forward.<br/><br />
Second, this utility convert KGML file into JSON and grab the information of genes, such as the reactions of genes and the relationship between genes.<br/><br />
Third, this utility continue to integrate the information above into two files, ‘gene.json’ and ‘relation.json’, which can be use directly in rewrite gene’s pathway.</p><br />
<p class="tit">Example</p><br />
<p> python convert.py –f sce04111</p><br />
<p class="tit">Parameters:</p><br />
<table border='1'><tbody><br />
<tr><td></td><td>default</td></tr><br />
<tr><td>-f/--file</td><td>read KGML from FILENAME(omit '.xml'), produce two files: gene list and relation</td></tr><br />
</tbody></table><br />
<p class="tit">The format of output:</p><br />
<p>The output file is stored in the path where you running this program.<br/><br />
1. _gene.json <br/><br />
<img src="https://static.igem.org/mediawiki/2013/1/1b/T4-1.png" /><br />
type:<br/><br />
<table><tbody><br />
<tr><td>ortholog</td><td>KO (orthology group)</td></tr><br />
<tr><td>enzyme</td><td>Enzyme</td></tr><br />
<tr><td>reaction</td><td>Reaction</td></tr><br />
<tr><td>gene</td><td>gene product (mostly a protein)</td></tr><br />
<tr><td>group</td><td>a complex of gene products (mostly a protein complex)</td></tr><br />
</tbody></table><br />
geneID:the unique identification of gene<br/><br />
<table><tbody><br />
<tr><td>name</td><td>the KEGGID of this gene </td></tr><br />
<tr><td>type</td><td>the type of this gene</td></tr><br />
</tbody></table><br />
reaction:<br/><br />
<table><tbody><br />
<tr><td>name</td><td>the KEGGID of this reaction</td></tr><br />
<tr><td>reversible</td><td>true: reversible reaction; false: irreversible reaction</td></tr><br />
<tr><td>substrates</td><td>KEGGID of substrate node</td></tr><br />
<tr><td>products</td><td>the KEGGID of product node</td></tr><br />
<tr><td>related-reactions</td><td>relate to another pathway or gene</td></tr><br />
</tbody></table><br />
2. _relation.json<br />
<img src="https://static.igem.org/mediawiki/2013/c/c1/T4-2.png" /><br />
relations:<br/><br />
<table><tbody><br />
<tr><td>type</td><td>The type of this relation[ ECrel, PPrel. GErel, PCrel, maplink]</td></tr><br />
<tr><td>subtype</td><td>Interaction/relation information[activation/inhibition]</td></tr><br />
<tr><td>entry1</td><td>The first (from) entry that defines this relation</td></tr><br />
<tr><td>entry2</td><td>The second (to) entry that defines this relation</td></tr><br />
</tbody></table><br />
entry1&2:<br/><br />
<table><tbody><br />
<tr><td>entry ID</td><td>The KEGGID of node which takes part in this relation</td></tr><br />
<tr><td>type</td><td>Have only two options: [gene/group]</td></tr><br />
<tr><td>name</td><td>The KEGGID of this gene</td></tr><br />
<tr><td>group</td><td>The node is a complex of gene products (mostly a protein complex)</td></tr><br />
</tbody></table><br />
</p><br />
<br/> <p class="tit">Shortcoming</p><br />
<p>We can’t automatic acquisition KGML file in the KEGG API, all the demo we have show need to be downloaded before. You can get the entire list of one database genes through KEGG API, just like http://rest.kegg.jp/list/ko , it shows the entire list of orthology genes. The download method about KGML files shows in “How to finish this plun-in” part.<br />
Some genes will relate to another pathway but it doesn’t shows in the pathway so we are failed to grab the relationships between genes and pathways automatically. So we added two gene-pathway relations in ko04010 demo manually, TP53 gene connected with ko04115: P53 signaling pathway and NLK gene connected with ko04310: WNT signaling pathway.<br />
We look forward to the improvement of this plun-in through these disadvantages. </p><br />
<p class="tit">How to finish this plun-in?</p><br />
<p> KEGG is a database resource for understanding high-level functions and utilities of the biological system, and KGML is an XML presentation of the KEGG pathway database, which enables automatic drawing of KEGG pathways and provides facilities for computational analysis and modeling of gene/protein networks and chemical networks. Here is the data structure of KGML.<br/> <br />
<img src="https://static.igem.org/mediawiki/2013/f/fa/T4-3.png" /><br />
It’s really complex and it will bother you to understand the KGML file! Do not worry, I will show you how to understand a KGML file and then how to convert it into JSON.<br/> <br />
First, how to find or download KGML file?<br/> <br />
Method: <br/> <br />
Download KGML" link for each pathway map.<br/> <br />
If you choose a pathway with prefix “map”, you can’t find the download link in the page, that’s <br />
because it can be generating almost ko/rn/ec/org files. <br/> <br />
Such as “map04111”, it has no link for download. But if you change the “map” into “sce” in<br />
the URL, you can get the file.<br/> <br />
<a href="http://www.kegg.jp/kegg/rest/keggapi.html">KEGG API:</a><br />
Take “sce04111” as an example, you can download the KGML file via the <a href="http://rest.kegg.jp/get/sce04111/KGML">this</a>.<br/> <br />
Second, the KGML file is difficult to find out the relationship through the data structure show above.<br/> <br />
Here is the simple but straightforward tutorial to teach you how to understand a KGML file.<br/> <br />
Take “sce04111.xml” as an example. We can simplify the data structure as:<br/> <br />
<img src="https://static.igem.org/mediawiki/2013/c/c5/T4-4.png" /><br/><br />
The entry element can be path/ko/ec/rn/cpd/gl/org/group, enzyme/protein/gene will have relation and gene will also have compound and reactions. We choose one relation to be example:<br/> <br />
<img src="https://static.igem.org/mediawiki/2013/2/27/T4-5.png" /><br />
It means that gene (YCL061C) have activation effect in gene (YPL153C).By the way, through the graphics elements, we can definitely rewrite the connection between these two genes.<br/> <br />
<br />
Third, thought we know how to get KGML file and can understand it but the crucial problem is, how to grab the information of genes and convert it into JSON.<br/> <br />
Here we use Python programming Language, install the library “lxml” for processing XML and HTML, and we import JSON library for convert.<br/> <br />
<br />
Fourth, you may ask: If there have any other software to do such job, that is read KGML files, convert it and rewrite it? <br/> <br />
Of course, and we indeed tried but failed for it’s not open source or the original source is difficult for modification. <br />
Actually, if you want to do some visualize pathway job, Cytoscape is a good choice and it also have cytoscape.js for drawing.<br/> <br />
<br />
Finally, we indeed done plentiful preparatory work, maybe in the end it’s not useful in this software but it can expand our horizons. <br />
<br/> <br />
</p><br />
<br />
</div><br />
<br />
</div><br />
<br />
<script><br />
function resetTabs(){<br />
$("#content2 > div").hide(); //Hide all content<br />
$("#tabs a").attr("id",""); //Reset id's <br />
}<br />
<br />
var myUrl = window.location.href; //get URL<br />
var myUrlTab = myUrl.substring(myUrl.indexOf("#")); // For localhost/tabs.html#tab2, myUrlTab = #tab2 <br />
var myUrlTabName = myUrlTab.substring(0,4); // For the above example, myUrlTabName = #tab<br />
<br />
(function(){<br />
$("#content2 > div").hide(); // Initially hide all content<br />
$("#tabs li:first a").attr("id","current"); // Activate first tab<br />
$("#content2 > div:first").fadeIn(); // Show first tab content<br />
<br />
$("#tabs a").on("click",function(e) {<br />
e.preventDefault();<br />
if ($(this).attr("id") == "current"){ //detection for current tab<br />
return <br />
}<br />
else{ <br />
resetTabs();<br />
$(this).attr("id","current"); // Activate this<br />
$($(this).attr('name')).fadeIn(); // Show content for current tab<br />
}<br />
});<br />
<br />
for (i = 1; i <= $("#tabs li").length; i++) {<br />
if (myUrlTab == myUrlTabName + i) {<br />
resetTabs();<br />
$("a[name='"+myUrlTab+"']").attr("id","current"); // Activate url tab<br />
$(myUrlTab).fadeIn(); // Show url tab content <br />
}<br />
}<br />
})()<br />
</script><br />
<br/><br/><br/><br/><br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard
Team:Shenzhen BGIC 0101/NewStandard
2013-10-20T09:43:38Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #fcc;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
h1{<br />
font-family: arial, sans-serif;<br />
font-size: 1.6em;<br />
color: #fbb;<br />
font-weight: 800;<br />
}<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard#">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: ;height: 200px;box-shadow: 4px 3px 25px #cff;"><br />
<h1></h1><br />
</div><br />
<br/><br />
<a name="overview"></a><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<h2 sytle="color:#83f">Develop New Standard</h2><br />
<br />
<div class="post-content" style="color: #ADFFCF;"><hr/><br />
<h1>Chromosome Design Standard </h1><br />
<p>After grap the information of pathway of interest, we can rewire genes' relation, replace genes with ortholog scoring higher, add human control upon genes' expression and experimentally synthesize this chromosome-like biodevice directly.</p><br/><br />
<h1>Design Operation Standard </h1><br />
<p>Drag & drop biodevice Design<br/><br />
We can change the position, strand of genes in neochromsome, in a user-friendly way.</p><br/><br />
<h1>Assembly Stategy Standard</h1><br />
<p>Synthesized fragments to Biodevice Assembly<br />
Different from the traditional bottom-up strategy, <a href="http://parts.igem.org/Assembly:Standard_assembly?title=Assembly:Standard_assembly">biobrick</a> & <a href="http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly">3A</a> standard assembly, to assemble biobricks into a high-level biodevice, we directly design brand new chromosome denovo in silico and design its segmentation with adaptors, so that we can synthesize DNA fragments, and integrate them into megachunks, and use a special method to transform megachunks to whole Chromosome.</p><br/><br />
<h1>Data Transmission Standard</h1><br />
<p>KGML is an XML presentation of KEGG pathway database, and rewrite relationships between genes use JavaScript (JS) language. In order to transfer XML be more readable for JS, we convert XML into JSON and transform data in more convenience way. We only reserve genes’ relationships and three kinds of subtype attribution, activation, inhibition and link. Through this data transmission standard, computer and users can directly and clearly understand the information. The diagram below is the data structure of our transmitted JSON format.</p><br />
<img src="https://static.igem.org/mediawiki/igem.org/7/77/Data_trans.png" /><br />
<br/><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
</article> <br />
<br />
</section><br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility
Team:Shenzhen BGIC 0101/Compatibility
2013-10-20T09:42:20Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<br />
<br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #FCC;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility#">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a></nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: ;height: 200px;box-shadow: 4px 3px 25px #cff;"><br />
<h1></h1><br />
</div><br />
<br/><br />
<a name="overview"></a><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<h2>Compatibility</h2><br />
<br />
<div class="post-content" style="color: #ADFFCF;"><br/><br />
<br />
<p>We have multiple output formats that can be used by other software.Such as:<br/><br/>GFF<br/>JSON<br/>SBOL<br/>self-defined format ,KGJN, that stores relation between genes</p><br/><br />
<br />
</div><br />
</div><br />
<br />
</div><br />
<br />
</article> <br />
<br />
</section><br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility
Team:Shenzhen BGIC 0101/Compatibility
2013-10-20T09:41:28Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<br />
<br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #FCC;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility#">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a></nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: ;height: 200px;box-shadow: 4px 3px 25px #cff;"><br />
<h1></h1><br />
</div><br />
<br/><br />
<a name="overview"></a><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix" style="background: cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<h2>Compatibility</h2><br />
<br />
<div class="post-content" style="color: #ADFFCF;"><br/><br />
<br />
<p>We have multiple output formats that can be used by other software.Such as:<br/><br/>GFF<br/>JSON<br/>SBOL<br/>self-defined format ,KGJN, that stores relation between genes</p><br/><br />
<br />
</div><br />
</div><br />
<br />
</div><br />
<br />
</article> <br />
<br />
</section><br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version
Team:Shenzhen BGIC 0101/Next version
2013-10-20T09:40:14Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #fcc;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version#">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a></nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: #;height: 200px;box-shadow: 4px 3px 125px #cff;"><br />
<h1></h1><br />
</div><br />
<br/><br />
<a name="overview"></a><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<h2>Next Version</h2><br />
<br />
<div class="post-content" style="color: #ADFFCF;"><br/><br />
<br />
<p><br />
In general<br/><br />
Add restriction on parameters of plugin or even change the plugin structure so that Genovo has a wider applied range.<br/><br />
Add encrypted water marks.<br/><br />
<br/><br />
Module1 Neochr<br/><br />
For genes in new pathway: <br/><br />
We can import exogenous genes into the new pathway, using the BLAST+ to classify and replace these exogenous genes orthologous relationship with original genes. <br/><br />
<img src="https://static.igem.org/mediawiki/2013/c/cc/Qq1.png" style="width:100%"/><br/><br />
For relationship between these genes:<br/><br />
In the next version of module, we also can rewire genes’ relationship logically in the pathway, such as: the transformation of activation/inhibition, the transformation of Negated AND gate and the addition of bistable state and oscillation circuit control relationship.<br/><br />
<img src="https://static.igem.org/mediawiki/2013/a/a0/Q2.png" style="width:100%"/><br/><br />
For human control over genes’ expression:<br/><br />
Artificial add chemicals to control regulatory sequence of expression, make certain genes under control.<br/><br />
<img src="https://static.igem.org/mediawiki/2013/e/ef/Q3.jpg" /><br/><br />
For the presentation of genes’ relationship:<br/><br />
In the next version for the presentation of genes’ relationship, we would have two improvements.<br/><br />
First, we will add the pathway which with indirectly relations between genes and present it in the pattern of gene-compound-gene,<br />
We will store the information of genes in the following structure. It will separate the substrates and products attribution of one gene in substance element which relate to reaction element.<br/><br />
<img src="https://static.igem.org/mediawiki/2013/1/17/Qq4.png"/><br/><br />
Every element will have id attribution which will be the unique identification of it. This utility will also use python program language to grab the information that show above and then convert xml to JSON. The results seem to like following:<br/><br />
Circle represents genes and triangle represents chemical substances. It means that TPI1 and TDH3 connect with this kind of indirectly relationships.<br/><br />
<br/><br />
Second, we will combine gene with pathway automatically whenever they have directly or indirectly relationships.We will store the genes’ relationship in the following ways, add one more values, link, in type attribution which in entry element.<br/><br />
<br/><br />
Module2 NecleoMod.<br/><br />
Since the integration of segments into whole do not work in proportion, so we’re obliged to identify the success of assembly. We hope to implement this by adding pcr tags to cds region of the genes. We mainly consider the melting temperature and minimum free energy by using <a href="http://www.bioperl.org/">bioperl</a>. <br/><br />
<br/><br />
Module3 SegmMan<br/><br />
As the assembly from 2k minichunks to 10k chunks(link), then to 30k megachunks(link), Gibson & Goldengate Strategies are used, the process from 600bp produced by complementary OLSDesign to 2k minichunks may use Goldengate strategy but IIA type instead of IIB type*.<br/><br />
<br/><br />
Another new way to construct new chromosome donovo<br/><br />
Because of the high price of gene synthesis, we would add such a function that users can construct their a small pathway by assembly genes one by one through biobrick stand or 3A standard.<br/><br />
<br/><br />
*Class describes the cutting behavior of an enzyme. The classes used by<br/><br />
GeneDesign uses a generalized subset of the classes as described at Rebase - for<br />
the purposes of enzyme editing, three classes have so far proven to be enough.<br />
See <a href="http://rebase.neb.com/cgi-bin/sublist">http://rebase.neb.com/cgi-bin/sublist</a> for the full description of enzyme<br />
classes.<br/><br />
<br/><br />
IIP : This enzyme has a symmetric target and a symmetric cleavage site; this<br />
usually means that the enzyme cleaves inside its own recognition site.<br />
This is not the same as overhang palindromy!<br/><br />
<br/><br />
IIA : This enzyme has an asymmetric recognition site and usually cleaves<br />
outside of it.<br/><br />
<br/><br />
IIB : This enzyme has one recognition site and two cleavage sites, one on<br />
either side of the recognition site, and thus cuts itself out of<br />
sequence.<br/><br />
</p><br/><br />
<br />
</div><br />
</div><br />
<br />
</div><br />
<br />
</article> <br />
<br />
</section><br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version
Team:Shenzhen BGIC 0101/Next version
2013-10-20T09:39:33Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #fcc;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version#">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a></nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: #;height: 300px;box-shadow: 4px 3px 125px #cff;"><br />
<h1></h1><br />
</div><br />
<br/><br />
<a name="overview"></a><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<h2>Next Version</h2><br />
<br />
<div class="post-content" style="color: #ADFFCF;"><br/><br />
<br />
<p><br />
In general<br/><br />
Add restriction on parameters of plugin or even change the plugin structure so that Genovo has a wider applied range.<br/><br />
Add encrypted water marks.<br/><br />
<br/><br />
Module1 Neochr<br/><br />
For genes in new pathway: <br/><br />
We can import exogenous genes into the new pathway, using the BLAST+ to classify and replace these exogenous genes orthologous relationship with original genes. <br/><br />
<img src="https://static.igem.org/mediawiki/2013/c/cc/Qq1.png" style="width:100%"/><br/><br />
For relationship between these genes:<br/><br />
In the next version of module, we also can rewire genes’ relationship logically in the pathway, such as: the transformation of activation/inhibition, the transformation of Negated AND gate and the addition of bistable state and oscillation circuit control relationship.<br/><br />
<img src="https://static.igem.org/mediawiki/2013/a/a0/Q2.png" style="width:100%"/><br/><br />
For human control over genes’ expression:<br/><br />
Artificial add chemicals to control regulatory sequence of expression, make certain genes under control.<br/><br />
<img src="https://static.igem.org/mediawiki/2013/e/ef/Q3.jpg" /><br/><br />
For the presentation of genes’ relationship:<br/><br />
In the next version for the presentation of genes’ relationship, we would have two improvements.<br/><br />
First, we will add the pathway which with indirectly relations between genes and present it in the pattern of gene-compound-gene,<br />
We will store the information of genes in the following structure. It will separate the substrates and products attribution of one gene in substance element which relate to reaction element.<br/><br />
<img src="https://static.igem.org/mediawiki/2013/1/17/Qq4.png"/><br/><br />
Every element will have id attribution which will be the unique identification of it. This utility will also use python program language to grab the information that show above and then convert xml to JSON. The results seem to like following:<br/><br />
Circle represents genes and triangle represents chemical substances. It means that TPI1 and TDH3 connect with this kind of indirectly relationships.<br/><br />
<br/><br />
Second, we will combine gene with pathway automatically whenever they have directly or indirectly relationships.We will store the genes’ relationship in the following ways, add one more values, link, in type attribution which in entry element.<br/><br />
<br/><br />
Module2 NecleoMod.<br/><br />
Since the integration of segments into whole do not work in proportion, so we’re obliged to identify the success of assembly. We hope to implement this by adding pcr tags to cds region of the genes. We mainly consider the melting temperature and minimum free energy by using <a href="http://www.bioperl.org/">bioperl</a>. <br/><br />
<br/><br />
Module3 SegmMan<br/><br />
As the assembly from 2k minichunks to 10k chunks(link), then to 30k megachunks(link), Gibson & Goldengate Strategies are used, the process from 600bp produced by complementary OLSDesign to 2k minichunks may use Goldengate strategy but IIA type instead of IIB type*.<br/><br />
<br/><br />
Another new way to construct new chromosome donovo<br/><br />
Because of the high price of gene synthesis, we would add such a function that users can construct their a small pathway by assembly genes one by one through biobrick stand or 3A standard.<br/><br />
<br/><br />
*Class describes the cutting behavior of an enzyme. The classes used by<br/><br />
GeneDesign uses a generalized subset of the classes as described at Rebase - for<br />
the purposes of enzyme editing, three classes have so far proven to be enough.<br />
See <a href="http://rebase.neb.com/cgi-bin/sublist">http://rebase.neb.com/cgi-bin/sublist</a> for the full description of enzyme<br />
classes.<br/><br />
<br/><br />
IIP : This enzyme has a symmetric target and a symmetric cleavage site; this<br />
usually means that the enzyme cleaves inside its own recognition site.<br />
This is not the same as overhang palindromy!<br/><br />
<br/><br />
IIA : This enzyme has an asymmetric recognition site and usually cleaves<br />
outside of it.<br/><br />
<br/><br />
IIB : This enzyme has one recognition site and two cleavage sites, one on<br />
either side of the recognition site, and thus cuts itself out of<br />
sequence.<br/><br />
</p><br/><br />
<br />
</div><br />
</div><br />
<br />
</div><br />
<br />
</article> <br />
<br />
</section><br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules
Team:Shenzhen BGIC 0101/Modules
2013-10-20T09:38:07Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #fcc;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
.hehe{<br />
width: 100%;<br />
}<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules#">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: ;height: 200px;box-shadow: 4px 3px 25px #cff;"><br />
<h1></h1><br />
</div><br />
<br/><br />
<a name="overview"></a><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix" style="background: #cf9"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<h2>Modules</h2><br />
<br />
<div class="post-content" style="color: #ADFFCF;"><hr/><br />
<h2>Neochr</h2><br />
<br />
<p><br />
Neochr module uses public data from <a href="www.yeastgenome.org">Saccharomyces Genome Database</a>, <a href="www.genome.jp/kegg">Kyoto Encyclopedia of Genes and Genomes</a> , <a href="www.genome.wisc.edu">E.coli genome project</a>,<a href="www.mgc.ac.cn/VFs/main.htm"> Virulence Factors of Pathogenic Bacteria </a>.<br/><br />
<img src="https://static.igem.org/mediawiki/2013/1/11/Mm3.jpg" /><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2013/5/5d/M4.jpg" /><br />
<img src="https://static.igem.org/mediawiki/2013/2/2f/Mm1.jpg" /><br />
<img src="https://static.igem.org/mediawiki/2013/b/bf/Mm2.jpg" /><br/><br />
The Neochr module contains three plugins: Decouple, Add and delete.<br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/9/91/Decpuple.png" /><br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/a/a7/Add.png" /><br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/8/8c/Delete.png" /><br/><br />
<br />
<br />
<br />
</p><br />
<br/><br />
<h2>NucleoMod</h2><br />
<p>When we extract gene from wild type genome to create a new chromosome, We need to silence the original wild type gene. The NucleoMod module can design CRISPR site to reach this goal. And the module can optimize the codon to increase expression level of genes.<br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/8/82/Crispr-01.png" /><br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/0/09/Create_enzyme_site-01.png" /><br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/2/2f/Erase_enzyme_site-01.png" /><br/><br />
<img class="hehe" src="https://2013.igem.org/File:Codon_optization-01.png" /><br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/4/42/Repeat_smash-01.png" /><br/><br />
</p><br/><br/><br />
<h2>SegmMan</h2><br />
<p>The synthesizer or synthesis chip can up to 3kb DNA sequence with high accuracy, but chromosome is not that short.<br/><br />
SegmMan can settle this problem, it splits chromosome into 30k fragments, after parsing its exited enzyme sites, continues segmentation into 10k and 2k fragments. In 10k and 2k level, its will add vector homologous region and design enzyme sites.<br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/e/ec/Segmentation_principle_general.jpg" /><br/><br />
</p><br/><br />
<h2>Others</h2><br />
<p>Presentation from KGML<br/><br />
This module will grab genes’ detail information in KEGG Makeup Language (KGML) file which can be downloaded in KEGG or get through KEGG API, and it will establish a new standard for data transmission which will convert XML format into JSON format and simplify structures. Furthermore, this module will export genes’ list and its relationships. Choose one pathway and this module will visualize the pathway and rebuild it in the level of genes.</p><br />
<img class="hehe" src="https://static.igem.org/mediawiki/igem.org/3/3b/Mod1.png" /><br />
<br/><br/><br />
<h2>Complementary project</h2><br />
<p></p><br />
<br/><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
</article> <br />
<br />
</section><br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules
Team:Shenzhen BGIC 0101/Modules
2013-10-20T09:37:37Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<br />
<!--[if lte IE 8]><link rel="stylesheet" href="http://www.humaan.com.au/wp-content/themes/humaan/css/iestyle.css"><![endif]--><br />
<!--[if IE 9]><link rel="stylesheet" href="http://www.humaan.com.au/wp-content/themes/humaan/css/ie9.css"><![endif]--><br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #fcc;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
.hehe{<br />
width: 100%;<br />
}<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules#">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: ;height: 200px;box-shadow: 4px 3px 25px #cff;"><br />
<h1></h1><br />
</div><br />
<br/><br />
<a name="overview"></a><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix" style="background: #cf9"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<h2>Modules</h2><br />
<br />
<div class="post-content" style="color: #ADFFCF;"><hr/><br />
<h2>Neochr</h2><br />
<br />
<p><br />
Neochr module uses public data from <a href="www.yeastgenome.org">Saccharomyces Genome Database</a>, <a href="www.genome.jp/kegg">Kyoto Encyclopedia of Genes and Genomes</a> , <a href="www.genome.wisc.edu">E.coli genome project</a>,<a href="www.mgc.ac.cn/VFs/main.htm"> Virulence Factors of Pathogenic Bacteria </a>.<br/><br />
<img src="https://static.igem.org/mediawiki/2013/1/11/Mm3.jpg" /><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2013/5/5d/M4.jpg" /><br />
<img src="https://static.igem.org/mediawiki/2013/2/2f/Mm1.jpg" /><br />
<img src="https://static.igem.org/mediawiki/2013/b/bf/Mm2.jpg" /><br/><br />
The Neochr module contains three plugins: Decouple, Add and delete.<br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/9/91/Decpuple.png" /><br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/a/a7/Add.png" /><br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/8/8c/Delete.png" /><br/><br />
<br />
<br />
<br />
</p><br />
<br/><br />
<h2>NucleoMod</h2><br />
<p>When we extract gene from wild type genome to create a new chromosome, We need to silence the original wild type gene. The NucleoMod module can design CRISPR site to reach this goal. And the module can optimize the codon to increase expression level of genes.<br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/8/82/Crispr-01.png" /><br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/0/09/Create_enzyme_site-01.png" /><br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/2/2f/Erase_enzyme_site-01.png" /><br/><br />
<img class="hehe" src="https://2013.igem.org/File:Codon_optization-01.png" /><br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/4/42/Repeat_smash-01.png" /><br/><br />
</p><br/><br/><br />
<h2>SegmMan</h2><br />
<p>The synthesizer or synthesis chip can up to 3kb DNA sequence with high accuracy, but chromosome is not that short.<br/><br />
SegmMan can settle this problem, it splits chromosome into 30k fragments, after parsing its exited enzyme sites, continues segmentation into 10k and 2k fragments. In 10k and 2k level, its will add vector homologous region and design enzyme sites.<br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/e/ec/Segmentation_principle_general.jpg" /><br/><br />
</p><br/><br />
<h2>Others</h2><br />
<p>Presentation from KGML<br/><br />
This module will grab genes’ detail information in KEGG Makeup Language (KGML) file which can be downloaded in KEGG or get through KEGG API, and it will establish a new standard for data transmission which will convert XML format into JSON format and simplify structures. Furthermore, this module will export genes’ list and its relationships. Choose one pathway and this module will visualize the pathway and rebuild it in the level of genes.</p><br />
<img class="hehe" src="https://static.igem.org/mediawiki/igem.org/3/3b/Mod1.png" /><br />
<br/><br/><br />
<h2>Complementary project</h2><br />
<p></p><br />
<br/><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
</article> <br />
<br />
</section><br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules
Team:Shenzhen BGIC 0101/Modules
2013-10-20T09:36:57Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<br />
<!--[if lte IE 8]><link rel="stylesheet" href="http://www.humaan.com.au/wp-content/themes/humaan/css/iestyle.css"><![endif]--><br />
<!--[if IE 9]><link rel="stylesheet" href="http://www.humaan.com.au/wp-content/themes/humaan/css/ie9.css"><![endif]--><br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #fcc;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
.hehe{<br />
width: 100%;<br />
}<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules#">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap" style="background:url(https://static.igem.org/mediawiki/igem.org/f/fb/Backgd.jpg);"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: ;height: 200px;box-shadow: 4px 3px 25px #cff;"><br />
<h1></h1><br />
</div><br />
<br/><br />
<a name="overview"></a><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix" style="background: #cf9"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<h2>Modules</h2><br />
<br />
<div class="post-content" style="color: #ADFFCF;"><hr/><br />
<h2>Neochr</h2><br />
<br />
<p><br />
Neochr module uses public data from <a href="www.yeastgenome.org">Saccharomyces Genome Database</a>, <a href="www.genome.jp/kegg">Kyoto Encyclopedia of Genes and Genomes</a> , <a href="www.genome.wisc.edu">E.coli genome project</a>,<a href="www.mgc.ac.cn/VFs/main.htm"> Virulence Factors of Pathogenic Bacteria </a>.<br/><br />
<img src="https://static.igem.org/mediawiki/2013/1/11/Mm3.jpg" /><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2013/5/5d/M4.jpg" /><br />
<img src="https://static.igem.org/mediawiki/2013/2/2f/Mm1.jpg" /><br />
<img src="https://static.igem.org/mediawiki/2013/b/bf/Mm2.jpg" /><br/><br />
The Neochr module contains three plugins: Decouple, Add and delete.<br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/9/91/Decpuple.png" /><br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/a/a7/Add.png" /><br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/8/8c/Delete.png" /><br/><br />
<br />
<br />
<br />
</p><br />
<br/><br />
<h2>NucleoMod</h2><br />
<p>When we extract gene from wild type genome to create a new chromosome, We need to silence the original wild type gene. The NucleoMod module can design CRISPR site to reach this goal. And the module can optimize the codon to increase expression level of genes.<br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/8/82/Crispr-01.png" /><br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/0/09/Create_enzyme_site-01.png" /><br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/2/2f/Erase_enzyme_site-01.png" /><br/><br />
<img class="hehe" src="https://2013.igem.org/File:Codon_optization-01.png" /><br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/4/42/Repeat_smash-01.png" /><br/><br />
</p><br/><br/><br />
<h2>SegmMan</h2><br />
<p>The synthesizer or synthesis chip can up to 3kb DNA sequence with high accuracy, but chromosome is not that short.<br/><br />
SegmMan can settle this problem, it splits chromosome into 30k fragments, after parsing its exited enzyme sites, continues segmentation into 10k and 2k fragments. In 10k and 2k level, its will add vector homologous region and design enzyme sites.<br/><br />
<img class="hehe" src="https://static.igem.org/mediawiki/2013/e/ec/Segmentation_principle_general.jpg" /><br/><br />
</p><br/><br />
<h2>Others</h2><br />
<p>Presentation from KGML<br/><br />
This module will grab genes’ detail information in KEGG Makeup Language (KGML) file which can be downloaded in KEGG or get through KEGG API, and it will establish a new standard for data transmission which will convert XML format into JSON format and simplify structures. Furthermore, this module will export genes’ list and its relationships. Choose one pathway and this module will visualize the pathway and rebuild it in the level of genes.</p><br />
<img class="hehe" src="https://static.igem.org/mediawiki/igem.org/3/3b/Mod1.png" /><br />
<br/><br/><br />
<h2>Complementary project</h2><br />
<p></p><br />
<br/><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
</article> <br />
<br />
</section><br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Software
Team:Shenzhen BGIC 0101/Software
2013-10-20T09:34:39Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #fcc;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software#">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: #cff;height: 200px;box-shadow: 4px 3px 125px #906;"><br />
<h1 style="<br />
font-family: 'Tangerine', serif;<br />
font-size: 5em;<br />
text-shadow: 5px 6px 4px #467952;<br />
color: #86E451;<br />
letter-spacing: 0.2em;<br />
word-spacing: 0.3em;<br />
font-weight: 900;<br />
line-height: 36px;<br />
margin: 0;">Genovo</h1><br />
</div><br />
<br/><br />
<a name="overview"></a><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<h2>Genovo</h2><br />
<br />
<div class="post-content" style="color: #003399;"><hr/><p><br />
Genovo is a Computer-Aided Design(CAD) tool to create genome denovo.<br/><br/><br />
1. operation interface<br/><br />
We developed its GUI & multiple functions basing upon JBrowse, a genome browse with a fully dynamic AJAX interface, which is included in GMOD in the CLOUD toolset.<br/><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/d2/Jbrowse.png" /><img src="https://static.igem.org/mediawiki/igem.org/2/28/Gmod.png" /><br/><br />
2. functional plugins<br/><br />
The current version is 1.3. It consists of 14 main plugins belonging to 3 design modules:<br/><br />
NeoChr, NecleoMod, SegmMan<br/><br/><br />
They are used to construct new chromosome structure denovo, modify CDS based on synoymous mutation, split chromosome into fragments with assembly adaptors in different sizes.<br/><br/><br />
The first module, NeoChr, would assist users to grab related genes in different pathways of various organism manually, to rewire genes’ relationship logically*, and to replace genes with orthologs that score higher*. Then it would allow users to define gene order and orientation in DRAG&DROP way, and decouple the genes with overlap. In the end, it would add or delete features, such as encrypted watermarks*, telomere, loxp sites to build a brand new genome.<br/><br/><br />
The second one , NucleoMod, has 5 applications. Firstly, NucleoMod is used to design CRISPR sites on NeoChr so that we can silence the wild type genes. Secondly, it can erase specific enzyme sites according to the users' selection. Thirdly, users can create a enzyme site in selected region of specific genes. Fourthly, it can optimize the codon efficiency to incresase the expression level. Finally, it can smash the tandem repeat bases to reduce the synthesis difficulty.<br/><br/><br />
The third one, SegmMan will cut chromosome into pieces in different sizes with Gibson, Goldengate, telomere adaptors to them so that they are able to be assembled into whole experimentally. Besides, it adds flanking vector homologous resion and enzyme sites for the preservation and excision from vectors.<br/><br/><br />
SegmMan, in another level, provide a complementary OLSDesign will guide users to get the chrosome fragments by chip and how to assembly them together.<br/><br/><br />
3. software goals<br/><br/><br />
Genovo enables users to create chromosome-like biodevice denovo, from pathway guided selection of gene to the rewire of genes’ relation, from reasonable substitution of genes to alteration of genes’ location along chromosome addition, from modification to CDS sequence to automatically segmentation design globally for assembly.<br/><br/><br />
We hope Genovo would assist users to have their own designed chromosome even if in silico, and hope it would assist researchers in SC2.0 project and futher genome research in pathway level.<br/><br/><br />
<img src="https://static.igem.org/mediawiki/igem.org/f/f5/Sc.png" /><br />
<br />
<br />
<br />
</p><br />
<br/><br/><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
</article> <br />
<br />
</section><br />
<br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Software
Team:Shenzhen BGIC 0101/Software
2013-10-20T09:32:40Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #fcc;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software#">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: #cf9;height: 200px;box-shadow: 4px 3px 125px #906;"><br />
<h1 style="<br />
font-family: 'Tangerine', serif;<br />
font-size: 5em;<br />
text-shadow: 5px 6px 4px #467952;<br />
color: #86E451;<br />
letter-spacing: 0.2em;<br />
word-spacing: 0.3em;<br />
font-weight: 900;<br />
line-height: 36px;<br />
margin: 0;">Genovo</h1><br />
</div><br />
<br/><br />
<a name="overview"></a><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<h2>Genovo</h2><br />
<br />
<div class="post-content" style="color: #003399;"><hr/><p><br />
Genovo is a Computer-Aided Design(CAD) tool to create genome denovo.<br/><br/><br />
1. operation interface<br/><br />
We developed its GUI & multiple functions basing upon JBrowse, a genome browse with a fully dynamic AJAX interface, which is included in GMOD in the CLOUD toolset.<br/><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/d2/Jbrowse.png" /><img src="https://static.igem.org/mediawiki/igem.org/2/28/Gmod.png" /><br/><br />
2. functional plugins<br/><br />
The current version is 1.3. It consists of 14 main plugins belonging to 3 design modules:<br/><br />
NeoChr, NecleoMod, SegmMan<br/><br/><br />
They are used to construct new chromosome structure denovo, modify CDS based on synoymous mutation, split chromosome into fragments with assembly adaptors in different sizes.<br/><br/><br />
The first module, NeoChr, would assist users to grab related genes in different pathways of various organism manually, to rewire genes’ relationship logically*, and to replace genes with orthologs that score higher*. Then it would allow users to define gene order and orientation in DRAG&DROP way, and decouple the genes with overlap. In the end, it would add or delete features, such as encrypted watermarks*, telomere, loxp sites to build a brand new genome.<br/><br/><br />
The second one , NucleoMod, has 5 applications. Firstly, NucleoMod is used to design CRISPR sites on NeoChr so that we can silence the wild type genes. Secondly, it can erase specific enzyme sites according to the users' selection. Thirdly, users can create a enzyme site in selected region of specific genes. Fourthly, it can optimize the codon efficiency to incresase the expression level. Finally, it can smash the tandem repeat bases to reduce the synthesis difficulty.<br/><br/><br />
The third one, SegmMan will cut chromosome into pieces in different sizes with Gibson, Goldengate, telomere adaptors to them so that they are able to be assembled into whole experimentally. Besides, it adds flanking vector homologous resion and enzyme sites for the preservation and excision from vectors.<br/><br/><br />
SegmMan, in another level, provide a complementary OLSDesign will guide users to get the chrosome fragments by chip and how to assembly them together.<br/><br/><br />
3. software goals<br/><br/><br />
Genovo enables users to create chromosome-like biodevice denovo, from pathway guided selection of gene to the rewire of genes’ relation, from reasonable substitution of genes to alteration of genes’ location along chromosome addition, from modification to CDS sequence to automatically segmentation design globally for assembly.<br/><br/><br />
We hope Genovo would assist users to have their own designed chromosome even if in silico, and hope it would assist researchers in SC2.0 project and futher genome research in pathway level.<br/><br/><br />
<img src="https://static.igem.org/mediawiki/igem.org/f/f5/Sc.png" /><br />
<br />
<br />
<br />
</p><br />
<br/><br/><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
</article> <br />
<br />
</section><br />
<br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements
Team:Shenzhen BGIC 0101/Requirements
2013-10-20T09:30:50Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
.ans a{<br />
color:#f77;<br />
}<br />
.ans a:hover{<br />
color:#38f;<br />
text-decoration: none;<br />
}<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:250px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #fcc;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<style><br />
.ach{<br />
text-indent: 1em;<br />
font-family: Century Gothic, Arial;<br />
}<br />
.que{<br />
color: #ADFFCF;<br />
}<br />
<br />
.ans a{<br />
color:#f77;<br />
}<br />
.ans a:hover{<br />
color:#38f;<br />
text-decoration: none;<br />
}<br />
</style><br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements#HumanPractices">Human Practices</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements#Safety">Safety</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements#Collaboration">Collaboration</a></div><br />
<br />
<br />
</div><br />
<div id="wrap" style="background:# ff9"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<div id="page-header" style="background: url(https://static.igem.org/mediawiki/2013/e/e5/Spor.jpg);height: 280px;box-shadow: 4px 3px 125px #cff;"><br />
<a name="HumanPractices"></a><h1></h1><br />
</div><br />
<br/><br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Human Practices</h2><br/><br />
<p class="ans"><br/><br />
1. Share Web-based server<br/><br />
2. Software assessment and comparison with BioStudio <br/><br />
3. Regional workshop<br/><br />
Regional workshop was held in BGI on May, 26th, 2013. As host, we invited 6 teams, SYSU-China, SYSU-Software, SCUT, SCAU-China, SUSTC-Shenzhen-A, SUSTC-Shenzhen-B. <br/><br />
Each team shared their ideas and progress, and even established cooperative intention:<br/><br />
DNA material shares among teams, SUSTC-Shenzhen-A assisted BGIC_Shenzhen_ATCG to purchase experimental material.<br/><br />
You can find the news <a href=" http://www.genomics.cn/news/show_news?nid=99539">here</a>.<br/><br />
4. Talk with Dr. Patrick Yizhi Cai<br/><br />
Dr. Patrick Cai is the Autodesk distinguished scholar and a Principal Investigator (with Chancellor's Fellowship), who directs the group of synthetic genomics in the university of Edinburgh. His research focuses on neochromosome design, computer assisted design for synbio and large scale DNA synthesis automation. So he is the most authoritative scholar for Genovo.<br/><br />
He came to BGI on Sep, 26th, 2013 and talk with us about Genovo's design and application.<br />
"Genovo is quite a neat idea." Quoted as Cai.<br/><br />
5. T-shirt sale<br/><br />
We tried to sell our design iGEM shirt to BGI’employees.<br/><br />
You may also order your own one <a href="https://docs.google.com/forms/d/1v8vvGN4TRq1yzLuKNed43mgl1KEyaWpOjh9VJfyNZqM/viewform">here</a>, if you’re in China.<br/><br />
<br />
<a name="Safety"></a></p><br />
<br/><br />
</div></div><br />
</article> <br />
</section><br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: #cff;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Safety</h2><br/><br />
<br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question1: Are you using the iGEM Software repository at github.com/igemsoftware?If you have instead stored your code elsewhere, please explain where and why you have put it there.If your code is not in the iGEM repository, are you using any version control system such as Git, CVS, or SVN?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. </p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question2:a. Does your software store any private data supplied by the user? (For example: the user's name and email address, passwords, DNA sequences, circuit designs, etc.) If yes, please describe what kind of data is stored. If no, skip the rest of this question and move on to question 3.</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. We store DNA sequences and circuit designs provided by users.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question2:b. What is the URL or IP address where the user's private data is stored? Where is the physical computer or hard drive that contains the user's private data?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:The server is still being constructed. </p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question2:c. Please describe any encryption, password protection, etc. that you use to protect the user's data. (It is not mandatory to have such protections, but if you do, describe them.)</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question3:Does your software include any other security features? Please describe them here.</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. The software can store the data provided by users and those produced step by step, so that user won't miss their result.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question4:Does your software let the user create a design by choosing parts/genes from a list/database, such as the Registry? If so, which lists/databases are included? Is there any restriction on which parts/genes the user can choose?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. KEGG, partsregistry, Codon usage database, SGD, VFDB, E. coli Genome Project. We have no restriction on genes the user can choose.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question5:Does your software allow users to write new data into any public lists or databases? If so, do you check the new data for errors before allowing it to be written?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:No.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question6:Does your software include any other features that encourage the user to create safe designs? Please describe them here.</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. We develop a plugin to show the relationship between the gene or artificial logic gate gene circuit to guide user to select their target genes safely. Besides, we have reminder about biosafely selection for users.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question7:Is your team also doing biological work in a wet lab?</p><a name="Collaboration"><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:No.</p><br />
<br />
<br />
</a> </div></div><br />
</article> <br />
</section><br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Collaboration</h2><br/><br />
<p class="ach"><br />
Cooperation: Shenzhen_BGIC_ATCG<br/><br />
We use NucleoMod to assist other wet team, Shenzhen_BGIC_ATCG, to design the biobrick optimized for eukaryons. <br/><br />
Below is one of the examples:<br/><br />
We transform the prokaryon version of cas9 for S.cerevisiae automatically.<br/><br />
Firstly, delete five enzymes of biobrick standard, EcoRI, XbaI, SpeI, PstI, NotI based on synonymous mutation of CDS.<br/><br />
<img src="https://static.igem.org/mediawiki/2013/e/e4/Ww1.png" /><br />
<img src="https://static.igem.org/mediawiki/2013/6/65/W2.png" width="100%" /><br />
<br />
Secondly, optimize the sequence for S.cerevisiae according to codon usage <a href="http://www.kazusa.or.jp/codon/ ">database</a>.<br/><br />
Finally, we recreate the sequence and annotation file.<br/><br />
We tried out SegmMan module to automatically split designed yeast_chr07_4_51 into 2k minichunks in command line.<br/><br />
After run the flow shell, SegmMan analyze the exited enzyme site along the sequence of yeast_chr07_4_51, and finally splited it into about 2k minichunks, so that we can synthesize these fragments and assemble them into whole.<br/><br />
The following is the final result of segmentations. yeast_chr07_4_51 is split into many 2k minichunks. After these fragments are synthesized, they can be assembled into whole step by step, from 2k to 10k to 30k to whole, according Gibson, Goldengate, Telomere Assembly.<br/><br />
On 2k and 10k level, they also have vectors homologous region and designed enzyme site, so that they can be preserved and cut out to use quickly. <br/><br />
<br />
</p><br />
</div></div><br />
</article> <br />
</section><br/><br />
<br/><br/><br/><br/><br/><br />
</div><!-- wrapper --><br />
<footer><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<script src="http://www.humaan.com.au/wp-content/themes/humaan/js/scripts.min.js" type="text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements
Team:Shenzhen BGIC 0101/Requirements
2013-10-20T09:26:19Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
.ans a{<br />
color:#f77;<br />
}<br />
.ans a:hover{<br />
color:#38f;<br />
text-decoration: none;<br />
}<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:250px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #1B1B1B;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<style><br />
.ach{<br />
text-indent: 1em;<br />
font-family: Century Gothic, Arial;<br />
}<br />
.que{<br />
color: #ADFFCF;<br />
}<br />
<br />
.ans a{<br />
color:#f77;<br />
}<br />
.ans a:hover{<br />
color:#38f;<br />
text-decoration: none;<br />
}<br />
</style><br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements#HumanPractices">Human Practices</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements#Safety">Safety</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements#Collaboration">Collaboration</a></div><br />
<br />
<br />
</div><br />
<div id="wrap" style="background:# ff9"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<div id="page-header" style="background: url(https://static.igem.org/mediawiki/2013/e/e5/Spor.jpg);height: 280px;box-shadow: 4px 3px 125px #cff;"><br />
<a name="HumanPractices"></a><h1></h1><br />
</div><br />
<br/><br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Human Practices</h2><br/><br />
<p class="ans"><br/><br />
1. Share Web-based server<br/><br />
2. Software assessment and comparison with BioStudio <br/><br />
3. Regional workshop<br/><br />
Regional workshop was held in BGI on May, 26th, 2013. As host, we invited 6 teams, SYSU-China, SYSU-Software, SCUT, SCAU-China, SUSTC-Shenzhen-A, SUSTC-Shenzhen-B. <br/><br />
Each team shared their ideas and progress, and even established cooperative intention:<br/><br />
DNA material shares among teams, SUSTC-Shenzhen-A assisted BGIC_Shenzhen_ATCG to purchase experimental material.<br/><br />
You can find the news <a href=" http://www.genomics.cn/news/show_news?nid=99539">here</a>.<br/><br />
4. Talk with Dr. Patrick Yizhi Cai<br/><br />
Dr. Patrick Cai is the Autodesk distinguished scholar and a Principal Investigator (with Chancellor's Fellowship), who directs the group of synthetic genomics in the university of Edinburgh. His research focuses on neochromosome design, computer assisted design for synbio and large scale DNA synthesis automation. So he is the most authoritative scholar for Genovo.<br/><br />
He came to BGI on Sep, 26th, 2013 and talk with us about Genovo's design and application.<br />
"Genovo is quite a neat idea." Quoted as Cai.<br/><br />
5. T-shirt sale<br/><br />
We tried to sell our design iGEM shirt to BGI’employees.<br/><br />
You may also order your own one <a href="https://docs.google.com/forms/d/1v8vvGN4TRq1yzLuKNed43mgl1KEyaWpOjh9VJfyNZqM/viewform">here</a>, if you’re in China.<br/><br />
<br />
<a name="Safety"></a></p><br />
<br/><br />
</div></div><br />
</article> <br />
</section><br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: #cff;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Safety</h2><br/><br />
<br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question1: Are you using the iGEM Software repository at github.com/igemsoftware?If you have instead stored your code elsewhere, please explain where and why you have put it there.If your code is not in the iGEM repository, are you using any version control system such as Git, CVS, or SVN?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. </p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question2:a. Does your software store any private data supplied by the user? (For example: the user's name and email address, passwords, DNA sequences, circuit designs, etc.) If yes, please describe what kind of data is stored. If no, skip the rest of this question and move on to question 3.</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. We store DNA sequences and circuit designs provided by users.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question2:b. What is the URL or IP address where the user's private data is stored? Where is the physical computer or hard drive that contains the user's private data?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:The server is still being constructed. </p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question2:c. Please describe any encryption, password protection, etc. that you use to protect the user's data. (It is not mandatory to have such protections, but if you do, describe them.)</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question3:Does your software include any other security features? Please describe them here.</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. The software can store the data provided by users and those produced step by step, so that user won't miss their result.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question4:Does your software let the user create a design by choosing parts/genes from a list/database, such as the Registry? If so, which lists/databases are included? Is there any restriction on which parts/genes the user can choose?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. KEGG, partsregistry, Codon usage database, SGD, VFDB, E. coli Genome Project. We have no restriction on genes the user can choose.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question5:Does your software allow users to write new data into any public lists or databases? If so, do you check the new data for errors before allowing it to be written?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:No.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question6:Does your software include any other features that encourage the user to create safe designs? Please describe them here.</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. We develop a plugin to show the relationship between the gene or artificial logic gate gene circuit to guide user to select their target genes safely. Besides, we have reminder about biosafely selection for users.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question7:Is your team also doing biological work in a wet lab?</p><a name="Collaboration"><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:No.</p><br />
<br />
<br />
</a> </div></div><br />
</article> <br />
</section><br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Collaboration</h2><br/><br />
<p class="ach"><br />
Cooperation: Shenzhen_BGIC_ATCG<br/><br />
We use NucleoMod to assist other wet team, Shenzhen_BGIC_ATCG, to design the biobrick optimized for eukaryons. <br/><br />
Below is one of the examples:<br/><br />
We transform the prokaryon version of cas9 for S.cerevisiae automatically.<br/><br />
Firstly, delete five enzymes of biobrick standard, EcoRI, XbaI, SpeI, PstI, NotI based on synonymous mutation of CDS.<br/><br />
<img src="https://static.igem.org/mediawiki/2013/e/e4/Ww1.png" /><br />
<img src="https://static.igem.org/mediawiki/2013/6/65/W2.png" width="100%" /><br />
<br />
Secondly, optimize the sequence for S.cerevisiae according to codon usage <a href="http://www.kazusa.or.jp/codon/ ">database</a>.<br/><br />
Finally, we recreate the sequence and annotation file.<br/><br />
We tried out SegmMan module to automatically split designed yeast_chr07_4_51 into 2k minichunks in command line.<br/><br />
After run the flow shell, SegmMan analyze the exited enzyme site along the sequence of yeast_chr07_4_51, and finally splited it into about 2k minichunks, so that we can synthesize these fragments and assemble them into whole.<br/><br />
The following is the final result of segmentations. yeast_chr07_4_51 is split into many 2k minichunks. After these fragments are synthesized, they can be assembled into whole step by step, from 2k to 10k to 30k to whole, according Gibson, Goldengate, Telomere Assembly.<br/><br />
On 2k and 10k level, they also have vectors homologous region and designed enzyme site, so that they can be preserved and cut out to use quickly. <br/><br />
<br />
</p><br />
</div></div><br />
</article> <br />
</section><br/><br />
<br/><br/><br/><br/><br/><br />
</div><!-- wrapper --><br />
<footer><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<script src="http://www.humaan.com.au/wp-content/themes/humaan/js/scripts.min.js" type="text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements
Team:Shenzhen BGIC 0101/Requirements
2013-10-20T09:24:04Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
.ans a{<br />
color:#f77;<br />
}<br />
.ans a:hover{<br />
color:#38f;<br />
text-decoration: none;<br />
}<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:250px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #1B1B1B;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<style><br />
.ach{<br />
text-indent: 1em;<br />
font-family: Century Gothic, Arial;<br />
}<br />
.que{<br />
color: #ADFFCF;<br />
}<br />
<br />
.ans a{<br />
color:#f77;<br />
}<br />
.ans a:hover{<br />
color:#38f;<br />
text-decoration: none;<br />
}<br />
</style><br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements#HumanPractices">Human Practices</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements#Safety">Safety</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements#Collaboration">Collaboration</a></div><br />
<br />
<br />
</div><br />
<div id="wrap" style="background:# ff9"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<div id="page-header" style="background: url(https://static.igem.org/mediawiki/2013/e/e5/Spor.jpg);height: 280px;box-shadow: 4px 3px 125px #cff;"><br />
<a name="HumanPractices"></a><h1></h1><br />
</div><br />
<br/><br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Human Practices</h2><br/><br />
<p class="ans"><br/><br />
1. Share Web-based server<br/><br />
2. Software assessment and comparison with BioStudio <br/><br />
3. Regional workshop<br/><br />
Regional workshop was held in BGI on May, 26th, 2013. As host, we invited 6 teams, SYSU-China, SYSU-Software, SCUT, SCAU-China, SUSTC-Shenzhen-A, SUSTC-Shenzhen-B. <br/><br />
Each team shared their ideas and progress, and even established cooperative intention:<br/><br />
DNA material shares among teams, SUSTC-Shenzhen-A assisted BGIC_Shenzhen_ATCG to purchase experimental material.<br/><br />
You can find the news <a href=" http://www.genomics.cn/news/show_news?nid=99539">here</a>.<br/><br />
4. Talk with Dr. Patrick Yizhi Cai<br/><br />
Dr. Patrick Cai is the Autodesk distinguished scholar and a Principal Investigator (with Chancellor's Fellowship), who directs the group of synthetic genomics in the university of Edinburgh. His research focuses on neochromosome design, computer assisted design for synbio and large scale DNA synthesis automation. So he is the most authoritative scholar for Genovo.<br/><br />
He came to BGI on Sep, 26th, 2013 and talk with us about Genovo's design and application.<br />
"Genovo is quite a neat idea." Quoted as Cai.<br/><br />
5. T-shirt sale<br/><br />
We tried to sell our design iGEM shirt to BGI’employees.<br/><br />
You may also order your own one <a href="https://docs.google.com/forms/d/1v8vvGN4TRq1yzLuKNed43mgl1KEyaWpOjh9VJfyNZqM/viewform">here</a>, if you’re in China.<br/><br />
<br />
<a name="Safety"></a></p><br />
<br/><br />
</div></div><br />
</article> <br />
</section><br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: #cff;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Safety</h2><br/><br />
<br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question1: Are you using the iGEM Software repository at github.com/igemsoftware?If you have instead stored your code elsewhere, please explain where and why you have put it there.If your code is not in the iGEM repository, are you using any version control system such as Git, CVS, or SVN?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. </p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question2:a. Does your software store any private data supplied by the user? (For example: the user's name and email address, passwords, DNA sequences, circuit designs, etc.) If yes, please describe what kind of data is stored. If no, skip the rest of this question and move on to question 3.</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. We store DNA sequences and circuit designs provided by users.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question2:b. What is the URL or IP address where the user's private data is stored? Where is the physical computer or hard drive that contains the user's private data?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:The server is still being constructed. </p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question2:c. Please describe any encryption, password protection, etc. that you use to protect the user's data. (It is not mandatory to have such protections, but if you do, describe them.)</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question3:Does your software include any other security features? Please describe them here.</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. The software can store the data provided by users and those produced step by step, so that user won't miss their result.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question4:Does your software let the user create a design by choosing parts/genes from a list/database, such as the Registry? If so, which lists/databases are included? Is there any restriction on which parts/genes the user can choose?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. KEGG, partsregistry, Codon usage database, SGD, VFDB, E. coli Genome Project. We have no restriction on genes the user can choose.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question5:Does your software allow users to write new data into any public lists or databases? If so, do you check the new data for errors before allowing it to be written?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:No.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question6:Does your software include any other features that encourage the user to create safe designs? Please describe them here.</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. We develop a plugin to show the relationship between the gene or artificial logic gate gene circuit to guide user to select their target genes safely. Besides, we have reminder about biosafely selection for users.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question7:Is your team also doing biological work in a wet lab?</p><a name="Collaboration"><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:No.</p><br />
<br />
<br />
</a> </div></div><br />
</article> <br />
</section><br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Collaboration</h2><br/><br />
<p class="ach"><br />
Cooperation: Shenzhen_BGIC_ATCG<br/><br />
We use NucleoMod to assist other wet team, Shenzhen_BGIC_ATCG, to design the biobrick optimized for eukaryons. <br/><br />
Below is one of the examples:<br/><br />
We transform the prokaryon version of cas9 for S.cerevisiae automatically.<br/><br />
Firstly, delete five enzymes of biobrick standard, EcoRI, XbaI, SpeI, PstI, NotI based on synonymous mutation of CDS.<br/><br />
<img src="https://static.igem.org/mediawiki/2013/e/e4/Ww1.png" /><br />
<img src="https://static.igem.org/mediawiki/2013/6/65/W2.png" /><br />
<br />
Secondly, optimize the sequence for S.cerevisiae according to codon usage <a href="http://www.kazusa.or.jp/codon/ ">database</a>.<br/><br />
Finally, we recreate the sequence and annotation file.<br/><br />
We tried out SegmMan module to automatically split designed yeast_chr07_4_51 into 2k minichunks in command line.<br/><br />
After run the flow shell, SegmMan analyze the exited enzyme site along the sequence of yeast_chr07_4_51, and finally splited it into about 2k minichunks, so that we can synthesize these fragments and assemble them into whole.<br/><br />
The following is the final result of segmentations. yeast_chr07_4_51 is split into many 2k minichunks. After these fragments are synthesized, they can be assembled into whole step by step, from 2k to 10k to 30k to whole, according Gibson, Goldengate, Telomere Assembly.<br/><br />
On 2k and 10k level, they also have vectors homologous region and designed enzyme site, so that they can be preserved and cut out to use quickly. <br/><br />
<br />
</p><br />
</div></div><br />
</article> <br />
</section><br/><br />
<br/><br/><br/><br/><br/><br />
</div><!-- wrapper --><br />
<footer><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<script src="http://www.humaan.com.au/wp-content/themes/humaan/js/scripts.min.js" type="text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements
Team:Shenzhen BGIC 0101/Requirements
2013-10-20T09:23:11Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
.ans a{<br />
color:#f77;<br />
}<br />
.ans a:hover{<br />
color:#38f;<br />
text-decoration: none;<br />
}<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:250px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #1B1B1B;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<style><br />
.ach{<br />
text-indent: 1em;<br />
font-family: Century Gothic, Arial;<br />
}<br />
.que{<br />
color: #ADFFCF;<br />
}<br />
<br />
.ans a{<br />
color:#f77;<br />
}<br />
.ans a:hover{<br />
color:#38f;<br />
text-decoration: none;<br />
}<br />
</style><br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements#HumanPractices">Human Practices</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements#Safety">Safety</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements#Collaboration">Collaboration</a></div><br />
<br />
<br />
</div><br />
<div id="wrap" style="background:# ff9"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<div id="page-header" style="background: url(https://static.igem.org/mediawiki/2013/e/e5/Spor.jpg);height: 300px;box-shadow: 4px 3px 25px #cff;"><br />
<a name="HumanPractices"></a><h1></h1><br />
</div><br />
<br/><br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Human Practices</h2><br/><br />
<p class="ans"><br/><br />
1. Share Web-based server<br/><br />
2. Software assessment and comparison with BioStudio <br/><br />
3. Regional workshop<br/><br />
Regional workshop was held in BGI on May, 26th, 2013. As host, we invited 6 teams, SYSU-China, SYSU-Software, SCUT, SCAU-China, SUSTC-Shenzhen-A, SUSTC-Shenzhen-B. <br/><br />
Each team shared their ideas and progress, and even established cooperative intention:<br/><br />
DNA material shares among teams, SUSTC-Shenzhen-A assisted BGIC_Shenzhen_ATCG to purchase experimental material.<br/><br />
You can find the news <a href=" http://www.genomics.cn/news/show_news?nid=99539">here</a>.<br/><br />
4. Talk with Dr. Patrick Yizhi Cai<br/><br />
Dr. Patrick Cai is the Autodesk distinguished scholar and a Principal Investigator (with Chancellor's Fellowship), who directs the group of synthetic genomics in the university of Edinburgh. His research focuses on neochromosome design, computer assisted design for synbio and large scale DNA synthesis automation. So he is the most authoritative scholar for Genovo.<br/><br />
He came to BGI on Sep, 26th, 2013 and talk with us about Genovo's design and application.<br />
"Genovo is quite a neat idea." Quoted as Cai.<br/><br />
5. T-shirt sale<br/><br />
We tried to sell our design iGEM shirt to BGI’employees.<br/><br />
You may also order your own one <a href="https://docs.google.com/forms/d/1v8vvGN4TRq1yzLuKNed43mgl1KEyaWpOjh9VJfyNZqM/viewform">here</a>, if you’re in China.<br/><br />
<br />
<a name="Safety"></a></p><br />
<br/><br />
</div></div><br />
</article> <br />
</section><br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: #cff;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Safety</h2><br/><br />
<br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question1: Are you using the iGEM Software repository at github.com/igemsoftware?If you have instead stored your code elsewhere, please explain where and why you have put it there.If your code is not in the iGEM repository, are you using any version control system such as Git, CVS, or SVN?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. </p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question2:a. Does your software store any private data supplied by the user? (For example: the user's name and email address, passwords, DNA sequences, circuit designs, etc.) If yes, please describe what kind of data is stored. If no, skip the rest of this question and move on to question 3.</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. We store DNA sequences and circuit designs provided by users.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question2:b. What is the URL or IP address where the user's private data is stored? Where is the physical computer or hard drive that contains the user's private data?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:The server is still being constructed. </p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question2:c. Please describe any encryption, password protection, etc. that you use to protect the user's data. (It is not mandatory to have such protections, but if you do, describe them.)</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question3:Does your software include any other security features? Please describe them here.</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. The software can store the data provided by users and those produced step by step, so that user won't miss their result.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question4:Does your software let the user create a design by choosing parts/genes from a list/database, such as the Registry? If so, which lists/databases are included? Is there any restriction on which parts/genes the user can choose?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. KEGG, partsregistry, Codon usage database, SGD, VFDB, E. coli Genome Project. We have no restriction on genes the user can choose.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question5:Does your software allow users to write new data into any public lists or databases? If so, do you check the new data for errors before allowing it to be written?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:No.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question6:Does your software include any other features that encourage the user to create safe designs? Please describe them here.</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. We develop a plugin to show the relationship between the gene or artificial logic gate gene circuit to guide user to select their target genes safely. Besides, we have reminder about biosafely selection for users.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question7:Is your team also doing biological work in a wet lab?</p><a name="Collaboration"><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:No.</p><br />
<br />
<br />
</a> </div></div><br />
</article> <br />
</section><br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Collaboration</h2><br/><br />
<p class="ach"><br />
Cooperation: Shenzhen_BGIC_ATCG<br/><br />
We use NucleoMod to assist other wet team, Shenzhen_BGIC_ATCG, to design the biobrick optimized for eukaryons. <br/><br />
Below is one of the examples:<br/><br />
We transform the prokaryon version of cas9 for S.cerevisiae automatically.<br/><br />
Firstly, delete five enzymes of biobrick standard, EcoRI, XbaI, SpeI, PstI, NotI based on synonymous mutation of CDS.<br/><br />
<img src="https://static.igem.org/mediawiki/2013/e/e4/Ww1.png" /><br />
<img src="https://static.igem.org/mediawiki/2013/6/65/W2.png" /><br />
<br />
Secondly, optimize the sequence for S.cerevisiae according to codon usage <a href="http://www.kazusa.or.jp/codon/ ">database</a>.<br/><br />
Finally, we recreate the sequence and annotation file.<br/><br />
We tried out SegmMan module to automatically split designed yeast_chr07_4_51 into 2k minichunks in command line.<br/><br />
After run the flow shell, SegmMan analyze the exited enzyme site along the sequence of yeast_chr07_4_51, and finally splited it into about 2k minichunks, so that we can synthesize these fragments and assemble them into whole.<br/><br />
The following is the final result of segmentations. yeast_chr07_4_51 is split into many 2k minichunks. After these fragments are synthesized, they can be assembled into whole step by step, from 2k to 10k to 30k to whole, according Gibson, Goldengate, Telomere Assembly.<br/><br />
On 2k and 10k level, they also have vectors homologous region and designed enzyme site, so that they can be preserved and cut out to use quickly. <br/><br />
<br />
</p><br />
</div></div><br />
</article> <br />
</section><br/><br />
<br/><br/><br/><br/><br/><br/><br/><br/><br />
</div><!-- wrapper --><br />
<footer><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<script src="http://www.humaan.com.au/wp-content/themes/humaan/js/scripts.min.js" type="text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements
Team:Shenzhen BGIC 0101/Requirements
2013-10-20T09:21:35Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
.ans a{<br />
color:#f77;<br />
}<br />
.ans a:hover{<br />
color:#38f;<br />
text-decoration: none;<br />
}<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:250px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #1B1B1B;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<!--[if lte IE 8]><link rel="stylesheet" href="http://www.humaan.com.au/wp-content/themes/humaan/css/iestyle.css"><![endif]--><br />
<!--[if IE 9]><link rel="stylesheet" href="http://www.humaan.com.au/wp-content/themes/humaan/css/ie9.css"><![endif]--><br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<style><br />
.ach{<br />
text-indent: 1em;<br />
font-family: Century Gothic, Arial;<br />
}<br />
.que{<br />
color: #ADFFCF;<br />
}<br />
<br />
.ans a{<br />
color:#f77;<br />
}<br />
.ans a:hover{<br />
color:#38f;<br />
text-decoration: none;<br />
}<br />
</style><br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements#HumanPractices">Human Practices</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements#Safety">Safety</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements#Collaboration">Collaboration</a></div><br />
<br />
<br />
</div><br />
<div id="wrap" style="background:# ff9"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<div id="page-header" style="background: url(https://static.igem.org/mediawiki/2013/e/e5/Spor.jpg);height: 300px;box-shadow: 4px 3px 25px #000;"><br />
<a name="HumanPractices"></a><h1></h1><br />
</div><br />
<br/><br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Human Practices</h2><br/><br />
<p class="ans"><br/><br />
1. Share Web-based server<br/><br />
2. Software assessment and comparison with BioStudio <br/><br />
3. Regional workshop<br/><br />
Regional workshop was held in BGI on May, 26th, 2013. As host, we invited 6 teams, SYSU-China, SYSU-Software, SCUT, SCAU-China, SUSTC-Shenzhen-A, SUSTC-Shenzhen-B. <br/><br />
Each team shared their ideas and progress, and even established cooperative intention:<br/><br />
DNA material shares among teams, SUSTC-Shenzhen-A assisted BGIC_Shenzhen_ATCG to purchase experimental material.<br/><br />
You can find the news <a href=" http://www.genomics.cn/news/show_news?nid=99539">here</a>.<br/><br />
4. Talk with Dr. Patrick Yizhi Cai<br/><br />
Dr. Patrick Cai is the Autodesk distinguished scholar and a Principal Investigator (with Chancellor's Fellowship), who directs the group of synthetic genomics in the university of Edinburgh. His research focuses on neochromosome design, computer assisted design for synbio and large scale DNA synthesis automation. So he is the most authoritative scholar for Genovo.<br/><br />
He came to BGI on Sep, 26th, 2013 and talk with us about Genovo's design and application.<br />
"Genovo is quite a neat idea." Quoted as Cai.<br/><br />
5. T-shirt sale<br/><br />
We tried to sell our design iGEM shirt to BGI’employees.<br/><br />
You may also order your own one <a href="https://docs.google.com/forms/d/1v8vvGN4TRq1yzLuKNed43mgl1KEyaWpOjh9VJfyNZqM/viewform">here</a>, if you’re in China.<br/><br />
<br />
<a name="Safety"></a></p><br />
<br/><br />
</div></div><br />
</article> <br />
</section><br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: #cff;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Safety</h2><br/><br />
<br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question1: Are you using the iGEM Software repository at github.com/igemsoftware?If you have instead stored your code elsewhere, please explain where and why you have put it there.If your code is not in the iGEM repository, are you using any version control system such as Git, CVS, or SVN?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. </p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question2:a. Does your software store any private data supplied by the user? (For example: the user's name and email address, passwords, DNA sequences, circuit designs, etc.) If yes, please describe what kind of data is stored. If no, skip the rest of this question and move on to question 3.</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. We store DNA sequences and circuit designs provided by users.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question2:b. What is the URL or IP address where the user's private data is stored? Where is the physical computer or hard drive that contains the user's private data?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:The server is still being constructed. </p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question2:c. Please describe any encryption, password protection, etc. that you use to protect the user's data. (It is not mandatory to have such protections, but if you do, describe them.)</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question3:Does your software include any other security features? Please describe them here.</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. The software can store the data provided by users and those produced step by step, so that user won't miss their result.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question4:Does your software let the user create a design by choosing parts/genes from a list/database, such as the Registry? If so, which lists/databases are included? Is there any restriction on which parts/genes the user can choose?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. KEGG, partsregistry, Codon usage database, SGD, VFDB, E. coli Genome Project. We have no restriction on genes the user can choose.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question5:Does your software allow users to write new data into any public lists or databases? If so, do you check the new data for errors before allowing it to be written?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:No.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question6:Does your software include any other features that encourage the user to create safe designs? Please describe them here.</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. We develop a plugin to show the relationship between the gene or artificial logic gate gene circuit to guide user to select their target genes safely. Besides, we have reminder about biosafely selection for users.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question7:Is your team also doing biological work in a wet lab?</p><a name="Collaboration"><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:No.</p><br />
<br />
<br />
</a> </div></div><br />
</article> <br />
</section><br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Collaboration</h2><br/><br />
<p class="ach"><br />
Cooperation: Shenzhen_BGIC_ATCG<br/><br />
We use NucleoMod to assist other wet team, Shenzhen_BGIC_ATCG, to design the biobrick optimized for eukaryons. <br/><br />
Below is one of the examples:<br/><br />
We transform the prokaryon version of cas9 for S.cerevisiae automatically.<br/><br />
Firstly, delete five enzymes of biobrick standard, EcoRI, XbaI, SpeI, PstI, NotI based on synonymous mutation of CDS.<br/><br />
<img src="https://static.igem.org/mediawiki/2013/e/e4/Ww1.png" /><br />
<img src="https://static.igem.org/mediawiki/2013/6/65/W2.png" /><br />
<br />
Secondly, optimize the sequence for S.cerevisiae according to codon usage <a href="http://www.kazusa.or.jp/codon/ ">database</a>.<br/><br />
Finally, we recreate the sequence and annotation file.<br/><br />
We tried out SegmMan module to automatically split designed yeast_chr07_4_51 into 2k minichunks in command line.<br/><br />
After run the flow shell, SegmMan analyze the exited enzyme site along the sequence of yeast_chr07_4_51, and finally splited it into about 2k minichunks, so that we can synthesize these fragments and assemble them into whole.<br/><br />
The following is the final result of segmentations. yeast_chr07_4_51 is split into many 2k minichunks. After these fragments are synthesized, they can be assembled into whole step by step, from 2k to 10k to 30k to whole, according Gibson, Goldengate, Telomere Assembly.<br/><br />
On 2k and 10k level, they also have vectors homologous region and designed enzyme site, so that they can be preserved and cut out to use quickly. <br/><br />
<br />
</p><br />
</div></div><br />
</article> <br />
</section><br/><br />
<br/><br/><br/><br/><br/><br/><br/><br/><br />
</div><!-- wrapper --><br />
<footer><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<script src="http://www.humaan.com.au/wp-content/themes/humaan/js/scripts.min.js" type="text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements
Team:Shenzhen BGIC 0101/Requirements
2013-10-20T09:19:30Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
.ans a{<br />
color:#f77;<br />
}<br />
.ans a:hover{<br />
color:#38f;<br />
text-decoration: none;<br />
}<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:250px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #1B1B1B;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<!--[if lte IE 8]><link rel="stylesheet" href="http://www.humaan.com.au/wp-content/themes/humaan/css/iestyle.css"><![endif]--><br />
<!--[if IE 9]><link rel="stylesheet" href="http://www.humaan.com.au/wp-content/themes/humaan/css/ie9.css"><![endif]--><br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<style><br />
.ach{<br />
text-indent: 1em;<br />
font-family: Century Gothic, Arial;<br />
}<br />
.que{<br />
color: #ADFFCF;<br />
}<br />
<br />
.ans a{<br />
color:#f77;<br />
}<br />
.ans a:hover{<br />
color:#38f;<br />
text-decoration: none;<br />
}<br />
</style><br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements#HumanPractices">Human Practices</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements#Safety">Safety</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements#Collaboration">Collaboration</a></div><br />
<br />
<br />
</div><br />
<div id="wrap" style="background:# ff9"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<div id="page-header" style="background: url(https://static.igem.org/mediawiki/2013/e/e5/Spor.jpg);height: 300px;box-shadow: 4px 3px 25px #000;"><br />
<a name="HumanPractices"></a><h1></h1><br />
</div><br />
<br/><br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: #cf9;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Human Practices</h2><br/><br />
<p class="ans"><br/><br />
1. Share Web-based server<br/><br />
2. Software assessment and comparison with BioStudio <br/><br />
3. Regional workshop<br/><br />
Regional workshop was held in BGI on May, 26th, 2013. As host, we invited 6 teams, SYSU-China, SYSU-Software, SCUT, SCAU-China, SUSTC-Shenzhen-A, SUSTC-Shenzhen-B. <br/><br />
Each team shared their ideas and progress, and even established cooperative intention:<br/><br />
DNA material shares among teams, SUSTC-Shenzhen-A assisted BGIC_Shenzhen_ATCG to purchase experimental material.<br/><br />
You can find the news <a href=" http://www.genomics.cn/news/show_news?nid=99539">here</a>.<br/><br />
4. Talk with Dr. Patrick Yizhi Cai<br/><br />
Dr. Patrick Cai is the Autodesk distinguished scholar and a Principal Investigator (with Chancellor's Fellowship), who directs the group of synthetic genomics in the university of Edinburgh. His research focuses on neochromosome design, computer assisted design for synbio and large scale DNA synthesis automation. So he is the most authoritative scholar for Genovo.<br/><br />
He came to BGI on Sep, 26th, 2013 and talk with us about Genovo's design and application.<br />
"Genovo is quite a neat idea." Quoted as Cai.<br/><br />
5. T-shirt sale<br/><br />
We tried to sell our design iGEM shirt to BGI’employees.<br/><br />
You may also order your own one <a href="https://docs.google.com/forms/d/1v8vvGN4TRq1yzLuKNed43mgl1KEyaWpOjh9VJfyNZqM/viewform">here</a>, if you’re in China.<br/><br />
<br />
<a name="Safety"></a></p><br />
<br/><br />
</div></div><br />
</article> <br />
</section><br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: rgba(29, 28, 28, 0.79);"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Safety</h2><br/><br />
<br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question1: Are you using the iGEM Software repository at github.com/igemsoftware?If you have instead stored your code elsewhere, please explain where and why you have put it there.If your code is not in the iGEM repository, are you using any version control system such as Git, CVS, or SVN?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. </p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question2:a. Does your software store any private data supplied by the user? (For example: the user's name and email address, passwords, DNA sequences, circuit designs, etc.) If yes, please describe what kind of data is stored. If no, skip the rest of this question and move on to question 3.</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. We store DNA sequences and circuit designs provided by users.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question2:b. What is the URL or IP address where the user's private data is stored? Where is the physical computer or hard drive that contains the user's private data?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:The server is still being constructed. </p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question2:c. Please describe any encryption, password protection, etc. that you use to protect the user's data. (It is not mandatory to have such protections, but if you do, describe them.)</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question3:Does your software include any other security features? Please describe them here.</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. The software can store the data provided by users and those produced step by step, so that user won't miss their result.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question4:Does your software let the user create a design by choosing parts/genes from a list/database, such as the Registry? If so, which lists/databases are included? Is there any restriction on which parts/genes the user can choose?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. KEGG, partsregistry, Codon usage database, SGD, VFDB, E. coli Genome Project. We have no restriction on genes the user can choose.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question5:Does your software allow users to write new data into any public lists or databases? If so, do you check the new data for errors before allowing it to be written?</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:No.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question6:Does your software include any other features that encourage the user to create safe designs? Please describe them here.</p><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:Yes. We develop a plugin to show the relationship between the gene or artificial logic gate gene circuit to guide user to select their target genes safely. Besides, we have reminder about biosafely selection for users.</p><br />
<p class="que"><img src="https://static.igem.org/mediawiki/2013/c/c0/Quest.png" width="30px" height="30px"/>Question7:Is your team also doing biological work in a wet lab?</p><a name="Collaboration"><br />
<p><img src="https://static.igem.org/mediawiki/2013/e/ef/Answer.png" width="30px" height="30px"/>Answer:No.</p><br />
<br />
<br />
</a> </div></div><br />
</article> <br />
</section><br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: rgba(29, 28, 28, 0.79);"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Collaboration</h2><br/><br />
<p class="ach"><br />
Cooperation: Shenzhen_BGIC_ATCG<br/><br />
We use NucleoMod to assist other wet team, Shenzhen_BGIC_ATCG, to design the biobrick optimized for eukaryons. <br/><br />
Below is one of the examples:<br/><br />
We transform the prokaryon version of cas9 for S.cerevisiae automatically.<br/><br />
Firstly, delete five enzymes of biobrick standard, EcoRI, XbaI, SpeI, PstI, NotI based on synonymous mutation of CDS.<br/><br />
<img src="https://static.igem.org/mediawiki/2013/e/e4/Ww1.png" /><br />
<img src="https://static.igem.org/mediawiki/2013/6/65/W2.png" /><br />
<br />
Secondly, optimize the sequence for S.cerevisiae according to codon usage <a href="http://www.kazusa.or.jp/codon/ ">database</a>.<br/><br />
Finally, we recreate the sequence and annotation file.<br/><br />
We tried out SegmMan module to automatically split designed yeast_chr07_4_51 into 2k minichunks in command line.<br/><br />
After run the flow shell, SegmMan analyze the exited enzyme site along the sequence of yeast_chr07_4_51, and finally splited it into about 2k minichunks, so that we can synthesize these fragments and assemble them into whole.<br/><br />
The following is the final result of segmentations. yeast_chr07_4_51 is split into many 2k minichunks. After these fragments are synthesized, they can be assembled into whole step by step, from 2k to 10k to 30k to whole, according Gibson, Goldengate, Telomere Assembly.<br/><br />
On 2k and 10k level, they also have vectors homologous region and designed enzyme site, so that they can be preserved and cut out to use quickly. <br/><br />
<br />
</p><br />
</div></div><br />
</article> <br />
</section><br/><br />
<br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br />
</div><!-- wrapper --><br />
<footer><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<script src="http://www.humaan.com.au/wp-content/themes/humaan/js/scripts.min.js" type="text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria
Team:Shenzhen BGIC 0101/Criteria
2013-10-20T09:17:38Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<!--[if lte IE 8]><link rel="stylesheet" href="http://www.humaan.com.au/wp-content/themes/humaan/css/iestyle.css"><![endif]--><br />
<!--[if IE 9]><link rel="stylesheet" href="http://www.humaan.com.au/wp-content/themes/humaan/css/ie9.css"><![endif]--><br />
<br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<br />
<style><br />
.ans{<br />
margin-left:50px;<br />
color:#fcc;<br />
line-height: 1.5em;<br />
}<br />
.ans a{<br />
color:#f77;<br />
}<br />
.ans a:hover{<br />
color:#38f;<br />
text-decoration: none;<br />
}<br />
.container{<br />
width:930px;<br />
}<br />
.que{<br />
color: #ADFFCF;<br />
line-height: 1.5em;<br />
}<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="wrap" style="background:#ff9;"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: url(https://static.igem.org/mediawiki/2013/7/7a/Backg.jpg);height: 154px;box-shadow: 4px 3px 25px #000;"><br />
<h1></h1><br />
</div><br />
<br/><br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: #cf9"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Bronze Medal</h2><br/><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>Register the team, have a great summer, and have fun attending the Jamboree.<br />
</p><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>Create and share a description of the team's project via the iGEM wiki.<br />
</p><br />
<p class="ans"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software">Overview of project</a></p><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>Present a Poster and Talk at the iGEM Jamboree.<br />
</p><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>Develop and make available via the The Registry of Software Tools an open source software tool that supports synthetic biology based on BioBrick standard biological parts <br />
</p><br />
<p class="ans">Our software in <a href="https://github.com/igemsoftware/Shenzhen_BGIC_0101_2013">Github</a>.<br/><br />
Note:<br/><br />
Our giant software aims at operating Biobrick of device level based on synthesized DNA fragments.<br/>But for biobrick level, the second module can also assist users to design genes, such as deletion of EcorI, XbaI, SpeI, PstI, Not I in the CDS, codon optimization and repeat smash. <br />
</p><br />
<br/><h2>Silver Medal</h2><br/><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>A. Provide a detailed, draft specification for the next version of your software tool. As our project is so large and extensible greatly, at least 5 ideas can’t be realized due to time limitation.<br />
</p><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>B. Provide a second, distinct (yet complementary) software tools project. For the third module SegmMan, we have a complementary design & synthesis method OLS chip synthesis, so that Genovo is compatible for both synthesizer and chip.<br />
</p><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>Provide a demonstration of their software either as a textual or video tutorial made available on their wiki.<br />
</p><br />
<p class="ans">Textual <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">tutorial</a></p><br />
<br/><h2>Gold Medal</h2><br/><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>Have another team utilize the software developed by your team. You must clearly show how your software was used and the results that were obtained.<br />
</p><br />
<p class="ans">We have software team Shenzhen_BGIC_ATCG to use the second module to design their genes. SC2.0 project also try out SegmMan module on chrVII’s segmentation.</p><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>A. Outline and detail how your software effects Human Practices in Synthetic Biology.<br />
</p><br />
<p class="ans">Share:<br/><br />
Web-based server for public to use Software assessment and comparison with Biostudio.<br/><br />
Innovation:<br/><br />
We interview with core leader, Dr. Patrick Yizhi Cai and talk about Genovo’s design and application.<br/><br />
Advertisement:<br/><br />
We tried to sell our team shirts to people from BGI.<br/><br />
</p><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>B. Use SBOL in your software documentation.<br />
</p><br />
<p class="ans">We use SBOL as one of the output of first module to describe the genes in new created pathway.</p><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>A. Develop and document a new technical standard that supports one of the following:<br />
</p> <br />
<p class="ans">a. Design of BioBrick Parts or Devices<br/><br />
Chromosome Design Standard<br/><br />
Design Operation Standard<br/><br />
b. Construction of BioBrick Parts or Devices<br/><br />
Assembly Strategy Standard<br />
</p><br />
</div></div><br />
</article> <br />
</section><br />
<!--<br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: rgba(29, 28, 28, 0.79);"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Special Awards</h2><br/><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>test<br />
</p><br />
<br />
</div></div><br />
</article> <br />
</section><br />
--><br />
<br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/humaan?action=raw&ctype=text/javascript" type="text/javascript"></script><br />
<br />
</html><br />
{{Scroll}}</div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/style
Team:Shenzhen BGIC 0101/style
2013-10-20T09:16:29Z
<p>Czh: </p>
<hr />
<div>@font-face {<br />
font-family: 'Tangerine';<br />
font-style: normal;<br />
font-weight: 400;<br />
src: local('Tangerine'), url(http://themes.googleusercontent.com/static/fonts/tangerine/v3/HGfsyCL5WASpHOFnouG-RD8E0i7KZn-EPnyo3HZu7kw.woff) format('woff');<br />
}<br />
<br />
html, body, div, span, applet, object, iframe, h1, h2, h3, h4, h5, h6, p, blockquote, pre, a, abbr, acronym, address, big, cite, code, del, dfn, em, img, ins, kbd, q, s, samp, small, strike, strong, sub, sup, tt, var, b, u, i, center, dl, dt, dd, ol, ul, li, fieldset, form, label, legend, table, caption, tbody, tfoot, thead, tr, th, td, article, aside, canvas, details, embed, figure, figcaption, footer, header, hgroup, menu, nav, output, ruby, section, summary, time, mark, audio, video {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-size: 100%;<br />
font: inherit;<br />
vertical-align: baseline;<br />
letter-spacing: 0.05em;<br />
}<br />
article, aside, details, figcaption, figure, footer, header, hgroup, menu, nav, section {<br />
display: block;<br />
}<br />
body {<br />
line-height: 1;<br />
}<br />
ol, ul {<br />
list-style: none;<br />
}<br />
<br />
p, ul, ol {<br />
margin: 0 0 0px; <br />
<br />
}<br />
ul, ol {<br />
padding: 1.5em 0 0 2.5em;<br />
}<br />
<br />
<br />
body {<br />
/* background: #f2f2f2;*/<br />
background: #262626;<br />
font-family: "proxima-nova", "HelveticaNeue", "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
font-size: 14px;<br />
line-height: 21px;<br />
color: #262626;<br />
-webkit-font-smoothing: antialiased;<br />
-webkit-text-size-adjust: 100%}<br />
html, body {<br />
height: 100%}<br />
#wrap {<br />
background: #ff9;<br />
background-size:cover;<br />
margin-bottom: 0px;<br />
min-height: 100%;<br />
height: auto!important;<br />
height: 100%}<br />
.push {<br />
height: 45px;<br />
}<br />
p img {<br />
margin: 0;<br />
}<br />
em {<br />
font-style: italic;<br />
}<br />
strong {<br />
font-weight: bold;<br />
}<br />
hr {<br />
border: solid #ddd;<br />
border-width: 1px 0 0;<br />
clear: both;<br />
margin: 10px 0 30px;<br />
height: 0;<br />
}<br />
a, a:visited {<br />
color: #666;<br />
text-decoration: none;<br />
outline: 0;<br />
}<br />
a:hover, a:focus {<br />
color: #333;<br />
}<br />
p a, p a:visited {<br />
line-height: inherit;<br />
}<br />
img.scale-with-grid {<br />
max-width: 100%;<br />
height: auto;<br />
}<br />
<br />
header {<br />
width: 100%;<br />
height: 90px;<br />
background: #222;<br />
background: rgba(0, 0, 0, .2);<br />
border-color: #fff;<br />
border-bottom: 1px solid rgba(255, 255, 255, .25);<br />
position: fixed;<br />
top: 0;<br />
z-index: 10;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
-ms-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
}<br />
header.sticky {<br />
height: 60px;<br />
background: #993399;<br />
border: 0;<br />
box-shadow: 0 1px 6px rgba(0, 0, 0, .2);<br />
}<br />
header h1 {<br />
margin: 0;<br />
}<br />
#logo {<br />
width: 84px;<br />
height: 59px;<br />
display: block;<br />
background: url(https://static.igem.org/mediawiki/igem.org/e/e8/Genovo-logo.png) no-repeat;<br />
text-indent: -99999em;<br />
position: absolute;<br />
top: 15px;<br />
left: 15px;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
}<br />
#logo1{<br />
width: 80px;<br />
height: 60px;<br />
display: block;<br />
background: url(https://static.igem.org/mediawiki/2013/d/dd/Igem_logo12.png) no-repeat;<br />
text-indent: -99999em;<br />
position: absolute;<br />
top: 15px;<br />
right: 10px;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
z-index:9999;<br />
}<br />
nav {<br />
text-align: center;<br />
margin-top: 35px;<br />
-webkit-transition: margin .2s ease-in-out;<br />
-moz-transition: margin .2s ease-in-out;<br />
transition: margin .2s ease-in-out;<br />
}<br />
.sticky nav {<br />
margin-top: 20px;<br />
}<br />
nav a, #start-project {<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
color: #555;<br />
text-shadow: 0 1px 0 #fff;<br />
padding: 16px;<br />
font-size: 14px;<br />
}<br />
.light nav a {<br />
color: #ddd;/* top-nav color */<br />
text-shadow: 0 1px 0 rgba(0, 0, 0, .5);<br />
opacity: .5;<br />
-webkit-transition: opacity .1s linear;<br />
-moz-transition: opacity .1s linear;<br />
transition: opacity .1s linear;<br />
}<br />
nav a.current-menu-item, nav a.current_page_parent, nav a:hover, .single-work .light nav a.menu-item-18, .single-lab .light nav a.menu-item-17, .single-post .light nav a.menu-item-16 {<br />
opacity: 1;<br />
}<br />
.single-work nav a.current_page_parent, .single-lab nav a.current_page_parent {<br />
opacity: .5;<br />
}<br />
#blog {<br />
z-index: 6;<br />
}<br />
#blog article {<br />
margin: 10px auto 60px;<br />
max-width: 700px;<br />
position: relative;<br />
}<br />
<br />
<br />
#home-content h2, #fresh h2, h2.section-title {<br />
color: #358;<br />
font-size: 12px;<br />
text-shadow: 0 1px 0 #fff;<br />
font-weight: 600;<br />
width: 150px;<br />
background: #aaa;<br />
margin: -20px auto 20px;<br />
text-align: center;<br />
}<br />
#home-content .column, #fresh {<br />
border-top: 1px solid #d0d0d0;<br />
}<br />
#home-content .one-third {<br />
float: right!important;<br />
}<br />
.mini-post {<br />
float: left;<br />
background: #fff;<br />
box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
border-radius: 2px;<br />
overflow: hidden;<br />
width: 290px;<br />
-webkit-transition: all .2s ease-out;<br />
-moz-transition: all .2s ease-out;<br />
transition: all .2s ease-out;<br />
color: #333;<br />
min-height: 320px;<br />
cursor: pointer;<br />
}<br />
.mini-post:hover {<br />
margin-top: -5px;<br />
box-shadow: 0 3px 3px 0 rgba(0, 0, 0, .4);<br />
}<br />
.mini-post .text {<br />
padding: 20px 20px 10px;<br />
}<br />
.mini-post h3 {<br />
font-size: 16px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
margin: 0;<br />
}<br />
.mini-post .meta {<br />
font-size: 11px;<br />
}<br />
.mini-post p {<br />
font-size: 13px;<br />
}<br />
.mini-post .more {<br />
font-weight: 600;<br />
}<br />
#tweet {<br />
margin: 40px auto;<br />
padding-top: 40px;<br />
border-top: 1px solid #d0d0d0;<br />
}<br />
#tweet .text {<br />
padding: 0 90px;<br />
background: url(art/bird.svg) no-repeat 35px 0;<br />
font-size: 26px;<br />
font-weight: 300;<br />
}<br />
#tweet .text p {<br />
margin: 0 0 10px;<br />
text-align: center;<br />
line-height: 36px;<br />
}<br />
#tweet .text p.author {<br />
font-size: 20px;<br />
}<br />
#page-header {<br />
width: auto;<br />
// height: 220px;<br />
//background: url(https://static.igem.org/mediawiki/2013/3/34/Test-head.jpg) top center;<br />
margin: 0 0 35px;<br />
box-shadow: 2px 1px 12px #272727;<br />
<br />
}<br />
.wf-loading #page-header h1 {<br />
visibility: hidden;<br />
}<br />
<br />
.blog #page-header {<br />
// background: url(https://static.igem.org/mediawiki/2013/3/34/Test-head.jpg) top center;<br />
}<br />
#page-header h1 {<br />
font-family: "abril-fatface", 'Adobe Garamond', 'Garamond', serif;<br />
color: #fff;<br />
text-align: center;<br />
padding: 130px 0 0 0;<br />
text-shadow: 0 2px 0 #000;<br />
font-size: 60px;<br />
}<br />
#blog {<br />
z-index: 6;<br />
}<br />
#blog article {<br />
margin: 10px auto 60px;<br />
max-width: 1200px;<br />
position: relative;<br />
}<br />
#blog article .post {<br />
background: #cf9;<br />
// box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
box-shadow: 2px 1px 6px #272727;<br />
border-radius: 2px;<br />
overflow: hidden;<br />
color: #333;<br />
margin: 0 0 15px;<br />
}<br />
#blog article .post .text {<br />
padding: 20px 20px 10px;<br />
}<br />
.post-content a {<br />
color: #2683a5;<br />
}<br />
.post-content a:hover {<br />
color: #4ea9a2; <br />
}<br />
#blog article .post h2 {<br />
font-family: 'Tangerine', serif;<br />
font-size: 48px;<br />
text-shadow: 4px 4px 4px #aaa;<br />
color: #38f;<br />
letter-spacing: 0.1em;<br />
word-spacing: 0.3em;<br />
font-weight: 700;<br />
line-height: 36px;<br />
margin: 0;<br />
}<br />
#blog article .post h3 {<br />
font-size: 14px;<br />
line-height: 18px;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
}<br />
#blog article .post .meta {<br />
font-size: 11px;<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
}<br />
#blog article .post p {<br />
font-size: 16px;<br />
line-height: 19px;<br />
font-family: Trebuchet MS;<br />
font-weight: 600;<br />
color: #000;<br />
}<br />
.short-url, .share, .categories {<br />
background: #eaeaea left center no-repeat;<br />
border-radius: 2px;<br />
border-bottom: 1px solid #fff;<br />
border-top: 1px solid #d0d0d0;<br />
float: left;<br />
margin: 0 20px 0 0;<br />
padding: 4px 15px 4px 35px;<br />
font-size: 11px;<br />
color: #666;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
text-shadow: 0 1px 0 #fff;<br />
-webkit-transition: all .2s ease-out;<br />
-moz-transition: all .2s ease-out;<br />
transition: all .2s ease-out;<br />
}<br />
.addthis_toolbox {<br />
display: none;<br />
padding: 0 20px 20px;<br />
}<br />
.short-url:hover, .share:hover {<br />
background-color: #ddd;<br />
border-top: 1px solid #aaa;<br />
}<br />
<br />
#blog article.quote {<br />
max-width: 940px;<br />
}<br />
#blog article.quote .quote-content {<br />
background: #676767;<br />
padding: 30px;<br />
border-radius: 3px;<br />
border-top: #111 1px solid;<br />
border-bottom: #fff 1px solid;<br />
margin: 0 0 15px;<br />
}<br />
#blog article.quote .quote-content p {<br />
font-size: 26px;<br />
line-height: 32px;<br />
color: #eee;<br />
font-weight: 300;<br />
}<br />
#blog article.quote p.ref {<br />
color: #fff;<br />
padding: 0;<br />
margin: 0;<br />
}<br />
#blog article.quote .quote-content a {<br />
color: #fff;<br />
text-decoration: underline;<br />
}<br />
#blog-pagination {<br />
display: block;<br />
text-align: center;<br />
margin: 35px 0;<br />
}<br />
.wp-paginate {<br />
display: inline-block;<br />
padding: 0;<br />
box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
border-radius: 3px;<br />
}<br />
.wp-paginate li {<br />
padding: 0!important;<br />
display: inline-block;<br />
background-image: none!important;<br />
background-color: #fff;<br />
margin: 0;<br />
float: left;<br />
}<br />
.wp-paginate a, .wp-paginate .page.current {<br />
color: #333;<br />
padding: 10px 13px;<br />
display: inline-block;<br />
margin-bottom: 0!important;<br />
min-width: 10px;<br />
border-right: 1px solid #eee;<br />
font-size: 12px;<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
-webkit-transition: all .1s ease-in-out;<br />
-moz-transition: all .1s ease-in-out;<br />
transition: all .1s ease-in-out;<br />
}<br />
.wp-paginate span {<br />
margin-bottom: 0!important;<br />
}<br />
.wp-paginate a.next {<br />
border-left: 0;<br />
}<br />
.wp-paginate .page {<br />
margin: 0;<br />
}<br />
.wp-paginate .page.current {<br />
background-color: #fafafa;<br />
color: #888;<br />
}<br />
.wp-paginate a:hover {<br />
background: #555;<br />
color: #fff;<br />
border-right: 1px solid #555;<br />
}<br />
#disqus_thread {<br />
margin: 10px auto 35px!important;<br />
max-width: 660px;<br />
position: relative;<br />
background: #eaeaea;<br />
border-radius: 2px;<br />
border-bottom: 1px solid #fff;<br />
border-top: 1px solid #d0d0d0;<br />
color: #1a1a1a;<br />
padding: 20px;<br />
font-size: 12px;<br />
}<br />
#disqus_thread h3 {<br />
font-size: 14px;<br />
text-transform: uppercase;<br />
text-shadow: 0 1px 0 #fff;<br />
font-weight: 600;<br />
}<br />
#contact {<br />
position: relative;<br />
height: 940px;<br />
}<br />
#location-map {<br />
width: 100%;<br />
height: 940px;<br />
display: block;<br />
position: absolute;<br />
top: 0;<br />
}<br />
#contact .container {<br />
padding-top: 60px;<br />
}<br />
#contact #contact-details, #contact #message {<br />
background: #262626;<br />
float: none;<br />
display: block;<br />
margin: 0 0 35px;<br />
box-shadow: 0 0 25px 0 rgba(0, 0, 0, .25);<br />
}<br />
#phone-address, #work-planner {<br />
padding: 30px 40px;<br />
}<br />
#phone-address {<br />
border-bottom: 1px solid #565656;<br />
}<br />
#phone-address p, #work-planner h2, #message h2 {<br />
text-transform: uppercase;<br />
color: #fff;<br />
font-weight: 600;<br />
font-size: 14px;<br />
}<br />
#phone-address p {<br />
padding-left: 35px;<br />
}<br />
#phone-address p#phone {<br />
background: url(art/phone.png) no-repeat 2px 2px;<br />
}<br />
#phone-address p#address {<br />
background: url(art/map.png) no-repeat 2px 2px;<br />
margin: 0;<br />
}<br />
#work-planner h2, #message h2 {<br />
margin: 0 0 10px;<br />
line-height: normal;<br />
}<br />
#work-planner p {<br />
color: #9c9c9c;<br />
font-size: 13px;<br />
font-weight: 600;<br />
}<br />
#work-planner a {<br />
padding: 12px 40px 12px 12px;<br />
color: #fff;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
font-size: 12px;<br />
background: #ce462b url(art/get-started-arrow.png) no-repeat right center;<br />
margin: 0 0 10px;<br />
display: block;<br />
width: 128px;<br />
-webkit-transition: background-color .2s ease-in-out;<br />
-moz-transition: background-color .2s ease-in-out;<br />
transition: background-color .2s ease-in-out;<br />
}<br />
#work-planner a:hover {<br />
background-color: #4ea9a2;<br />
}<br />
#contact #message .wrapper {<br />
padding: 30px 40px;<br />
}<br />
#contact #message .field {<br />
display: block;<br />
position: relative;<br />
margin: 0 0 15px;<br />
}<br />
#contact #message label {<br />
position: absolute;<br />
top: 9px;<br />
left: 11px;<br />
color: #aaa;<br />
font-size: 13px;<br />
font-weight: 500;<br />
}<br />
#contact #message input, #contact #message textarea {<br />
width: 300px;<br />
max-width: 300px;<br />
background: #000;<br />
border: 0;<br />
border-bottom: 1px solid #373737;<br />
width: 100%;<br />
color: #ddd;<br />
font-size: 13px;<br />
font-weight: 500;<br />
padding: 8px 10px;<br />
}<br />
#contact #message textarea {<br />
height: 80px;<br />
}<br />
#contact #message input:focus, #contact #message textarea:focus {<br />
background: #111;<br />
outline: 0;<br />
}<br />
#contact #message button {<br />
padding: 14px 40px 14px 12px;<br />
color: #fff;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
text-align: left;<br />
font-size: 12px;<br />
background: #343434 url(art/message-arrow.png) no-repeat right center;<br />
display: block;<br />
margin: 0;<br />
width: 180px;<br />
-webkit-transition: background-color .2s ease-in-out;<br />
-moz-transition: background-color .2s ease-in-out;<br />
transition: background-color .2s ease-in-out;<br />
font-family: "proxima-nova", "HelveticaNeue", "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
}<br />
#contact #message button:hover {<br />
background-color: #666;<br />
}<br />
.contact footer {<br />
margin: 0;<br />
}<br />
footer {<br />
padding: 35px 0 20px;<br />
background: #003399;<br />
height: 130px;<br />
box-shadow: 4px 3px 25px #000;<br />
}<br />
footer h3 {<br />
font-size: 13px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
color: #fff;<br />
text-transform: uppercase;<br />
margin: 0 0 20px;<br />
}<br />
footer p {<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
}<br />
footer p a, footer p a:visited, footer p span {<br />
color: #dedede;<br />
}<br />
footer p a:hover {<br />
color: #fff;<br />
}<br />
#footer-contact p {<br />
margin-right: 40px;<br />
float: left;<br />
}<br />
#footer-project p {<br />
max-width: 180px;<br />
}<br />
#footer-newsletter {<br />
position: relative;<br />
}<br />
#footer-newsletter p {<br />
position: absolute;<br />
font-size: 11px;<br />
top: 0;<br />
right: 0;<br />
color: #7c7c7c;<br />
}<br />
#footer-newsletter input {<br />
width: 220px;<br />
height: 19px;<br />
background: #202020;<br />
border: 0;<br />
margin: 0;<br />
padding: 10px;<br />
color: #fff;<br />
font-size: 12px;<br />
-webkit-transition: background .3s ease-in-out;<br />
-moz-transition: background .3s ease-in-out;<br />
transition: background .3s ease-in-out;<br />
float: left;<br />
border-radius: 0;<br />
}<br />
#footer-newsletter input:focus {<br />
outline: 0;<br />
background: #333;<br />
}<br />
#footer-newsletter label {<br />
position: absolute;<br />
top: 49px;<br />
left: 10px;<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
}<br />
#footer-newsletter button {<br />
width: 39px;<br />
height: 39px;<br />
text-indent: -99999em;<br />
background: #202020 url(art/btn-arrow.svg) no-repeat center center;<br />
float: right;<br />
-webkit-transition: background .3s ease-in-out;<br />
-moz-transition: background .3s ease-in-out;<br />
transition: background .3s ease-in-out;<br />
}<br />
#footer-newsletter button:hover {<br />
background-color: #333;<br />
}<br />
#footer-final {<br />
margin: 15px auto;<br />
padding-top: 35px;<br />
border-top: 1px solid #313131;<br />
position: relative;<br />
}<br />
#footer-final a, #footer-final a:visited {<br />
color: #aaa;<br />
}<br />
#footer-final a:hover {<br />
color: #fff;<br />
}<br />
#footer-final p {<br />
font-weight: 600;<br />
font-size: 12px;<br />
display: block;<br />
margin: 0;<br />
}<br />
#footer-nav {<br />
text-align: center;<br />
}<br />
#footer-nav a {<br />
margin: 0 8px;<br />
}<br />
#footer-final p#footer-social {<br />
text-align: right;<br />
margin-left: 40px;<br />
}<br />
#footer-social a, #footer-social a:visited {<br />
margin: 0 0 0 16px;<br />
}<br />
.left {<br />
float: left;<br />
}<br />
.right {<br />
float: right;<br />
}<br />
span.error {<br />
color: red;<br />
font-size: 12px;<br />
}<br />
p.success {<br />
background: #009b00;<br />
padding: 5px;<br />
color: #fff;<br />
text-align: center;<br />
font-weight: 600;<br />
border-radius: 3px;<br />
}<br />
p.fail {<br />
background: red;<br />
padding: 5px;<br />
color: #fff;<br />
text-align: center;<br />
font-weight: 600;<br />
border-radius: 3px;<br />
}<br />
.success {<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
}<br />
.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.aligncenter, div.aligncenter {<br />
display: block;<br />
margin: 5px auto 5px auto;<br />
}<br />
.alignright {<br />
float: right;<br />
margin: 5px 0 20px 20px;<br />
}<br />
.alignleft {<br />
float: left;<br />
margin: 5px 20px 20px 0;<br />
}<br />
.aligncenter {<br />
display: block;<br />
margin: 5px auto 5px auto;<br />
}<br />
a img.alignright {<br />
float: right;<br />
margin: 5px 0 20px 20px;<br />
}<br />
a img.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
a img.alignleft {<br />
float: left;<br />
margin: 5px 20px 20px 0;<br />
}<br />
a img.aligncenter {<br />
display: block;<br />
margin-left: auto;<br />
margin-right: auto;<br />
}<br />
.wp-caption {<br />
background: #fff;<br />
border: 1px solid #f0f0f0;<br />
max-width: 96%;<br />
padding: 5px 3px 10px;<br />
text-align: center;<br />
}<br />
.wp-caption.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.wp-caption.alignleft {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.wp-caption.alignright {<br />
margin: 5px 0 20px 20px;<br />
}<br />
.wp-caption img {<br />
border: 0 none;<br />
height: auto;<br />
margin: 0;<br />
max-width: 98.5%;<br />
padding: 0;<br />
width: auto;<br />
}<br />
.wp-caption p.wp-caption-text {<br />
font-size: 11px;<br />
line-height: 17px;<br />
margin: 0;<br />
padding: 0 4px 5px;<br />
}<br />
.cols_2_left, .cols_2_right, .cols_3_left, .cols_3_middle, .cols_3_right {<br />
margin: 0 0 1.5em;<br />
}<br />
.cols_2_left {<br />
float: left;<br />
width: 47%}<br />
.cols_2_right {<br />
float: right;<br />
width: 47%}<br />
.cols_3_left {<br />
float: left;<br />
width: 30%}<br />
.cols_3_middle {<br />
float: left;<br />
width: 30%;<br />
margin-left: 5%}<br />
.cols_3_right {<br />
float: right;<br />
width: 30%}<br />
.container {<br />
position: relative;<br />
width: 1000px;<br />
margin: 0 auto;<br />
padding: 0;<br />
}<br />
.container.short {<br />
width: 940px;<br />
}<br />
.container .column, .container .columns {<br />
float: left;<br />
display: inline;<br />
margin-left: 10px;<br />
margin-right: 10px;<br />
}<br />
.row {<br />
margin-bottom: 20px;<br />
}<br />
.column.alpha, .columns.alpha {<br />
margin-left: 0;<br />
}<br />
.column.omega, .columns.omega {<br />
margin-right: 0;<br />
}<br />
.container .one.column, .container .one.columns {<br />
width: 40px;<br />
}<br />
.container .two.columns {<br />
width: 100px;<br />
}<br />
.container .three.columns {<br />
width: 160px;<br />
}<br />
.container .four.columns {<br />
width: 220px;<br />
}<br />
.container .five.columns {<br />
width: 180px;<br />
}<br />
.container .six.columns {<br />
width: 340px;<br />
}<br />
.container .seven.columns {<br />
width: 400px;<br />
}<br />
.container .eight.columns {<br />
width: 460px;<br />
}<br />
.container .nine.columns {<br />
width: 520px;<br />
}<br />
.container .ten.columns {<br />
width: 580px;<br />
}<br />
.container .eleven.columns {<br />
width: 640px;<br />
}<br />
.container .twelve.columns {<br />
width: 700px;<br />
}<br />
.container .thirteen.columns {<br />
width: 760px;<br />
}<br />
.container .fourteen.columns {<br />
width: 820px;<br />
}<br />
.container .fifteen.columns {<br />
width: 880px;<br />
}<br />
.container .sixteen.columns {<br />
width: 940px;<br />
}<br />
.container .one-third.column {<br />
width: 290px;<br />
}<br />
.container .two-thirds.column {<br />
width: 615px;<br />
}<br />
.container .offset-by-one {<br />
padding-left: 60px;<br />
}<br />
.container .offset-by-two {<br />
padding-left: 120px;<br />
}<br />
.container .offset-by-three {<br />
padding-left: 180px;<br />
}<br />
.container .offset-by-four {<br />
padding-left: 240px;<br />
}<br />
.container .offset-by-five {<br />
padding-left: 300px;<br />
}<br />
.container .offset-by-six {<br />
padding-left: 360px;<br />
}<br />
.container .offset-by-seven {<br />
padding-left: 420px;<br />
}<br />
.container .offset-by-eight {<br />
padding-left: 480px;<br />
}<br />
.container .offset-by-nine {<br />
padding-left: 540px;<br />
}<br />
.container .offset-by-ten {<br />
padding-left: 600px;<br />
}<br />
.container .offset-by-eleven {<br />
padding-left: 660px;<br />
}<br />
.container .offset-by-twelve {<br />
padding-left: 720px;<br />
}<br />
.container .offset-by-thirteen {<br />
padding-left: 780px;<br />
}<br />
.container .offset-by-fourteen {<br />
padding-left: 840px;<br />
}<br />
.container .offset-by-fifteen {<br />
padding-left: 900px;<br />
}<br />
@media only screen and (max-width:1049px) {<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images.two img {<br />
width: 450px;<br />
}<br />
}@media only screen and (min-width:960px) {<br />
#logo {<br />
-webkit-transform-style: preserve-3d;<br />
}<br />
#logo1 {<br />
-webkit-transform-style: preserve-3d;<br />
}<br />
.sticky #logo {<br />
-webkit-transform: scale(.75);<br />
-moz-transform: scale(.75);<br />
-ms-transform: scale(.75);<br />
-o-transform: scale(.75);<br />
transform: scale(.75);<br />
top: 0;<br />
left: -10px;<br />
}<br />
.sticky #logo1 {<br />
-webkit-transform: scale(.75);<br />
-moz-transform: scale(.75);<br />
-ms-transform: scale(.75);<br />
-o-transform: scale(.75);<br />
transform: scale(.75);<br />
top: 0;<br />
right: -1px;<br />
}<br />
<br />
}@media only screen and (min-device-width :768px) and (max-device-width:1024px) and (orientation:landscape) {<br />
#logo {<br />
-webkit-transform-style: flat;<br />
}<br />
#logo1 {<br />
-webkit-transform-style: flat;<br />
}<br />
.sticky #logo {<br />
-webkit-transform: none;<br />
-moz-transform: none;<br />
-ms-transform: none;<br />
-o-transform: none;<br />
transform: none;<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
-webkit-transform: none;<br />
-moz-transform: none;<br />
-ms-transform: none;<br />
-o-transform: none;<br />
transform: none;<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
}@media only screen and (min-width:768px) and (max-width:959px) {<br />
.container {<br />
width: 768px;<br />
}<br />
.container.short {<br />
width: 748px;<br />
}<br />
.container .column, .container .columns {<br />
margin-left: 10px;<br />
margin-right: 10px;<br />
}<br />
.column.alpha, .columns.alpha {<br />
margin-left: 0;<br />
margin-right: 10px;<br />
}<br />
.column.omega, .columns.omega {<br />
margin-right: 0;<br />
margin-left: 10px;<br />
}<br />
.alpha.omega {<br />
margin-left: 0;<br />
margin-right: 0;<br />
}<br />
.container .one.column, .container .one.columns {<br />
width: 28px;<br />
}<br />
.container .two.columns {<br />
width: 76px;<br />
}<br />
.container .three.columns {<br />
width: 124px;<br />
}<br />
.container .four.columns {<br />
width: 172px;<br />
}<br />
.container .five.columns {<br />
width: 220px;<br />
}<br />
.container .six.columns {<br />
width: 268px;<br />
}<br />
.container .seven.columns {<br />
width: 316px;<br />
}<br />
.container .eight.columns {<br />
width: 364px;<br />
}<br />
.container .nine.columns {<br />
width: 412px;<br />
}<br />
.container .ten.columns {<br />
width: 460px;<br />
}<br />
.container .eleven.columns {<br />
width: 508px;<br />
}<br />
.container .twelve.columns {<br />
width: 556px;<br />
}<br />
.container .thirteen.columns {<br />
width: 604px;<br />
}<br />
.container .fourteen.columns {<br />
width: 652px;<br />
}<br />
.container .fifteen.columns {<br />
width: 700px;<br />
}<br />
.container .sixteen.columns {<br />
width: 748px;<br />
}<br />
.container .one-third.column {<br />
width: 236px;<br />
}<br />
.container .two-thirds.column {<br />
width: 492px;<br />
}<br />
.container .offset-by-one {<br />
padding-left: 48px;<br />
}<br />
.container .offset-by-two {<br />
padding-left: 96px;<br />
}<br />
.container .offset-by-three {<br />
padding-left: 144px;<br />
}<br />
.container .offset-by-four {<br />
padding-left: 192px;<br />
}<br />
.container .offset-by-five {<br />
padding-left: 240px;<br />
}<br />
.container .offset-by-six {<br />
padding-left: 288px;<br />
}<br />
.container .offset-by-seven {<br />
padding-left: 336px;<br />
}<br />
.container .offset-by-eight {<br />
padding-left: 384px;<br />
}<br />
.container .offset-by-nine {<br />
padding-left: 432px;<br />
}<br />
.container .offset-by-ten {<br />
padding-left: 480px;<br />
}<br />
.container .offset-by-eleven {<br />
padding-left: 528px;<br />
}<br />
.container .offset-by-twelve {<br />
padding-left: 576px;<br />
}<br />
.container .offset-by-thirteen {<br />
padding-left: 624px;<br />
}<br />
.container .offset-by-fourteen {<br />
padding-left: 672px;<br />
}<br />
.container .offset-by-fifteen {<br />
padding-left: 720px;<br />
}<br />
.sticky #logo {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
nav a {<br />
padding-left: 10px;<br />
padding-right: 10px;<br />
}<br />
#footer-contact {<br />
width: 220px;<br />
}<br />
#footer-newsletter {<br />
float: right;<br />
width: 280px;<br />
}<br />
.mini-post {<br />
width: 236px;<br />
}<br />
.mini-post img {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images img {<br />
width: 100%}<br />
#case-details .images.two img {<br />
width: 350px;<br />
}<br />
#case-details, #meta .container, .single #page-header .container {<br />
padding: 0 10px;<br />
width: 748px;<br />
}<br />
.about .column-text {<br />
padding: 0 15px;<br />
}<br />
#feature h1 {<br />
font-size: 55px;<br />
}<br />
#page-header.case h1 {<br />
font-size: 40px;<br />
line-height: 34px;<br />
}<br />
#page-header.case h2 {<br />
max-width: 40%;<br />
line-height: 24px;<br />
}<br />
#blog-top #categories {<br />
width: 220px;<br />
}<br />
#blog-top form {<br />
width: 340px;<br />
}<br />
#blog-top #rss {<br />
width: 100px;<br />
}<br />
.container .seven.columns {<br />
width: 400px;<br />
}<br />
.single-work #page-header h2, .single-lab #page-header h2 {<br />
font-weight: 500;<br />
font-size: 16px;<br />
line-height: 22px;<br />
}<br />
<br />
footer {<br />
height: auto;<br />
}<br />
#wrap {<br />
margin-bottom: 0;<br />
min-height: 0;<br />
}<br />
.push {<br />
display: none;<br />
}<br />
#copyright, #footer-social {<br />
width: 150px;<br />
margin: 0!important;<br />
}<br />
#location-map {<br />
display: none;<br />
}<br />
#contact {<br />
height: auto;<br />
}<br />
#contact .container {<br />
padding-top: 10px;<br />
}<br />
#contact #contact-details {<br />
float: left;<br />
width: 340px;<br />
}<br />
#contact #message {<br />
float: right;<br />
width: 400px;<br />
}<br />
#footer-nav {<br />
width: 448px;<br />
}<br />
#processes {<br />
margin: 0 30px;<br />
}<br />
.process .text {<br />
padding: 0 15px;<br />
}<br />
.process p {<br />
font-size: 13px;<br />
line-height: 18px;<br />
}<br />
}@media only screen and (max-width:767px) {<br />
.container, .container.short {<br />
width: 300px;<br />
}<br />
.container .columns, .container .column {<br />
margin: 0;<br />
}<br />
.container .one.column, .container .one.columns, .container .two.columns, .container .three.columns, .container .four.columns, .container .five.columns, .container .six.columns, .container .seven.columns, .container .eight.columns, .container .nine.columns, .container .ten.columns, .container .eleven.columns, .container .twelve.columns, .container .thirteen.columns, .container .fourteen.columns, .container .fifteen.columns, .container .sixteen.columns, .container .one-third.column, .container .two-thirds.column {<br />
width: 300px;<br />
}<br />
.container .offset-by-one, .container .offset-by-two, .container .offset-by-three, .container .offset-by-four, .container .offset-by-five, .container .offset-by-six, .container .offset-by-seven, .container .offset-by-eight, .container .offset-by-nine, .container .offset-by-ten, .container .offset-by-eleven, .container .offset-by-twelve, .container .offset-by-thirteen, .container .offset-by-fourteen, .container .offset-by-fifteen {<br />
padding-left: 0;<br />
}<br />
.sticky #logo {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
#feature {<br />
height: 250px;<br />
}<br />
#feature article, #feature ul {<br />
display: none!important;<br />
}<br />
#feature h1 {<br />
top: 100px;<br />
font-size: 36px;<br />
line-height: 42px;<br />
}<br />
#home-content, #home-content .column, .mini-post {<br />
width: auto;<br />
float: none!important;<br />
display: block;<br />
}<br />
#home-content .column {<br />
margin: 0 0 40px;<br />
}<br />
.mini-post {<br />
margin: 0 auto 20px;<br />
width: 290px;<br />
}<br />
#tweet {<br />
padding: 40px 0 0 0;<br />
margin: 40px 0;<br />
width: auto;<br />
}<br />
#tweet .text {<br />
padding: 40px 20px 0;<br />
background-position: center top;<br />
}<br />
nav a {<br />
padding-left: 6px;<br />
padding-right: 6px;<br />
font-size: 12px;<br />
}<br />
<br />
#work article {<br />
width: 30%;<br />
margin: 10px;<br />
}<br />
#work article .image, #work article a img, .labs#work article .image {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images img, #case-details .images.two img {<br />
width: 100%;<br />
margin: 0 0 20px!important;<br />
}<br />
#page-header.case h1 {<br />
font-size: 30px;<br />
line-height: 28px;<br />
max-width: 55%}<br />
#page-header.case h2 {<br />
max-width: 50%;<br />
line-height: 24px;<br />
}<br />
.labs #page-header h1 {<br />
font-size: 46px;<br />
}<br />
#meta p {<br />
float: right;<br />
margin: 0;<br />
}<br />
#meta p:first-child {<br />
width: 50%;<br />
float: left;<br />
}<br />
#work-with-us {<br />
font-size: 18px;<br />
}<br />
#blog-top #categories {<br />
margin-bottom: 15px;<br />
}<br />
#blog-top form {<br />
width: 200px;<br />
}<br />
#blog-top input {<br />
width: 170px;<br />
}<br />
#blog-top #rss {<br />
width: 80px;<br />
float: right;<br />
}<br />
#blog article img {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#blog article {<br />
margin-bottom: 30px;<br />
}<br />
#blog article iframe {<br />
height: 270px;<br />
}<br />
#blog article .post h2 {<br />
font-size: 20px;<br />
line-height: 22px;<br />
}<br />
#blog .share {<br />
display: none;<br />
}<br />
.short-url {<br />
margin-bottom: 5px;<br />
}<br />
.categories {<br />
float: left;<br />
}<br />
.content h2 {<br />
font-size: 30px;<br />
line-height: 38px;<br />
}<br />
.content p {<br />
font-size: 14px;<br />
line-height: 22px;<br />
font-weight: 500;<br />
}<br />
<br />
footer {<br />
height: auto;<br />
}<br />
#wrap {<br />
margin-bottom: 0;<br />
min-height: 0;<br />
}<br />
.push {<br />
display: none;<br />
}<br />
#processes {<br />
margin: 0 20px;<br />
}<br />
.process .text {<br />
padding: 0 10px;<br />
}<br />
.process p {<br />
font-size: 12px;<br />
line-height: 16px;<br />
}<br />
}@media only screen and (min-width:480px) and (max-width:767px) {<br />
.container, .container.short {<br />
width: 420px;<br />
}<br />
.container .columns, .container .column {<br />
margin: 0;<br />
}<br />
.container .one.column, .container .one.columns, .container .two.columns, .container .three.columns, .container .four.columns, .container .five.columns, .container .six.columns, .container .seven.columns, .container .eight.columns, .container .nine.columns, .container .ten.columns, .container .eleven.columns, .container .twelve.columns, .container .thirteen.columns, .container .fourteen.columns, .container .fifteen.columns, .container .sixteen.columns, .container .one-third.column, .container .two-thirds.column {<br />
width: 420px;<br />
}<br />
#footer-newsletter input {<br />
width: 360px;<br />
}<br />
#blog-top form {<br />
width: 300px;<br />
}<br />
#blog-top input {<br />
width: 270px;<br />
}<br />
#blog-top #rss {<br />
width: 100px;<br />
float: right;<br />
}<br />
.categories {<br />
float: right;<br />
}<br />
.column-text {<br />
-moz-column-count: 1;<br />
-webkit-column-count: 1;<br />
column-count: 1;<br />
}<br />
}@media only screen and (min-width:320px) and (max-width:580px) {<br />
#logo, .sticky #logo {<br />
background-position: 0 -80px;<br />
top: 10px;<br />
left: 10px;<br />
}<br />
#logo1, .sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 10px;<br />
right: 1px;<br />
}<br />
header, header.sticky {<br />
height: 100px;<br />
}<br />
.sticky nav, nav {<br />
margin-top: 64px;<br />
}<br />
nav a {<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
}<br />
#feature h1 {<br />
top: 120px;<br />
font-size: 22px;<br />
line-height: 30px;<br />
}<br />
#tweet .text p {<br />
font-size: 20px;<br />
line-height: 24px;<br />
}<br />
#work article {<br />
width: 45%;<br />
margin: 6px;<br />
}<br />
#page-header {<br />
height: 200px;<br />
}<br />
#page-header h1 {<br />
font-size: 34px;<br />
}<br />
.labs #page-header h1 {<br />
font-size: 25px;<br />
}<br />
#page-header.case h2 {<br />
font-size: 16px;<br />
font-weight: 500;<br />
line-height: 20px;<br />
}<br />
#work-with-us {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#work-with-us span {<br />
background-image: none;<br />
}<br />
#contact #message input, #contact #message textarea {<br />
width: 200px;<br />
max-width: 200px;<br />
}<br />
#fresh ul {<br />
display: none;<br />
}<br />
#blog article iframe {<br />
height: 200px;<br />
}<br />
#process {<br />
display: none;<br />
}<br />
}.container:after {<br />
content: "\0020";<br />
display: block;<br />
height: 0;<br />
clear: both;<br />
visibility: hidden;<br />
}</div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria
Team:Shenzhen BGIC 0101/Criteria
2013-10-20T09:13:06Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<!--[if lte IE 8]><link rel="stylesheet" href="http://www.humaan.com.au/wp-content/themes/humaan/css/iestyle.css"><![endif]--><br />
<!--[if IE 9]><link rel="stylesheet" href="http://www.humaan.com.au/wp-content/themes/humaan/css/ie9.css"><![endif]--><br />
<br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<br />
<style><br />
.ans{<br />
margin-left:50px;<br />
color:#fcc;<br />
line-height: 1.5em;<br />
}<br />
.ans a{<br />
color:#f77;<br />
}<br />
.ans a:hover{<br />
color:#38f;<br />
text-decoration: none;<br />
}<br />
.container{<br />
width:930px;<br />
}<br />
.que{<br />
color: #ADFFCF;<br />
line-height: 1.5em;<br />
}<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="wrap" style="background:#ff9;"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: url(https://static.igem.org/mediawiki/2013/7/7a/Backg.jpg);height: 154px;box-shadow: 4px 3px 25px #000;"><br />
<h1></h1><br />
</div><br />
<br/><br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: #cf9"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Bronze Medal</h2><br/><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>Register the team, have a great summer, and have fun attending the Jamboree.<br />
</p><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>Create and share a description of the team's project via the iGEM wiki.<br />
</p><br />
<p class="ans"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software">Overview of project</a></p><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>Present a Poster and Talk at the iGEM Jamboree.<br />
</p><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>Develop and make available via the The Registry of Software Tools an open source software tool that supports synthetic biology based on BioBrick standard biological parts <br />
</p><br />
<p class="ans">Our software in <a href="https://github.com/igemsoftware/Shenzhen_BGIC_0101_2013">Github</a>.<br/><br />
Note:<br/><br />
Our giant software aims at operating Biobrick of device level based on synthesized DNA fragments.<br/>But for biobrick level, the second module can also assist users to design genes, such as deletion of EcorI, XbaI, SpeI, PstI, Not I in the CDS, codon optimization and repeat smash. <br />
</p><br />
<br/><h2>Silver Medal</h2><br/><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>A. Provide a detailed, draft specification for the next version of your software tool. As our project is so large and extensible greatly, at least 5 ideas can’t be realized due to time limitation.<br />
</p><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>B. Provide a second, distinct (yet complementary) software tools project. For the third module SegmMan, we have a complementary design & synthesis method OLS chip synthesis, so that Genovo is compatible for both synthesizer and chip.<br />
</p><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>Provide a demonstration of their software either as a textual or video tutorial made available on their wiki.<br />
</p><br />
<p class="ans">Textual <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">tutorial</a></p><br />
<br/><h2>Gold Medal</h2><br/><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>Have another team utilize the software developed by your team. You must clearly show how your software was used and the results that were obtained.<br />
</p><br />
<p class="ans">We have software team Shenzhen_BGIC_ATCG to use the second module to design their genes. SC2.0 project also try out SegmMan module on chrVII’s segmentation.</p><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>A. Outline and detail how your software effects Human Practices in Synthetic Biology.<br />
</p><br />
<p class="ans">Share:<br/><br />
Web-based server for public to use Software assessment and comparison with Biostudio.<br/><br />
Innovation:<br/><br />
We interview with core leader, Dr. Patrick Yizhi Cai and talk about Genovo’s design and application.<br/><br />
Advertisement:<br/><br />
We tried to sell our team shirts to people from BGI.<br/><br />
</p><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>B. Use SBOL in your software documentation.<br />
</p><br />
<p class="ans">We use SBOL as one of the output of first module to describe the genes in new created pathway.</p><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>A. Develop and document a new technical standard that supports one of the following:<br />
</p> <br />
<p class="ans">a. Design of BioBrick Parts or Devices<br/><br />
Chromosome Design Standard<br/><br />
Design Operation Standard<br/><br />
b. Construction of BioBrick Parts or Devices<br/><br />
Assembly Strategy Standard<br />
</p><br />
</div></div><br />
</article> <br />
</section><br />
<!--<br />
<section id="blog" class="container" style="width:910px"><br />
<br />
<article class="clearfix" style="background: rgba(29, 28, 28, 0.79);"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<br/><h2>Special Awards</h2><br/><br />
<p class="ach"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/USTC-Software-check.png" width="20px" height="20px"/>test<br />
</p><br />
<br />
</div></div><br />
</article> <br />
</section><br />
--><br />
<br/><br/><br/><br/><br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/humaan?action=raw&ctype=text/javascript" type="text/javascript"></script><br />
<br />
</html><br />
{{Scroll}}</div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Software
Team:Shenzhen BGIC 0101/Software
2013-10-20T09:06:45Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #1B1B1B;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software#">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: #cf9;height: 200px;box-shadow: 4px 3px 125px #906;"><br />
<h1 style="<br />
font-family: 'Tangerine', serif;<br />
font-size: 5em;<br />
text-shadow: 5px 6px 4px #467952;<br />
color: #86E451;<br />
letter-spacing: 0.2em;<br />
word-spacing: 0.3em;<br />
font-weight: 900;<br />
line-height: 36px;<br />
margin: 0;">Genovo</h1><br />
</div><br />
<br/><br />
<a name="overview"></a><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix" style="background: #cff;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<h2>Genovo</h2><br />
<br />
<div class="post-content" style="color: #003399;"><hr/><p><br />
Genovo is a Computer-Aided Design(CAD) tool to create genome denovo.<br/><br/><br />
1. operation interface<br/><br />
We developed its GUI & multiple functions basing upon JBrowse, a genome browse with a fully dynamic AJAX interface, which is included in GMOD in the CLOUD toolset.<br/><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/d2/Jbrowse.png" /><img src="https://static.igem.org/mediawiki/igem.org/2/28/Gmod.png" /><br/><br />
2. functional plugins<br/><br />
The current version is 1.3. It consists of 14 main plugins belonging to 3 design modules:<br/><br />
NeoChr, NecleoMod, SegmMan<br/><br/><br />
They are used to construct new chromosome structure denovo, modify CDS based on synoymous mutation, split chromosome into fragments with assembly adaptors in different sizes.<br/><br/><br />
The first module, NeoChr, would assist users to grab related genes in different pathways of various organism manually, to rewire genes’ relationship logically*, and to replace genes with orthologs that score higher*. Then it would allow users to define gene order and orientation in DRAG&DROP way, and decouple the genes with overlap. In the end, it would add or delete features, such as encrypted watermarks*, telomere, loxp sites to build a brand new genome.<br/><br/><br />
The second one , NucleoMod, has 5 applications. Firstly, NucleoMod is used to design CRISPR sites on NeoChr so that we can silence the wild type genes. Secondly, it can erase specific enzyme sites according to the users' selection. Thirdly, users can create a enzyme site in selected region of specific genes. Fourthly, it can optimize the codon efficiency to incresase the expression level. Finally, it can smash the tandem repeat bases to reduce the synthesis difficulty.<br/><br/><br />
The third one, SegmMan will cut chromosome into pieces in different sizes with Gibson, Goldengate, telomere adaptors to them so that they are able to be assembled into whole experimentally. Besides, it adds flanking vector homologous resion and enzyme sites for the preservation and excision from vectors.<br/><br/><br />
SegmMan, in another level, provide a complementary OLSDesign will guide users to get the chrosome fragments by chip and how to assembly them together.<br/><br/><br />
3. software goals<br/><br/><br />
Genovo enables users to create chromosome-like biodevice denovo, from pathway guided selection of gene to the rewire of genes’ relation, from reasonable substitution of genes to alteration of genes’ location along chromosome addition, from modification to CDS sequence to automatically segmentation design globally for assembly.<br/><br/><br />
We hope Genovo would assist users to have their own designed chromosome even if in silico, and hope it would assist researchers in SC2.0 project and futher genome research in pathway level.<br/><br/><br />
<img src="https://static.igem.org/mediawiki/igem.org/f/f5/Sc.png" /><br />
<br />
<br />
<br />
</p><br />
<br/><br/><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
</article> <br />
<br />
</section><br />
<br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Software
Team:Shenzhen BGIC 0101/Software
2013-10-20T09:05:43Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #1B1B1B;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software#">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: #cf9;height: 200px;box-shadow: 4px 3px 125px #906;"><br />
<h1 style="<br />
font-family: 'Tangerine', serif;<br />
font-size: 5em;<br />
text-shadow: 5px 6px 4px #467952;<br />
color: #86E451;<br />
letter-spacing: 0.2em;<br />
word-spacing: 0.3em;<br />
font-weight: 900;<br />
line-height: 36px;<br />
margin: 0;">Genovo</h1><br />
</div><br />
<br/><br />
<a name="overview"></a><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix" style="background: #cff;"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<h2>Genovo</h2><br />
<br />
<div class="post-content" style="color: #ADFFCF;"><hr/><p><br />
Genovo is a Computer-Aided Design(CAD) tool to create genome denovo.<br/><br/><br />
1. operation interface<br/><br />
We developed its GUI & multiple functions basing upon JBrowse, a genome browse with a fully dynamic AJAX interface, which is included in GMOD in the CLOUD toolset.<br/><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/d2/Jbrowse.png" /><img src="https://static.igem.org/mediawiki/igem.org/2/28/Gmod.png" /><br/><br />
2. functional plugins<br/><br />
The current version is 1.3. It consists of 14 main plugins belonging to 3 design modules:<br/><br />
NeoChr, NecleoMod, SegmMan<br/><br/><br />
They are used to construct new chromosome structure denovo, modify CDS based on synoymous mutation, split chromosome into fragments with assembly adaptors in different sizes.<br/><br/><br />
The first module, NeoChr, would assist users to grab related genes in different pathways of various organism manually, to rewire genes’ relationship logically*, and to replace genes with orthologs that score higher*. Then it would allow users to define gene order and orientation in DRAG&DROP way, and decouple the genes with overlap. In the end, it would add or delete features, such as encrypted watermarks*, telomere, loxp sites to build a brand new genome.<br/><br/><br />
The second one , NucleoMod, has 5 applications. Firstly, NucleoMod is used to design CRISPR sites on NeoChr so that we can silence the wild type genes. Secondly, it can erase specific enzyme sites according to the users' selection. Thirdly, users can create a enzyme site in selected region of specific genes. Fourthly, it can optimize the codon efficiency to incresase the expression level. Finally, it can smash the tandem repeat bases to reduce the synthesis difficulty.<br/><br/><br />
The third one, SegmMan will cut chromosome into pieces in different sizes with Gibson, Goldengate, telomere adaptors to them so that they are able to be assembled into whole experimentally. Besides, it adds flanking vector homologous resion and enzyme sites for the preservation and excision from vectors.<br/><br/><br />
SegmMan, in another level, provide a complementary OLSDesign will guide users to get the chrosome fragments by chip and how to assembly them together.<br/><br/><br />
3. software goals<br/><br/><br />
Genovo enables users to create chromosome-like biodevice denovo, from pathway guided selection of gene to the rewire of genes’ relation, from reasonable substitution of genes to alteration of genes’ location along chromosome addition, from modification to CDS sequence to automatically segmentation design globally for assembly.<br/><br/><br />
We hope Genovo would assist users to have their own designed chromosome even if in silico, and hope it would assist researchers in SC2.0 project and futher genome research in pathway level.<br/><br/><br />
<img src="https://static.igem.org/mediawiki/igem.org/f/f5/Sc.png" /><br />
<br />
<br />
<br />
</p><br />
<br/><br/><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
</article> <br />
<br />
</section><br />
<br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Software
Team:Shenzhen BGIC 0101/Software
2013-10-20T08:49:55Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #1B1B1B;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software#">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: #cf9;height: 200px;box-shadow: 4px 3px 125px #906;"><br />
<h1 style="<br />
font-family: 'Tangerine', serif;<br />
font-size: 5em;<br />
text-shadow: 5px 6px 4px #467952;<br />
color: #86E451;<br />
letter-spacing: 0.2em;<br />
word-spacing: 0.3em;<br />
font-weight: 900;<br />
line-height: 36px;<br />
margin: 0;">Genovo</h1><br />
</div><br />
<br/><br />
<a name="overview"></a><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix" style="background: rgba(29, 28, 28, 0.79);"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<h2>Genovo</h2><br />
<br />
<div class="post-content" style="color: #ADFFCF;"><hr/><p><br />
Genovo is a Computer-Aided Design(CAD) tool to create genome denovo.<br/><br/><br />
1. operation interface<br/><br />
We developed its GUI & multiple functions basing upon JBrowse, a genome browse with a fully dynamic AJAX interface, which is included in GMOD in the CLOUD toolset.<br/><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/d2/Jbrowse.png" /><img src="https://static.igem.org/mediawiki/igem.org/2/28/Gmod.png" /><br/><br />
2. functional plugins<br/><br />
The current version is 1.3. It consists of 14 main plugins belonging to 3 design modules:<br/><br />
NeoChr, NecleoMod, SegmMan<br/><br/><br />
They are used to construct new chromosome structure denovo, modify CDS based on synoymous mutation, split chromosome into fragments with assembly adaptors in different sizes.<br/><br/><br />
The first module, NeoChr, would assist users to grab related genes in different pathways of various organism manually, to rewire genes’ relationship logically*, and to replace genes with orthologs that score higher*. Then it would allow users to define gene order and orientation in DRAG&DROP way, and decouple the genes with overlap. In the end, it would add or delete features, such as encrypted watermarks*, telomere, loxp sites to build a brand new genome.<br/><br/><br />
The second one , NucleoMod, has 5 applications. Firstly, NucleoMod is used to design CRISPR sites on NeoChr so that we can silence the wild type genes. Secondly, it can erase specific enzyme sites according to the users' selection. Thirdly, users can create a enzyme site in selected region of specific genes. Fourthly, it can optimize the codon efficiency to incresase the expression level. Finally, it can smash the tandem repeat bases to reduce the synthesis difficulty.<br/><br/><br />
The third one, SegmMan will cut chromosome into pieces in different sizes with Gibson, Goldengate, telomere adaptors to them so that they are able to be assembled into whole experimentally. Besides, it adds flanking vector homologous resion and enzyme sites for the preservation and excision from vectors.<br/><br/><br />
SegmMan, in another level, provide a complementary OLSDesign will guide users to get the chrosome fragments by chip and how to assembly them together.<br/><br/><br />
3. software goals<br/><br/><br />
Genovo enables users to create chromosome-like biodevice denovo, from pathway guided selection of gene to the rewire of genes’ relation, from reasonable substitution of genes to alteration of genes’ location along chromosome addition, from modification to CDS sequence to automatically segmentation design globally for assembly.<br/><br/><br />
We hope Genovo would assist users to have their own designed chromosome even if in silico, and hope it would assist researchers in SC2.0 project and futher genome research in pathway level.<br/><br/><br />
<img src="https://static.igem.org/mediawiki/igem.org/f/f5/Sc.png" /><br />
<br />
<br />
<br />
</p><br />
<br/><br/><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
</article> <br />
<br />
</section><br />
<br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Software
Team:Shenzhen BGIC 0101/Software
2013-10-20T08:42:59Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #1B1B1B;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software#">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: #cf9;height: 200px;box-shadow: 4px 3px 25px #cf9;"><br />
<h1 style="<br />
font-family: 'Tangerine', serif;<br />
font-size: 5em;<br />
text-shadow: 5px 6px 4px #467952;<br />
color: #86E451;<br />
letter-spacing: 0.2em;<br />
word-spacing: 0.3em;<br />
font-weight: 900;<br />
line-height: 36px;<br />
margin: 0;">Genovo</h1><br />
</div><br />
<br/><br />
<a name="overview"></a><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix" style="background: rgba(29, 28, 28, 0.79);"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<h2>Genovo</h2><br />
<br />
<div class="post-content" style="color: #ADFFCF;"><hr/><p><br />
Genovo is a Computer-Aided Design(CAD) tool to create genome denovo.<br/><br/><br />
1. operation interface<br/><br />
We developed its GUI & multiple functions basing upon JBrowse, a genome browse with a fully dynamic AJAX interface, which is included in GMOD in the CLOUD toolset.<br/><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/d2/Jbrowse.png" /><img src="https://static.igem.org/mediawiki/igem.org/2/28/Gmod.png" /><br/><br />
2. functional plugins<br/><br />
The current version is 1.3. It consists of 14 main plugins belonging to 3 design modules:<br/><br />
NeoChr, NecleoMod, SegmMan<br/><br/><br />
They are used to construct new chromosome structure denovo, modify CDS based on synoymous mutation, split chromosome into fragments with assembly adaptors in different sizes.<br/><br/><br />
The first module, NeoChr, would assist users to grab related genes in different pathways of various organism manually, to rewire genes’ relationship logically*, and to replace genes with orthologs that score higher*. Then it would allow users to define gene order and orientation in DRAG&DROP way, and decouple the genes with overlap. In the end, it would add or delete features, such as encrypted watermarks*, telomere, loxp sites to build a brand new genome.<br/><br/><br />
The second one , NucleoMod, has 5 applications. Firstly, NucleoMod is used to design CRISPR sites on NeoChr so that we can silence the wild type genes. Secondly, it can erase specific enzyme sites according to the users' selection. Thirdly, users can create a enzyme site in selected region of specific genes. Fourthly, it can optimize the codon efficiency to incresase the expression level. Finally, it can smash the tandem repeat bases to reduce the synthesis difficulty.<br/><br/><br />
The third one, SegmMan will cut chromosome into pieces in different sizes with Gibson, Goldengate, telomere adaptors to them so that they are able to be assembled into whole experimentally. Besides, it adds flanking vector homologous resion and enzyme sites for the preservation and excision from vectors.<br/><br/><br />
SegmMan, in another level, provide a complementary OLSDesign will guide users to get the chrosome fragments by chip and how to assembly them together.<br/><br/><br />
3. software goals<br/><br/><br />
Genovo enables users to create chromosome-like biodevice denovo, from pathway guided selection of gene to the rewire of genes’ relation, from reasonable substitution of genes to alteration of genes’ location along chromosome addition, from modification to CDS sequence to automatically segmentation design globally for assembly.<br/><br/><br />
We hope Genovo would assist users to have their own designed chromosome even if in silico, and hope it would assist researchers in SC2.0 project and futher genome research in pathway level.<br/><br/><br />
<img src="https://static.igem.org/mediawiki/igem.org/f/f5/Sc.png" /><br />
<br />
<br />
<br />
</p><br />
<br/><br/><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
</article> <br />
<br />
</section><br />
<br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Software
Team:Shenzhen BGIC 0101/Software
2013-10-20T08:30:28Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script type="text/javascript" src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/easying?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<script type="text/javascript"><br />
function FloatMenu(){<br />
var animationSpeed=1500;<br />
var animationEasing='easeOutQuint';<br />
var scrollAmount=$(document).scrollTop();<br />
var newPosition=menuPosition+scrollAmount;<br />
if($(window).height()<$('#fl_menu').height()+$('#fl_menu .menu').height()){<br />
$('#fl_menu').css('top',menuPosition);<br />
} else {<br />
$('#fl_menu').stop().animate({top: newPosition}, animationSpeed, animationEasing);<br />
}<br />
}<br />
$(window).load(function(){<br />
menuPosition=$('#fl_menu').position().top;<br />
FloatMenu();<br />
});<br />
$(window).scroll(function(){ <br />
FloatMenu();<br />
});<br />
$(document).ready(function(){<br />
var fadeSpeed=500;<br />
$("#fl_menu").hover(function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 1);<br />
$("#fl_menu .menu").fadeIn(fadeSpeed);<br />
},function(){<br />
$('#fl_menu .label').fadeTo(fadeSpeed, 0.75);<br />
$("#fl_menu .menu").fadeOut(fadeSpeed);<br />
});<br />
});<br />
</script><br />
<style><br />
<br />
.container{<br />
width:65%;<br />
left: 5%;<br />
}<br />
/* fl_menu */<br />
#fl_menu{position:absolute;top:150px;left:-2px;z-index:9999;<br />
width:200px;<br />
height:50px;<br />
}<br />
#fl_menu .label{line-height:50px;font-size:18px;font-weight:bold;background: #1B1B1B;color:#fff;letter-spacing:5px;text-align: center;box-shadow: 2px 1px 6px #272727;border-radius: 2px;opacity: 0.75;}<br />
#fl_menu .label a{color:#83f;text-decoration: none;}<br />
#fl_menu .label a:hover{color:#38f;}<br />
<br />
</style><br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="fl_menu"><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software#">Overview</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules">Modules</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Next_version">Next version</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Compatibility">Compatibility</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/NewStandard">New Standard</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial">Tutorial</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial">Web-based trial</a></div><br />
<br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software_Assessment">Assessment</a></div><br />
<div class="label"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Downloadsl">Downloads</a></div><br />
<br />
<br />
</div><br />
<div id="wrap"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: #399;height: 100px;box-shadow: 4px 3px 25px #000;"><br />
<h1 style="<br />
font-family: 'Tangerine', serif;<br />
font-size: 5em;<br />
text-shadow: 5px 6px 4px #467952;<br />
color: #86E451;<br />
letter-spacing: 0.2em;<br />
word-spacing: 0.3em;<br />
font-weight: 900;<br />
line-height: 36px;<br />
margin: 0;">Genovo</h1><br />
</div><br />
<br/><br />
<a name="overview"></a><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix" style="background: rgba(29, 28, 28, 0.79);"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution" style="background: transparent;color: #E6E6E6;"><br />
<div class="text"><br />
<h2>Genovo</h2><br />
<br />
<div class="post-content" style="color: #ADFFCF;"><hr/><p><br />
Genovo is a Computer-Aided Design(CAD) tool to create genome denovo.<br/><br/><br />
1. operation interface<br/><br />
We developed its GUI & multiple functions basing upon JBrowse, a genome browse with a fully dynamic AJAX interface, which is included in GMOD in the CLOUD toolset.<br/><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/d2/Jbrowse.png" /><img src="https://static.igem.org/mediawiki/igem.org/2/28/Gmod.png" /><br/><br />
2. functional plugins<br/><br />
The current version is 1.3. It consists of 14 main plugins belonging to 3 design modules:<br/><br />
NeoChr, NecleoMod, SegmMan<br/><br/><br />
They are used to construct new chromosome structure denovo, modify CDS based on synoymous mutation, split chromosome into fragments with assembly adaptors in different sizes.<br/><br/><br />
The first module, NeoChr, would assist users to grab related genes in different pathways of various organism manually, to rewire genes’ relationship logically*, and to replace genes with orthologs that score higher*. Then it would allow users to define gene order and orientation in DRAG&DROP way, and decouple the genes with overlap. In the end, it would add or delete features, such as encrypted watermarks*, telomere, loxp sites to build a brand new genome.<br/><br/><br />
The second one , NucleoMod, has 5 applications. Firstly, NucleoMod is used to design CRISPR sites on NeoChr so that we can silence the wild type genes. Secondly, it can erase specific enzyme sites according to the users' selection. Thirdly, users can create a enzyme site in selected region of specific genes. Fourthly, it can optimize the codon efficiency to incresase the expression level. Finally, it can smash the tandem repeat bases to reduce the synthesis difficulty.<br/><br/><br />
The third one, SegmMan will cut chromosome into pieces in different sizes with Gibson, Goldengate, telomere adaptors to them so that they are able to be assembled into whole experimentally. Besides, it adds flanking vector homologous resion and enzyme sites for the preservation and excision from vectors.<br/><br/><br />
SegmMan, in another level, provide a complementary OLSDesign will guide users to get the chrosome fragments by chip and how to assembly them together.<br/><br/><br />
3. software goals<br/><br/><br />
Genovo enables users to create chromosome-like biodevice denovo, from pathway guided selection of gene to the rewire of genes’ relation, from reasonable substitution of genes to alteration of genes’ location along chromosome addition, from modification to CDS sequence to automatically segmentation design globally for assembly.<br/><br/><br />
We hope Genovo would assist users to have their own designed chromosome even if in silico, and hope it would assist researchers in SC2.0 project and futher genome research in pathway level.<br/><br/><br />
<img src="https://static.igem.org/mediawiki/igem.org/f/f5/Sc.png" /><br />
<br />
<br />
<br />
</p><br />
<br/><br/><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
</article> <br />
<br />
</section><br />
<br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer style><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
</body><br />
</html></div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/style
Team:Shenzhen BGIC 0101/style
2013-10-20T08:26:12Z
<p>Czh: </p>
<hr />
<div>@font-face {<br />
font-family: 'Tangerine';<br />
font-style: normal;<br />
font-weight: 400;<br />
src: local('Tangerine'), url(http://themes.googleusercontent.com/static/fonts/tangerine/v3/HGfsyCL5WASpHOFnouG-RD8E0i7KZn-EPnyo3HZu7kw.woff) format('woff');<br />
}<br />
<br />
html, body, div, span, applet, object, iframe, h1, h2, h3, h4, h5, h6, p, blockquote, pre, a, abbr, acronym, address, big, cite, code, del, dfn, em, img, ins, kbd, q, s, samp, small, strike, strong, sub, sup, tt, var, b, u, i, center, dl, dt, dd, ol, ul, li, fieldset, form, label, legend, table, caption, tbody, tfoot, thead, tr, th, td, article, aside, canvas, details, embed, figure, figcaption, footer, header, hgroup, menu, nav, output, ruby, section, summary, time, mark, audio, video {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-size: 100%;<br />
font: inherit;<br />
vertical-align: baseline;<br />
letter-spacing: 0.05em;<br />
}<br />
article, aside, details, figcaption, figure, footer, header, hgroup, menu, nav, section {<br />
display: block;<br />
}<br />
body {<br />
line-height: 1;<br />
}<br />
ol, ul {<br />
list-style: none;<br />
}<br />
<br />
p, ul, ol {<br />
margin: 0 0 0px; <br />
<br />
}<br />
ul, ol {<br />
padding: 1.5em 0 0 2.5em;<br />
}<br />
<br />
<br />
body {<br />
/* background: #f2f2f2;*/<br />
background: #262626;<br />
font-family: "proxima-nova", "HelveticaNeue", "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
font-size: 14px;<br />
line-height: 21px;<br />
color: #262626;<br />
-webkit-font-smoothing: antialiased;<br />
-webkit-text-size-adjust: 100%}<br />
html, body {<br />
height: 100%}<br />
#wrap {<br />
background: #ff9;<br />
background-size:cover;<br />
margin-bottom: 0px;<br />
min-height: 100%;<br />
height: auto!important;<br />
height: 100%}<br />
.push {<br />
height: 45px;<br />
}<br />
p img {<br />
margin: 0;<br />
}<br />
em {<br />
font-style: italic;<br />
}<br />
strong {<br />
font-weight: bold;<br />
}<br />
hr {<br />
border: solid #ddd;<br />
border-width: 1px 0 0;<br />
clear: both;<br />
margin: 10px 0 30px;<br />
height: 0;<br />
}<br />
a, a:visited {<br />
color: #666;<br />
text-decoration: none;<br />
outline: 0;<br />
}<br />
a:hover, a:focus {<br />
color: #333;<br />
}<br />
p a, p a:visited {<br />
line-height: inherit;<br />
}<br />
img.scale-with-grid {<br />
max-width: 100%;<br />
height: auto;<br />
}<br />
<br />
header {<br />
width: 100%;<br />
height: 90px;<br />
background: #222;<br />
background: rgba(0, 0, 0, .2);<br />
border-color: #fff;<br />
border-bottom: 1px solid rgba(255, 255, 255, .25);<br />
position: fixed;<br />
top: 0;<br />
z-index: 10;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
-ms-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
}<br />
header.sticky {<br />
height: 60px;<br />
background: #993399;<br />
border: 0;<br />
box-shadow: 0 1px 6px rgba(0, 0, 0, .2);<br />
}<br />
header h1 {<br />
margin: 0;<br />
}<br />
#logo {<br />
width: 84px;<br />
height: 59px;<br />
display: block;<br />
background: url(https://static.igem.org/mediawiki/igem.org/e/e8/Genovo-logo.png) no-repeat;<br />
text-indent: -99999em;<br />
position: absolute;<br />
top: 15px;<br />
left: 15px;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
}<br />
#logo1{<br />
width: 80px;<br />
height: 60px;<br />
display: block;<br />
background: url(https://static.igem.org/mediawiki/2013/d/dd/Igem_logo12.png) no-repeat;<br />
text-indent: -99999em;<br />
position: absolute;<br />
top: 15px;<br />
right: 10px;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
z-index:9999;<br />
}<br />
nav {<br />
text-align: center;<br />
margin-top: 35px;<br />
-webkit-transition: margin .2s ease-in-out;<br />
-moz-transition: margin .2s ease-in-out;<br />
transition: margin .2s ease-in-out;<br />
}<br />
.sticky nav {<br />
margin-top: 20px;<br />
}<br />
nav a, #start-project {<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
color: #555;<br />
text-shadow: 0 1px 0 #fff;<br />
padding: 16px;<br />
font-size: 14px;<br />
}<br />
.light nav a {<br />
color: #ddd;/* top-nav color */<br />
text-shadow: 0 1px 0 rgba(0, 0, 0, .5);<br />
opacity: .5;<br />
-webkit-transition: opacity .1s linear;<br />
-moz-transition: opacity .1s linear;<br />
transition: opacity .1s linear;<br />
}<br />
nav a.current-menu-item, nav a.current_page_parent, nav a:hover, .single-work .light nav a.menu-item-18, .single-lab .light nav a.menu-item-17, .single-post .light nav a.menu-item-16 {<br />
opacity: 1;<br />
}<br />
.single-work nav a.current_page_parent, .single-lab nav a.current_page_parent {<br />
opacity: .5;<br />
}<br />
#blog {<br />
z-index: 6;<br />
}<br />
#blog article {<br />
margin: 10px auto 60px;<br />
max-width: 700px;<br />
position: relative;<br />
}<br />
<br />
<br />
#home-content h2, #fresh h2, h2.section-title {<br />
color: #358;<br />
font-size: 12px;<br />
text-shadow: 0 1px 0 #fff;<br />
font-weight: 600;<br />
width: 150px;<br />
background: #aaa;<br />
margin: -20px auto 20px;<br />
text-align: center;<br />
}<br />
#home-content .column, #fresh {<br />
border-top: 1px solid #d0d0d0;<br />
}<br />
#home-content .one-third {<br />
float: right!important;<br />
}<br />
.mini-post {<br />
float: left;<br />
background: #fff;<br />
box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
border-radius: 2px;<br />
overflow: hidden;<br />
width: 290px;<br />
-webkit-transition: all .2s ease-out;<br />
-moz-transition: all .2s ease-out;<br />
transition: all .2s ease-out;<br />
color: #333;<br />
min-height: 320px;<br />
cursor: pointer;<br />
}<br />
.mini-post:hover {<br />
margin-top: -5px;<br />
box-shadow: 0 3px 3px 0 rgba(0, 0, 0, .4);<br />
}<br />
.mini-post .text {<br />
padding: 20px 20px 10px;<br />
}<br />
.mini-post h3 {<br />
font-size: 16px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
margin: 0;<br />
}<br />
.mini-post .meta {<br />
font-size: 11px;<br />
}<br />
.mini-post p {<br />
font-size: 13px;<br />
}<br />
.mini-post .more {<br />
font-weight: 600;<br />
}<br />
#tweet {<br />
margin: 40px auto;<br />
padding-top: 40px;<br />
border-top: 1px solid #d0d0d0;<br />
}<br />
#tweet .text {<br />
padding: 0 90px;<br />
background: url(art/bird.svg) no-repeat 35px 0;<br />
font-size: 26px;<br />
font-weight: 300;<br />
}<br />
#tweet .text p {<br />
margin: 0 0 10px;<br />
text-align: center;<br />
line-height: 36px;<br />
}<br />
#tweet .text p.author {<br />
font-size: 20px;<br />
}<br />
#page-header {<br />
width: auto;<br />
// height: 220px;<br />
//background: url(https://static.igem.org/mediawiki/2013/3/34/Test-head.jpg) top center;<br />
margin: 0 0 35px;<br />
box-shadow: 2px 1px 12px #272727;<br />
<br />
}<br />
.wf-loading #page-header h1 {<br />
visibility: hidden;<br />
}<br />
<br />
.blog #page-header {<br />
// background: url(https://static.igem.org/mediawiki/2013/3/34/Test-head.jpg) top center;<br />
}<br />
#page-header h1 {<br />
font-family: "abril-fatface", 'Adobe Garamond', 'Garamond', serif;<br />
color: #fff;<br />
text-align: center;<br />
padding: 130px 0 0 0;<br />
text-shadow: 0 2px 0 #000;<br />
font-size: 60px;<br />
}<br />
#blog {<br />
z-index: 6;<br />
}<br />
#blog article {<br />
margin: 10px auto 60px;<br />
max-width: 1200px;<br />
position: relative;<br />
}<br />
#blog article .post {<br />
background: #cf9;<br />
// box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
box-shadow: 2px 1px 6px #272727;<br />
border-radius: 2px;<br />
overflow: hidden;<br />
color: #333;<br />
margin: 0 0 15px;<br />
}<br />
#blog article .post .text {<br />
padding: 20px 20px 10px;<br />
}<br />
.post-content a {<br />
color: #2683a5;<br />
}<br />
.post-content a:hover {<br />
color: #4ea9a2; <br />
}<br />
#blog article .post h2 {<br />
font-family: 'Tangerine', serif;<br />
font-size: 48px;<br />
text-shadow: 4px 4px 4px #aaa;<br />
color: #38f;<br />
letter-spacing: 0.1em;<br />
word-spacing: 0.3em;<br />
font-weight: 700;<br />
line-height: 36px;<br />
margin: 0;<br />
}<br />
#blog article .post h3 {<br />
font-size: 14px;<br />
line-height: 18px;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
}<br />
#blog article .post .meta {<br />
font-size: 11px;<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
}<br />
#blog article .post p {<br />
font-size: 16px;<br />
line-height: 19px;<br />
font-family: Trebuchet MS;<br />
font-weight: 600;<br />
}<br />
.short-url, .share, .categories {<br />
background: #eaeaea left center no-repeat;<br />
border-radius: 2px;<br />
border-bottom: 1px solid #fff;<br />
border-top: 1px solid #d0d0d0;<br />
float: left;<br />
margin: 0 20px 0 0;<br />
padding: 4px 15px 4px 35px;<br />
font-size: 11px;<br />
color: #666;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
text-shadow: 0 1px 0 #fff;<br />
-webkit-transition: all .2s ease-out;<br />
-moz-transition: all .2s ease-out;<br />
transition: all .2s ease-out;<br />
}<br />
.addthis_toolbox {<br />
display: none;<br />
padding: 0 20px 20px;<br />
}<br />
.short-url:hover, .share:hover {<br />
background-color: #ddd;<br />
border-top: 1px solid #aaa;<br />
}<br />
<br />
#blog article.quote {<br />
max-width: 940px;<br />
}<br />
#blog article.quote .quote-content {<br />
background: #676767;<br />
padding: 30px;<br />
border-radius: 3px;<br />
border-top: #111 1px solid;<br />
border-bottom: #fff 1px solid;<br />
margin: 0 0 15px;<br />
}<br />
#blog article.quote .quote-content p {<br />
font-size: 26px;<br />
line-height: 32px;<br />
color: #eee;<br />
font-weight: 300;<br />
}<br />
#blog article.quote p.ref {<br />
color: #fff;<br />
padding: 0;<br />
margin: 0;<br />
}<br />
#blog article.quote .quote-content a {<br />
color: #fff;<br />
text-decoration: underline;<br />
}<br />
#blog-pagination {<br />
display: block;<br />
text-align: center;<br />
margin: 35px 0;<br />
}<br />
.wp-paginate {<br />
display: inline-block;<br />
padding: 0;<br />
box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
border-radius: 3px;<br />
}<br />
.wp-paginate li {<br />
padding: 0!important;<br />
display: inline-block;<br />
background-image: none!important;<br />
background-color: #fff;<br />
margin: 0;<br />
float: left;<br />
}<br />
.wp-paginate a, .wp-paginate .page.current {<br />
color: #333;<br />
padding: 10px 13px;<br />
display: inline-block;<br />
margin-bottom: 0!important;<br />
min-width: 10px;<br />
border-right: 1px solid #eee;<br />
font-size: 12px;<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
-webkit-transition: all .1s ease-in-out;<br />
-moz-transition: all .1s ease-in-out;<br />
transition: all .1s ease-in-out;<br />
}<br />
.wp-paginate span {<br />
margin-bottom: 0!important;<br />
}<br />
.wp-paginate a.next {<br />
border-left: 0;<br />
}<br />
.wp-paginate .page {<br />
margin: 0;<br />
}<br />
.wp-paginate .page.current {<br />
background-color: #fafafa;<br />
color: #888;<br />
}<br />
.wp-paginate a:hover {<br />
background: #555;<br />
color: #fff;<br />
border-right: 1px solid #555;<br />
}<br />
#disqus_thread {<br />
margin: 10px auto 35px!important;<br />
max-width: 660px;<br />
position: relative;<br />
background: #eaeaea;<br />
border-radius: 2px;<br />
border-bottom: 1px solid #fff;<br />
border-top: 1px solid #d0d0d0;<br />
color: #1a1a1a;<br />
padding: 20px;<br />
font-size: 12px;<br />
}<br />
#disqus_thread h3 {<br />
font-size: 14px;<br />
text-transform: uppercase;<br />
text-shadow: 0 1px 0 #fff;<br />
font-weight: 600;<br />
}<br />
#contact {<br />
position: relative;<br />
height: 940px;<br />
}<br />
#location-map {<br />
width: 100%;<br />
height: 940px;<br />
display: block;<br />
position: absolute;<br />
top: 0;<br />
}<br />
#contact .container {<br />
padding-top: 60px;<br />
}<br />
#contact #contact-details, #contact #message {<br />
background: #262626;<br />
float: none;<br />
display: block;<br />
margin: 0 0 35px;<br />
box-shadow: 0 0 25px 0 rgba(0, 0, 0, .25);<br />
}<br />
#phone-address, #work-planner {<br />
padding: 30px 40px;<br />
}<br />
#phone-address {<br />
border-bottom: 1px solid #565656;<br />
}<br />
#phone-address p, #work-planner h2, #message h2 {<br />
text-transform: uppercase;<br />
color: #fff;<br />
font-weight: 600;<br />
font-size: 14px;<br />
}<br />
#phone-address p {<br />
padding-left: 35px;<br />
}<br />
#phone-address p#phone {<br />
background: url(art/phone.png) no-repeat 2px 2px;<br />
}<br />
#phone-address p#address {<br />
background: url(art/map.png) no-repeat 2px 2px;<br />
margin: 0;<br />
}<br />
#work-planner h2, #message h2 {<br />
margin: 0 0 10px;<br />
line-height: normal;<br />
}<br />
#work-planner p {<br />
color: #9c9c9c;<br />
font-size: 13px;<br />
font-weight: 600;<br />
}<br />
#work-planner a {<br />
padding: 12px 40px 12px 12px;<br />
color: #fff;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
font-size: 12px;<br />
background: #ce462b url(art/get-started-arrow.png) no-repeat right center;<br />
margin: 0 0 10px;<br />
display: block;<br />
width: 128px;<br />
-webkit-transition: background-color .2s ease-in-out;<br />
-moz-transition: background-color .2s ease-in-out;<br />
transition: background-color .2s ease-in-out;<br />
}<br />
#work-planner a:hover {<br />
background-color: #4ea9a2;<br />
}<br />
#contact #message .wrapper {<br />
padding: 30px 40px;<br />
}<br />
#contact #message .field {<br />
display: block;<br />
position: relative;<br />
margin: 0 0 15px;<br />
}<br />
#contact #message label {<br />
position: absolute;<br />
top: 9px;<br />
left: 11px;<br />
color: #aaa;<br />
font-size: 13px;<br />
font-weight: 500;<br />
}<br />
#contact #message input, #contact #message textarea {<br />
width: 300px;<br />
max-width: 300px;<br />
background: #000;<br />
border: 0;<br />
border-bottom: 1px solid #373737;<br />
width: 100%;<br />
color: #ddd;<br />
font-size: 13px;<br />
font-weight: 500;<br />
padding: 8px 10px;<br />
}<br />
#contact #message textarea {<br />
height: 80px;<br />
}<br />
#contact #message input:focus, #contact #message textarea:focus {<br />
background: #111;<br />
outline: 0;<br />
}<br />
#contact #message button {<br />
padding: 14px 40px 14px 12px;<br />
color: #fff;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
text-align: left;<br />
font-size: 12px;<br />
background: #343434 url(art/message-arrow.png) no-repeat right center;<br />
display: block;<br />
margin: 0;<br />
width: 180px;<br />
-webkit-transition: background-color .2s ease-in-out;<br />
-moz-transition: background-color .2s ease-in-out;<br />
transition: background-color .2s ease-in-out;<br />
font-family: "proxima-nova", "HelveticaNeue", "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
}<br />
#contact #message button:hover {<br />
background-color: #666;<br />
}<br />
.contact footer {<br />
margin: 0;<br />
}<br />
footer {<br />
padding: 35px 0 20px;<br />
background: #003399;<br />
height: 130px;<br />
box-shadow: 4px 3px 25px #000;<br />
}<br />
footer h3 {<br />
font-size: 13px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
color: #fff;<br />
text-transform: uppercase;<br />
margin: 0 0 20px;<br />
}<br />
footer p {<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
}<br />
footer p a, footer p a:visited, footer p span {<br />
color: #dedede;<br />
}<br />
footer p a:hover {<br />
color: #fff;<br />
}<br />
#footer-contact p {<br />
margin-right: 40px;<br />
float: left;<br />
}<br />
#footer-project p {<br />
max-width: 180px;<br />
}<br />
#footer-newsletter {<br />
position: relative;<br />
}<br />
#footer-newsletter p {<br />
position: absolute;<br />
font-size: 11px;<br />
top: 0;<br />
right: 0;<br />
color: #7c7c7c;<br />
}<br />
#footer-newsletter input {<br />
width: 220px;<br />
height: 19px;<br />
background: #202020;<br />
border: 0;<br />
margin: 0;<br />
padding: 10px;<br />
color: #fff;<br />
font-size: 12px;<br />
-webkit-transition: background .3s ease-in-out;<br />
-moz-transition: background .3s ease-in-out;<br />
transition: background .3s ease-in-out;<br />
float: left;<br />
border-radius: 0;<br />
}<br />
#footer-newsletter input:focus {<br />
outline: 0;<br />
background: #333;<br />
}<br />
#footer-newsletter label {<br />
position: absolute;<br />
top: 49px;<br />
left: 10px;<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
}<br />
#footer-newsletter button {<br />
width: 39px;<br />
height: 39px;<br />
text-indent: -99999em;<br />
background: #202020 url(art/btn-arrow.svg) no-repeat center center;<br />
float: right;<br />
-webkit-transition: background .3s ease-in-out;<br />
-moz-transition: background .3s ease-in-out;<br />
transition: background .3s ease-in-out;<br />
}<br />
#footer-newsletter button:hover {<br />
background-color: #333;<br />
}<br />
#footer-final {<br />
margin: 15px auto;<br />
padding-top: 35px;<br />
border-top: 1px solid #313131;<br />
position: relative;<br />
}<br />
#footer-final a, #footer-final a:visited {<br />
color: #aaa;<br />
}<br />
#footer-final a:hover {<br />
color: #fff;<br />
}<br />
#footer-final p {<br />
font-weight: 600;<br />
font-size: 12px;<br />
display: block;<br />
margin: 0;<br />
}<br />
#footer-nav {<br />
text-align: center;<br />
}<br />
#footer-nav a {<br />
margin: 0 8px;<br />
}<br />
#footer-final p#footer-social {<br />
text-align: right;<br />
margin-left: 40px;<br />
}<br />
#footer-social a, #footer-social a:visited {<br />
margin: 0 0 0 16px;<br />
}<br />
.left {<br />
float: left;<br />
}<br />
.right {<br />
float: right;<br />
}<br />
span.error {<br />
color: red;<br />
font-size: 12px;<br />
}<br />
p.success {<br />
background: #009b00;<br />
padding: 5px;<br />
color: #fff;<br />
text-align: center;<br />
font-weight: 600;<br />
border-radius: 3px;<br />
}<br />
p.fail {<br />
background: red;<br />
padding: 5px;<br />
color: #fff;<br />
text-align: center;<br />
font-weight: 600;<br />
border-radius: 3px;<br />
}<br />
.success {<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
}<br />
.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.aligncenter, div.aligncenter {<br />
display: block;<br />
margin: 5px auto 5px auto;<br />
}<br />
.alignright {<br />
float: right;<br />
margin: 5px 0 20px 20px;<br />
}<br />
.alignleft {<br />
float: left;<br />
margin: 5px 20px 20px 0;<br />
}<br />
.aligncenter {<br />
display: block;<br />
margin: 5px auto 5px auto;<br />
}<br />
a img.alignright {<br />
float: right;<br />
margin: 5px 0 20px 20px;<br />
}<br />
a img.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
a img.alignleft {<br />
float: left;<br />
margin: 5px 20px 20px 0;<br />
}<br />
a img.aligncenter {<br />
display: block;<br />
margin-left: auto;<br />
margin-right: auto;<br />
}<br />
.wp-caption {<br />
background: #fff;<br />
border: 1px solid #f0f0f0;<br />
max-width: 96%;<br />
padding: 5px 3px 10px;<br />
text-align: center;<br />
}<br />
.wp-caption.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.wp-caption.alignleft {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.wp-caption.alignright {<br />
margin: 5px 0 20px 20px;<br />
}<br />
.wp-caption img {<br />
border: 0 none;<br />
height: auto;<br />
margin: 0;<br />
max-width: 98.5%;<br />
padding: 0;<br />
width: auto;<br />
}<br />
.wp-caption p.wp-caption-text {<br />
font-size: 11px;<br />
line-height: 17px;<br />
margin: 0;<br />
padding: 0 4px 5px;<br />
}<br />
.cols_2_left, .cols_2_right, .cols_3_left, .cols_3_middle, .cols_3_right {<br />
margin: 0 0 1.5em;<br />
}<br />
.cols_2_left {<br />
float: left;<br />
width: 47%}<br />
.cols_2_right {<br />
float: right;<br />
width: 47%}<br />
.cols_3_left {<br />
float: left;<br />
width: 30%}<br />
.cols_3_middle {<br />
float: left;<br />
width: 30%;<br />
margin-left: 5%}<br />
.cols_3_right {<br />
float: right;<br />
width: 30%}<br />
.container {<br />
position: relative;<br />
width: 1000px;<br />
margin: 0 auto;<br />
padding: 0;<br />
}<br />
.container.short {<br />
width: 940px;<br />
}<br />
.container .column, .container .columns {<br />
float: left;<br />
display: inline;<br />
margin-left: 10px;<br />
margin-right: 10px;<br />
}<br />
.row {<br />
margin-bottom: 20px;<br />
}<br />
.column.alpha, .columns.alpha {<br />
margin-left: 0;<br />
}<br />
.column.omega, .columns.omega {<br />
margin-right: 0;<br />
}<br />
.container .one.column, .container .one.columns {<br />
width: 40px;<br />
}<br />
.container .two.columns {<br />
width: 100px;<br />
}<br />
.container .three.columns {<br />
width: 160px;<br />
}<br />
.container .four.columns {<br />
width: 220px;<br />
}<br />
.container .five.columns {<br />
width: 180px;<br />
}<br />
.container .six.columns {<br />
width: 340px;<br />
}<br />
.container .seven.columns {<br />
width: 400px;<br />
}<br />
.container .eight.columns {<br />
width: 460px;<br />
}<br />
.container .nine.columns {<br />
width: 520px;<br />
}<br />
.container .ten.columns {<br />
width: 580px;<br />
}<br />
.container .eleven.columns {<br />
width: 640px;<br />
}<br />
.container .twelve.columns {<br />
width: 700px;<br />
}<br />
.container .thirteen.columns {<br />
width: 760px;<br />
}<br />
.container .fourteen.columns {<br />
width: 820px;<br />
}<br />
.container .fifteen.columns {<br />
width: 880px;<br />
}<br />
.container .sixteen.columns {<br />
width: 940px;<br />
}<br />
.container .one-third.column {<br />
width: 290px;<br />
}<br />
.container .two-thirds.column {<br />
width: 615px;<br />
}<br />
.container .offset-by-one {<br />
padding-left: 60px;<br />
}<br />
.container .offset-by-two {<br />
padding-left: 120px;<br />
}<br />
.container .offset-by-three {<br />
padding-left: 180px;<br />
}<br />
.container .offset-by-four {<br />
padding-left: 240px;<br />
}<br />
.container .offset-by-five {<br />
padding-left: 300px;<br />
}<br />
.container .offset-by-six {<br />
padding-left: 360px;<br />
}<br />
.container .offset-by-seven {<br />
padding-left: 420px;<br />
}<br />
.container .offset-by-eight {<br />
padding-left: 480px;<br />
}<br />
.container .offset-by-nine {<br />
padding-left: 540px;<br />
}<br />
.container .offset-by-ten {<br />
padding-left: 600px;<br />
}<br />
.container .offset-by-eleven {<br />
padding-left: 660px;<br />
}<br />
.container .offset-by-twelve {<br />
padding-left: 720px;<br />
}<br />
.container .offset-by-thirteen {<br />
padding-left: 780px;<br />
}<br />
.container .offset-by-fourteen {<br />
padding-left: 840px;<br />
}<br />
.container .offset-by-fifteen {<br />
padding-left: 900px;<br />
}<br />
@media only screen and (max-width:1049px) {<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images.two img {<br />
width: 450px;<br />
}<br />
}@media only screen and (min-width:960px) {<br />
#logo {<br />
-webkit-transform-style: preserve-3d;<br />
}<br />
#logo1 {<br />
-webkit-transform-style: preserve-3d;<br />
}<br />
.sticky #logo {<br />
-webkit-transform: scale(.75);<br />
-moz-transform: scale(.75);<br />
-ms-transform: scale(.75);<br />
-o-transform: scale(.75);<br />
transform: scale(.75);<br />
top: 0;<br />
left: -10px;<br />
}<br />
.sticky #logo1 {<br />
-webkit-transform: scale(.75);<br />
-moz-transform: scale(.75);<br />
-ms-transform: scale(.75);<br />
-o-transform: scale(.75);<br />
transform: scale(.75);<br />
top: 0;<br />
right: -1px;<br />
}<br />
<br />
}@media only screen and (min-device-width :768px) and (max-device-width:1024px) and (orientation:landscape) {<br />
#logo {<br />
-webkit-transform-style: flat;<br />
}<br />
#logo1 {<br />
-webkit-transform-style: flat;<br />
}<br />
.sticky #logo {<br />
-webkit-transform: none;<br />
-moz-transform: none;<br />
-ms-transform: none;<br />
-o-transform: none;<br />
transform: none;<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
-webkit-transform: none;<br />
-moz-transform: none;<br />
-ms-transform: none;<br />
-o-transform: none;<br />
transform: none;<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
}@media only screen and (min-width:768px) and (max-width:959px) {<br />
.container {<br />
width: 768px;<br />
}<br />
.container.short {<br />
width: 748px;<br />
}<br />
.container .column, .container .columns {<br />
margin-left: 10px;<br />
margin-right: 10px;<br />
}<br />
.column.alpha, .columns.alpha {<br />
margin-left: 0;<br />
margin-right: 10px;<br />
}<br />
.column.omega, .columns.omega {<br />
margin-right: 0;<br />
margin-left: 10px;<br />
}<br />
.alpha.omega {<br />
margin-left: 0;<br />
margin-right: 0;<br />
}<br />
.container .one.column, .container .one.columns {<br />
width: 28px;<br />
}<br />
.container .two.columns {<br />
width: 76px;<br />
}<br />
.container .three.columns {<br />
width: 124px;<br />
}<br />
.container .four.columns {<br />
width: 172px;<br />
}<br />
.container .five.columns {<br />
width: 220px;<br />
}<br />
.container .six.columns {<br />
width: 268px;<br />
}<br />
.container .seven.columns {<br />
width: 316px;<br />
}<br />
.container .eight.columns {<br />
width: 364px;<br />
}<br />
.container .nine.columns {<br />
width: 412px;<br />
}<br />
.container .ten.columns {<br />
width: 460px;<br />
}<br />
.container .eleven.columns {<br />
width: 508px;<br />
}<br />
.container .twelve.columns {<br />
width: 556px;<br />
}<br />
.container .thirteen.columns {<br />
width: 604px;<br />
}<br />
.container .fourteen.columns {<br />
width: 652px;<br />
}<br />
.container .fifteen.columns {<br />
width: 700px;<br />
}<br />
.container .sixteen.columns {<br />
width: 748px;<br />
}<br />
.container .one-third.column {<br />
width: 236px;<br />
}<br />
.container .two-thirds.column {<br />
width: 492px;<br />
}<br />
.container .offset-by-one {<br />
padding-left: 48px;<br />
}<br />
.container .offset-by-two {<br />
padding-left: 96px;<br />
}<br />
.container .offset-by-three {<br />
padding-left: 144px;<br />
}<br />
.container .offset-by-four {<br />
padding-left: 192px;<br />
}<br />
.container .offset-by-five {<br />
padding-left: 240px;<br />
}<br />
.container .offset-by-six {<br />
padding-left: 288px;<br />
}<br />
.container .offset-by-seven {<br />
padding-left: 336px;<br />
}<br />
.container .offset-by-eight {<br />
padding-left: 384px;<br />
}<br />
.container .offset-by-nine {<br />
padding-left: 432px;<br />
}<br />
.container .offset-by-ten {<br />
padding-left: 480px;<br />
}<br />
.container .offset-by-eleven {<br />
padding-left: 528px;<br />
}<br />
.container .offset-by-twelve {<br />
padding-left: 576px;<br />
}<br />
.container .offset-by-thirteen {<br />
padding-left: 624px;<br />
}<br />
.container .offset-by-fourteen {<br />
padding-left: 672px;<br />
}<br />
.container .offset-by-fifteen {<br />
padding-left: 720px;<br />
}<br />
.sticky #logo {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
nav a {<br />
padding-left: 10px;<br />
padding-right: 10px;<br />
}<br />
#footer-contact {<br />
width: 220px;<br />
}<br />
#footer-newsletter {<br />
float: right;<br />
width: 280px;<br />
}<br />
.mini-post {<br />
width: 236px;<br />
}<br />
.mini-post img {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images img {<br />
width: 100%}<br />
#case-details .images.two img {<br />
width: 350px;<br />
}<br />
#case-details, #meta .container, .single #page-header .container {<br />
padding: 0 10px;<br />
width: 748px;<br />
}<br />
.about .column-text {<br />
padding: 0 15px;<br />
}<br />
#feature h1 {<br />
font-size: 55px;<br />
}<br />
#page-header.case h1 {<br />
font-size: 40px;<br />
line-height: 34px;<br />
}<br />
#page-header.case h2 {<br />
max-width: 40%;<br />
line-height: 24px;<br />
}<br />
#blog-top #categories {<br />
width: 220px;<br />
}<br />
#blog-top form {<br />
width: 340px;<br />
}<br />
#blog-top #rss {<br />
width: 100px;<br />
}<br />
.container .seven.columns {<br />
width: 400px;<br />
}<br />
.single-work #page-header h2, .single-lab #page-header h2 {<br />
font-weight: 500;<br />
font-size: 16px;<br />
line-height: 22px;<br />
}<br />
<br />
footer {<br />
height: auto;<br />
}<br />
#wrap {<br />
margin-bottom: 0;<br />
min-height: 0;<br />
}<br />
.push {<br />
display: none;<br />
}<br />
#copyright, #footer-social {<br />
width: 150px;<br />
margin: 0!important;<br />
}<br />
#location-map {<br />
display: none;<br />
}<br />
#contact {<br />
height: auto;<br />
}<br />
#contact .container {<br />
padding-top: 10px;<br />
}<br />
#contact #contact-details {<br />
float: left;<br />
width: 340px;<br />
}<br />
#contact #message {<br />
float: right;<br />
width: 400px;<br />
}<br />
#footer-nav {<br />
width: 448px;<br />
}<br />
#processes {<br />
margin: 0 30px;<br />
}<br />
.process .text {<br />
padding: 0 15px;<br />
}<br />
.process p {<br />
font-size: 13px;<br />
line-height: 18px;<br />
}<br />
}@media only screen and (max-width:767px) {<br />
.container, .container.short {<br />
width: 300px;<br />
}<br />
.container .columns, .container .column {<br />
margin: 0;<br />
}<br />
.container .one.column, .container .one.columns, .container .two.columns, .container .three.columns, .container .four.columns, .container .five.columns, .container .six.columns, .container .seven.columns, .container .eight.columns, .container .nine.columns, .container .ten.columns, .container .eleven.columns, .container .twelve.columns, .container .thirteen.columns, .container .fourteen.columns, .container .fifteen.columns, .container .sixteen.columns, .container .one-third.column, .container .two-thirds.column {<br />
width: 300px;<br />
}<br />
.container .offset-by-one, .container .offset-by-two, .container .offset-by-three, .container .offset-by-four, .container .offset-by-five, .container .offset-by-six, .container .offset-by-seven, .container .offset-by-eight, .container .offset-by-nine, .container .offset-by-ten, .container .offset-by-eleven, .container .offset-by-twelve, .container .offset-by-thirteen, .container .offset-by-fourteen, .container .offset-by-fifteen {<br />
padding-left: 0;<br />
}<br />
.sticky #logo {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
#feature {<br />
height: 250px;<br />
}<br />
#feature article, #feature ul {<br />
display: none!important;<br />
}<br />
#feature h1 {<br />
top: 100px;<br />
font-size: 36px;<br />
line-height: 42px;<br />
}<br />
#home-content, #home-content .column, .mini-post {<br />
width: auto;<br />
float: none!important;<br />
display: block;<br />
}<br />
#home-content .column {<br />
margin: 0 0 40px;<br />
}<br />
.mini-post {<br />
margin: 0 auto 20px;<br />
width: 290px;<br />
}<br />
#tweet {<br />
padding: 40px 0 0 0;<br />
margin: 40px 0;<br />
width: auto;<br />
}<br />
#tweet .text {<br />
padding: 40px 20px 0;<br />
background-position: center top;<br />
}<br />
nav a {<br />
padding-left: 6px;<br />
padding-right: 6px;<br />
font-size: 12px;<br />
}<br />
<br />
#work article {<br />
width: 30%;<br />
margin: 10px;<br />
}<br />
#work article .image, #work article a img, .labs#work article .image {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images img, #case-details .images.two img {<br />
width: 100%;<br />
margin: 0 0 20px!important;<br />
}<br />
#page-header.case h1 {<br />
font-size: 30px;<br />
line-height: 28px;<br />
max-width: 55%}<br />
#page-header.case h2 {<br />
max-width: 50%;<br />
line-height: 24px;<br />
}<br />
.labs #page-header h1 {<br />
font-size: 46px;<br />
}<br />
#meta p {<br />
float: right;<br />
margin: 0;<br />
}<br />
#meta p:first-child {<br />
width: 50%;<br />
float: left;<br />
}<br />
#work-with-us {<br />
font-size: 18px;<br />
}<br />
#blog-top #categories {<br />
margin-bottom: 15px;<br />
}<br />
#blog-top form {<br />
width: 200px;<br />
}<br />
#blog-top input {<br />
width: 170px;<br />
}<br />
#blog-top #rss {<br />
width: 80px;<br />
float: right;<br />
}<br />
#blog article img {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#blog article {<br />
margin-bottom: 30px;<br />
}<br />
#blog article iframe {<br />
height: 270px;<br />
}<br />
#blog article .post h2 {<br />
font-size: 20px;<br />
line-height: 22px;<br />
}<br />
#blog .share {<br />
display: none;<br />
}<br />
.short-url {<br />
margin-bottom: 5px;<br />
}<br />
.categories {<br />
float: left;<br />
}<br />
.content h2 {<br />
font-size: 30px;<br />
line-height: 38px;<br />
}<br />
.content p {<br />
font-size: 14px;<br />
line-height: 22px;<br />
font-weight: 500;<br />
}<br />
<br />
footer {<br />
height: auto;<br />
}<br />
#wrap {<br />
margin-bottom: 0;<br />
min-height: 0;<br />
}<br />
.push {<br />
display: none;<br />
}<br />
#processes {<br />
margin: 0 20px;<br />
}<br />
.process .text {<br />
padding: 0 10px;<br />
}<br />
.process p {<br />
font-size: 12px;<br />
line-height: 16px;<br />
}<br />
}@media only screen and (min-width:480px) and (max-width:767px) {<br />
.container, .container.short {<br />
width: 420px;<br />
}<br />
.container .columns, .container .column {<br />
margin: 0;<br />
}<br />
.container .one.column, .container .one.columns, .container .two.columns, .container .three.columns, .container .four.columns, .container .five.columns, .container .six.columns, .container .seven.columns, .container .eight.columns, .container .nine.columns, .container .ten.columns, .container .eleven.columns, .container .twelve.columns, .container .thirteen.columns, .container .fourteen.columns, .container .fifteen.columns, .container .sixteen.columns, .container .one-third.column, .container .two-thirds.column {<br />
width: 420px;<br />
}<br />
#footer-newsletter input {<br />
width: 360px;<br />
}<br />
#blog-top form {<br />
width: 300px;<br />
}<br />
#blog-top input {<br />
width: 270px;<br />
}<br />
#blog-top #rss {<br />
width: 100px;<br />
float: right;<br />
}<br />
.categories {<br />
float: right;<br />
}<br />
.column-text {<br />
-moz-column-count: 1;<br />
-webkit-column-count: 1;<br />
column-count: 1;<br />
}<br />
}@media only screen and (min-width:320px) and (max-width:580px) {<br />
#logo, .sticky #logo {<br />
background-position: 0 -80px;<br />
top: 10px;<br />
left: 10px;<br />
}<br />
#logo1, .sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 10px;<br />
right: 1px;<br />
}<br />
header, header.sticky {<br />
height: 100px;<br />
}<br />
.sticky nav, nav {<br />
margin-top: 64px;<br />
}<br />
nav a {<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
}<br />
#feature h1 {<br />
top: 120px;<br />
font-size: 22px;<br />
line-height: 30px;<br />
}<br />
#tweet .text p {<br />
font-size: 20px;<br />
line-height: 24px;<br />
}<br />
#work article {<br />
width: 45%;<br />
margin: 6px;<br />
}<br />
#page-header {<br />
height: 200px;<br />
}<br />
#page-header h1 {<br />
font-size: 34px;<br />
}<br />
.labs #page-header h1 {<br />
font-size: 25px;<br />
}<br />
#page-header.case h2 {<br />
font-size: 16px;<br />
font-weight: 500;<br />
line-height: 20px;<br />
}<br />
#work-with-us {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#work-with-us span {<br />
background-image: none;<br />
}<br />
#contact #message input, #contact #message textarea {<br />
width: 200px;<br />
max-width: 200px;<br />
}<br />
#fresh ul {<br />
display: none;<br />
}<br />
#blog article iframe {<br />
height: 200px;<br />
}<br />
#process {<br />
display: none;<br />
}<br />
}.container:after {<br />
content: "\0020";<br />
display: block;<br />
height: 0;<br />
clear: both;<br />
visibility: hidden;<br />
}</div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Team
Team:Shenzhen BGIC 0101/Team
2013-10-20T08:21:41Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<style type="text/css"><br />
.container{<br />
width:930px;<br />
}<br />
.reveal-modal-bg { <br />
position: fixed; <br />
height: 100%;<br />
width: 100%;<br />
background: #000;<br />
background: rgba(0,0,0,.8);<br />
z-index: 100;<br />
display: none;<br />
top: 0;<br />
left: 0; <br />
}<br />
<br />
.reveal-modal {<br />
visibility: hidden;<br />
top: 100px; <br />
left: 50%;<br />
margin-left: -300px;<br />
width: 520px;<br />
background: #eee url(modal-gloss.png) no-repeat -200px -80px;<br />
position: absolute;<br />
z-index: 101;<br />
padding: 30px 40px 34px;<br />
-moz-border-radius: 5px;<br />
-webkit-border-radius: 5px;<br />
border-radius: 5px;<br />
-moz-box-shadow: 0 0 10px rgba(0,0,0,.4);<br />
-webkit-box-shadow: 0 0 10px rgba(0,0,0,.4);<br />
-box-shadow: 0 0 10px rgba(0,0,0,.4);<br />
}<br />
<br />
.reveal-modal.small { width: 200px; margin-left: -140px;}<br />
.reveal-modal.medium { width: 400px; margin-left: -240px;}<br />
.reveal-modal.large { width: 600px; margin-left: -340px;}<br />
.reveal-modal.xlarge { width: 800px; margin-left: -440px;}<br />
<br />
.reveal-modal .close-reveal-modal {<br />
font-size: 22px;<br />
line-height: .5;<br />
position: absolute;<br />
top: 8px;<br />
right: 11px;<br />
color: #aaa;<br />
text-shadow: 0 -1px 1px rbga(0,0,0,.6);<br />
font-weight: bold;<br />
cursor: pointer;<br />
} <br />
.team{<br />
font-family: 'Tangerine', serif;<br />
font-size: 48px;<br />
text-shadow: 4px 4px 4px #8E9092;<br />
color: #257EFC;<br />
letter-spacing: 0.1em;<br />
word-spacing: 0.3em;<br />
font-weight: 700;<br />
line-height: 36px;<br />
margin-left: 15%<br />
}<br />
<br />
</style><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/reveal?action=raw&ctype=text/javascript"></script><br />
<!--[if lte IE 8]><link rel="stylesheet" href="http://www.humaan.com.au/wp-content/themes/humaan/css/iestyle.css"><![endif]--><br />
<!--[if IE 9]><link rel="stylesheet" href="http://www.humaan.com.au/wp-content/themes/humaan/css/ie9.css"><![endif]--><br />
<style type="text/css"><br />
//body { font-family: "HelveticaNeue","Helvetica-Neue", "Helvetica", "Arial", sans-serif; }<br />
.big-link { display:block; margin:0px;}<br />
</style><br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="wrap" style="font-family: Verdana, Geneva, sans-serif;background-color:#ff9"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav> <br />
<a href="https://2013.igem.org/Main_Page" id="logo1">logo</a><br />
</header><br />
<br />
<br />
<div id="page-header" style="background: url(https://static.igem.org/mediawiki/2013/5/52/Tj_1.jpg) no-repeat 0 0; height:668px;width: 100%;"><br />
<h1></h1><br />
</div><br />
<br/><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution"><br />
<div class="text"><br />
<h2>Consortium</h2><hr/><br />
<p id="my_team">Shenzhen_BGIC_0101 is a special consortium named after a city and a academy. Team members are not from one school, but six. In their 3rd or 4th year in university, some undergraduate students came to Shenzhen_BGIC_0101 and joined a co-cultured program called Innovation Classes on Genomics, in BGI College. After lectures introducing synthetic biology and iGEM given by our instructor K2, students from five schools, including HUST, SCU, SCUT, UESTC, SCNU, SEU, have decided to set up a united team for iGEM 2013.<br />
Students from five different universities have contributed to this project.</p><p>including:<br/><br />
- Huazhong University of Science and Technology, China<br/><br />
- Sichuan University, China<br/><br />
- South China University of Technology, China<br/><br />
- University of Electronic Science and Technology of China, China<br/><br />
- South China Normal University, China<br/></p><br/><br />
<br/><br/></p><br />
<br />
</div></div><br />
</article> <br />
<br />
</section><br />
<br/><br />
<section id="blog" class="container"><br />
<br />
<article class="clearfix"><br />
<div id="post-1815" class="post-1815 post type-post status-publish format-standard hentry category-evolution"><br />
<div class="text"><br />
<h2>Attributions & Support</h2><hr/><br />
<h3>Financial support:</h3><p><br />
BGI College, it paid team & attendance registration fee, traveling allowance and accommodation fee for us.</p><br />
<br/><h3>Workplace & desktop & test environment provider:</h3><p><br />
BGI, Shenzhen, it provided us enough room to discuss, work together, organize meetings and also at least 7 desktops. BGI also allowed us to test our plug-ins and program on mainframe.</p><br />
<br/><h3>Server support:</h3><p><br />
Thanks Dr. Huixiong Li from UESTC supports us a web server.</p><br />
<br/><h3>Brain storming support:</h3><p><br />
Mr. Kang Kang joined the brain-storming often to give suggestions.</p><br />
<br/><h3>Software design guidance:</h3><p><br />
Mr. Yun Wang assisted us to design the third module SegmMan, assembly from 2k minichunks to 10k chunks, and then to 30k megachunks.<br/><br />
Dr. Patrick Yizhi Cai checked the assembly strategy, and point out some errors of design principle, especially in the homologous recombination from 30k megachunks to whole chromosome.</p><br />
<br/><h3>Software based framework provider:</h3><p><br />
Jbrowse & Gbrowse from GMOD.<br/><br />
GeneDesign & BioStudio from Dr. Sarah Richardson of John Hopkins University.<br/><br />
GASP from Dr. Eroshenko from Harvard School of Engineering and Applied Sciences.<br/></p><br />
<br/><h3>Drawing support:</h3><p><br />
Mr. Boxian Wang from USB helped us to copy hand painted drawings into mouse painted.</p><br />
<h3>Team shirt design support:</h3><p><br />
Mr. Kang Kang helped us to design two types of shirts, one for team members, another for advertising and sales.</p><br />
<br/><br />
<br/><p>We would like to thank all the people who came to South China regional workshop and gave feedbacks to us.<br/><br />
Dr Jiankui He from SUSTC, Peng Nie from SYSU, Ruosang Qiu from XMU.<br/><br />
And all people who withdrew our team at early time:<br/><br />
Silong Sun, Jing Lu, Hanshi Xu, Yi Zhao, He Zhang and Weilin Qiu.<br />
</p><br/><br/><br />
</div></div><br />
</article><br />
</section><br/><br />
<h3 class="team">Advisors</h3><br/><br />
<section class="container clearfix" id="home-content1"><br />
<div class="one-third column"><br />
<a href="#" class="big-link" data-reveal-id="myModalyhm"><br />
<h2>Huanming YANG</h2><br />
<article class="mini-post"><br />
<br />
<img width="290" height="320" src="https://static.igem.org/mediawiki/2013/9/9d/Yhm.jpg" class="attachment-front-page-thumb wp-post-image" alt="Huanming YANG" /><br />
<br />
</article> </a><br />
</div> <br />
<div class="one-third column"><br />
<a href="#" class="big-link" data-reveal-id="myModalwy"> <br />
<h2>Yun WANG</h2> <br />
<article class="mini-post"><br />
<img width="290" height="320" src="https://static.igem.org/mediawiki/2013/6/6f/Wy.jpg" class="attachment-front-page-thumb wp-post-image" alt="Yun Wang" /> <br />
<br />
</article><br />
</a> <br />
</div><br />
<br />
<div class="one-third column"><br />
<a href="#" class="big-link" data-reveal-id="myModalsy"><br />
<h2>Yue SHEN</h2><br />
<article class="mini-post"><br />
<br />
<img width="290" height="320" src="https://static.igem.org/mediawiki/2013/2/2d/Sy.jpg" class="attachment-front-page-thumb wp-post-image" alt="Yue SHEN" /><br />
<br />
</article> </a><br />
</div><br />
<br />
</section><br />
<br/><br/><br />
<h3 class="team">Instructors</h3><br />
<br/><br />
<section class="container clearfix" id="home-content"><br />
<div class="one-third column" style="margin: 0 110px 0 110px;"><br />
<a href="#" class="big-link" data-reveal-id="myModalcy"> <br />
<h2>Yu CHEN</h2> <br />
<article class="mini-post"><br />
<img width="290" height="320" src="https://static.igem.org/mediawiki/2013/3/34/Cyy.jpg" class="attachment-front-page-thumb wp-post-image" alt="Yu CHEN" /> <br />
<br />
</article><br />
</a> <br />
</div><br />
<br />
<div class="one-third column"><br />
<a href="#" class="big-link" data-reveal-id="myModalkk"><br />
<h2>Kang KANG</h2><br />
<article class="mini-post"><br />
<br />
<img width="290" height="320" src="https://static.igem.org/mediawiki/2013/0/07/K2.jpg" class="attachment-front-page-thumb wp-post-image" alt="K2" /><br />
<br />
</article> </a><br />
</div><br />
<br />
</section><br />
<br/><br/><br />
<h3 class="team">Postgraduate & Undergraduates</h3><br />
</br><br />
<section class="container clearfix" id="home-content"><br />
<div class="one-third column"><br />
<a href="#" class="big-link" data-reveal-id="myModal1"> <br />
<h2>Yuxiang Li</h2><br />
<br />
<article class="mini-post"><br />
<br />
<img width="290" height="135" src="https://static.igem.org/mediawiki/igem.org/3/3a/Xiang.jpg" class="attachment-front-page-thumb wp-post-image" alt="Yuxiang Li" /> <br />
<div class="text"><br />
<h3>Yuxiang Li</h3><br />
<br />
<p>Yuxiang Li is a postgraduate of USAS, majoring in bioengineering. He is responsible for constructing the data structure, designing CRISPR site, enzyme modification and codon optimization in Genovo project.</p> <br />
</div><br />
</article><br />
</a> <br />
</div><br />
<br />
<div class="one-third column"><br />
<a href="#" class="big-link" data-reveal-id="myModal2"><br />
<h2>Zeyun Hu</h2><br />
<article class="mini-post"><br />
<br />
<img width="290" height="135" src="https://static.igem.org/mediawiki/igem.org/b/be/Hu.jpg" class="attachment-front-page-thumb wp-post-image" alt="Zeyun Hu" /><br />
<div class="text"><br />
<h3>Zeyun Hu</h3><br />
<p>Huzeyun is a student from Sichuan university, major in biotechnology, his is also a parter of Innovation Class of BGI. His hobby is play for the belife "life is a charming game, we should go all out."</p><br />
</div><br />
</article> </a><br />
</div><br />
<div class="one-third column"><br />
<a href="#" class="big-link" data-reveal-id="myModal3"><br />
<h2>jianhun gong</h2> <br />
<article class="mini-post"><br />
<img width="290" height="135" src="https://static.igem.org/mediawiki/2013/a/a7/Gongjianhun.png" class="attachment-front-page-thumb wp-post-image" alt="gongjun" /> <br />
<div class="text"><br />
<h3>Jianhun Gong</h3> <br />
<p>Gong just graduated from his college SCUT and now work for BGI as a bioinformatics analyst. <br />
He is a crazy SBer. This year, he will lead this team and is responsible for the project, Genovo’s design and the third module, SegmMan’s implementation.<br />
</p><br />
</div><br />
</article> </a><br />
</div><br />
<br />
<br />
</section><br />
<br />
<br/><br/><br/><br />
<section class="container clearfix" id="home-content"><br />
<div class="one-third column"><br />
<a href="#" class="big-link" data-reveal-id="myModal4"><br />
<h2>Yincheng Li</h2><br />
<br />
<br />
<article class="mini-post"><br />
<img width="290" height="135" src="https://static.igem.org/mediawiki/igem.org/2/2b/Li.jpg" class="attachment-front-page-thumb wp-post-image" alt="Yincheng Li" /> <br />
<div class="text"><br />
<h3>Yincheng Li</h3><br />
<p>Li is an undergraduate from SCNU, specializing in Information and Computer Science. He focus on the pathway processing. He enjoys the project and the teamwork. </p><br />
</div><br />
</article> </a><br />
</div><br />
<div class="one-third column"><br />
<a href="#" class="big-link" data-reveal-id="myModal5"><br />
<h2>Czh</h2><br />
<article class="mini-post"><br />
<br />
<img width="290" height="135" src="https://static.igem.org/mediawiki/igem.org/2/29/Zc.jpg" class="attachment-front-page-thumb wp-post-image" alt="Chao Zhang" /><br />
<div class="text"><br />
<h3>Chao Zhang</h3><br />
<p>Czh is a student from UESTC, he is insteresting in bioinformatics and web technology. In his spare time, he enjoy playing e-sports (DOTA) with his little buddies.</p><br />
</div><br />
</article> </a><br />
</div><br />
<div class="one-third column"><br />
<a href="#" class="big-link" data-reveal-id="myModal6"><br />
<h2>Luxuia</h2> <br />
<article class="mini-post"> <img width="290" height="135" src="https://static.igem.org/mediawiki/igem.org/2/2d/Lu.jpg" class="attachment-front-page-thumb wp-post-image" alt="Xujia Lu" /> <br />
<div class="text"><br />
<h3>Xujia Lu</h3><br />
<p>{<br/>&nbsp;&nbsp;Name: "Xujia, Lu",<br />&nbsp;&nbsp;School: "UESTC",<br />&nbsp;&nbsp;Major: "Biomedical-Engineering",<br />&nbsp;&nbsp;Description:"too YONG too SIMPLE, sometime NAIVE"<br/>}</p><br />
</div><br />
</article> </a><br />
</div><br />
<br />
<br />
</section><br />
<br/><br/><br/><br />
<section class="container clearfix" id="home-content"><br />
<div class="one-third column"><br />
<a href="#" class="big-link" data-reveal-id="myModal7"><br />
<h2>Xianming Liang</h2><br />
<br />
<br />
<article class="mini-post"><br />
<img width="290" height="135" src="https://static.igem.org/mediawiki/igem.org/a/a5/Xiao.jpg" class="attachment-front-page-thumb wp-post-image" alt="Xinming Liang" /> <br />
<div class="text"><br />
<h3>Xinming Liang</h3><br />
<p>Liang is a postgraduate in UCAS, majoring in Bioengineering. Everyone calls him "Xiao ming". He loves badminton, orienteering, swimming and other outdoor sports. In addition, he also is a HD movie fan.<br />
</p><br />
</div><br />
</article> </a><br />
</div><br />
<div class="one-third column"><br />
<a href="#" class="big-link" data-reveal-id="myModal8"><br />
<h2>Wenzhuo Zeng</h2><br />
<article class="mini-post"><br />
<br />
<img width="290" height="135" src="https://static.igem.org/mediawiki/igem.org/d/d6/Zeng.jpg" class="attachment-front-page-thumb wp-post-image" alt="Wenzuo Zeng" /><br />
<div class="text"><br />
<h3>Wenzhuo Zeng</h3><br />
<p>Wenzhuo or Table is an undergraduate student in SCNU, majoring in Software Engineering. She is responsible for the pathway drawing of Genovo and she has passion for doing such significant software. </p><br />
</div><br />
</article> </a><br />
</div><br />
<div class="one-third column"><br />
<a href="#" class="big-link" data-reveal-id="myModal9"><br />
<h2>Boxian Lai</h2> <br />
<article class="mini-post"><br />
<img width="290" height="135" src="https://static.igem.org/mediawiki/2013/3/35/Bx.jpg" class="attachment-front-page-thumb wp-post-image" alt="Boxian Lai" /> </a><br />
<div class="text"><br />
<h3>Boxian Lai</h3><br />
<p>Boxian lai is student form South China Normal University, major in computer sciences. He is responsible for designing oligonucleotides and primers for synthesis on a chip.His interest is play computer program and mine information form bio_data. </p><br />
</div><br />
</article> </a><br />
</div><br />
<br />
<br />
</section><br />
<br/><br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<footer><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<div id="myModal1" class="reveal-modal"><br />
<h1>Yuxiang Li</h1><br />
<p>He is responsible for constructing the data structure, designing CRISPR site, enzyme modification and codon optimization in Genovo project.</p><br />
<a class="close-reveal-modal">&#215;</a><br />
</div><br />
<div id="myModal2" class="reveal-modal"><br />
<h1>Zeyun Hu</h1><br />
<p>collect the document about our project.</p><br />
<a class="close-reveal-modal">&#215;</a><br />
</div><br />
<div id="myModal3" class="reveal-modal"><br />
<h1>Jianhui Gong</h1><br />
<p> he leads this team and is responsible for the project, Genovo’s design and the third module, SegmMan’s implementation.</p><br />
<a class="close-reveal-modal">&#215;</a><br />
</div><br />
<div id="myModal4" class="reveal-modal"><br />
<h1>compare our software with BioStudio</h1><br />
<p></p><br />
<a class="close-reveal-modal">&#215;</a><br />
</div><br />
<div id="myModal5" class="reveal-modal"><br />
<h1>Chao Zhang</h1><br />
<p>He makes this wiki</p><br />
<a class="close-reveal-modal">&#215;</a><br />
</div><br />
<div id="myModal6" class="reveal-modal"><br />
<h1>Xujia LU</h1><br />
<p><pre><br />
{<br />
Name: "Xujia, Lu",<br />
School: "University of Electronic Science and Technology of China" ,<br />
School_short: "UESTC",<br />
Major: "Biomedical-Engineering", <br />
Enjoy: [<br />
"Cate", <br />
"Gamming", <br />
"Grils", <br />
"Jogging", <br />
"Programming",<br />
"Reading",<br />
"Travel"<br />
],<br />
Description: [<br />
"too YONG too SIMPLE, sometime NAIVE"<br />
]<br />
}</pre></p><br />
<a class="close-reveal-modal">&#215;</a><br />
</div><br />
<div id="myModal7" class="reveal-modal"><br />
<h1>Xinming Liang</h1><br />
<p> I participate in the part of neo-chromosome construction and designing. </p><br />
<a class="close-reveal-modal">&#215;</a><br />
</div><br />
<div id="myModal8" class="reveal-modal"><br />
<h1>Wenzhuo Zeng</h1><br />
<p>She is responsible for the pathway drawing of Genovo</p><br />
<a class="close-reveal-modal">&#215;</a><br />
</div><br />
<div id="myModal9" class="reveal-modal"><br />
<h1>Boxian Lai</h1><br />
<p>He is responsible for designing oligonucleotides and primers for synthesis on a chip.</p><br />
<a class="close-reveal-modal">&#215;</a><br />
</div><br />
<div id="myModalcy" class="reveal-modal"><br />
<h1>Yu CHEN</h1><br />
<p>Errrggg! Yu is busy!<br/><br />
He is Research Scientist in BGI Research Institute & ZMBH PhD Candidate.<br />
As an observer, he is peering natural history. As an investigator, he is digging the design principle of molecular system. As an engineer, he is stacking molecular system with special function.</p><br />
<a class="close-reveal-modal">&#215;</a><br />
</div><br />
<div id="myModalsy" class="reveal-modal"><br />
<h1>Yue SHNE</h1><br />
<p>Yue (Chantal) Shen is the Leader of the Synthetic Biology Unit of the Beijing Genomics Institute, Shenzhen. She received her Masters degree in Biomedical Engineering from the University of Melbourne. Her work focuses on metagenomic sequencing, assembly, and characterization of genes found in the human intestinal tract. She also leads international cooperative projects, including the E. coli Central Dogma Project with the BIOFAB and the SC2.0 Project with Johns Hopkins University.</p><br />
<a class="close-reveal-modal">&#215;</a><br />
</div><br />
<div id="myModalwy" class="reveal-modal"><br />
<h1>Yun WANG</h1><br />
<p>Mr. Yun Wang,project manager of Unit of Synthetic Biology in BGI.<br />
He is responsible for the SC2.0 project in BGI, about chrII and chrVII.</p><br />
<a class="close-reveal-modal">&#215;</a><br />
</div><br />
<div id="myModalkk" class="reveal-modal"><br />
<h1>Kang KANG</h1><br />
<p>In BGI, K2 is veeeeery famous for lurking on BBS and sarcasm! As a former champion in a national robot contest, a hacker, a web engineer, a designer, a magazine editor, a citizen reporter, a filmmaker and a drama actor, he has always too many wonderings, including how life works on its core database - genome. Cracking and hacking the code of life, making actors in cell perform on his scripts, has become the primary task of this young scientist.</p><br />
<a class="close-reveal-modal">&#215;</a><br />
</div><br />
<div id="myModalyhm" class="reveal-modal"><br />
<h1>Dr.YANG</h1><br />
<p>Dr. Huanming Yang is a globally recognized leader in genetic and genomic research. He founded BGI, the largest genomics organization in the world presently, in 1999. Dr. Yang and his collaborators at BGI have made significant contributions to the International Human Genome Project, the International Human HapMap project and the 1000 Genomes Project. In conjunction with its research projects, BGI has established its technical platforms based on large-scale genome sequencing, efficient bioinformatics analyses, and innovative genetic healthcare initiatives. </p><br />
<a class="close-reveal-modal">&#215;</a><br />
</div><br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/aaa?action=raw&ctype=text/javascript"></script><br />
<br />
</body><br />
</html><br />
{{Scroll}}</div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/style
Team:Shenzhen BGIC 0101/style
2013-10-20T08:21:06Z
<p>Czh: </p>
<hr />
<div>@font-face {<br />
font-family: 'Tangerine';<br />
font-style: normal;<br />
font-weight: 400;<br />
src: local('Tangerine'), url(http://themes.googleusercontent.com/static/fonts/tangerine/v3/HGfsyCL5WASpHOFnouG-RD8E0i7KZn-EPnyo3HZu7kw.woff) format('woff');<br />
}<br />
<br />
html, body, div, span, applet, object, iframe, h1, h2, h3, h4, h5, h6, p, blockquote, pre, a, abbr, acronym, address, big, cite, code, del, dfn, em, img, ins, kbd, q, s, samp, small, strike, strong, sub, sup, tt, var, b, u, i, center, dl, dt, dd, ol, ul, li, fieldset, form, label, legend, table, caption, tbody, tfoot, thead, tr, th, td, article, aside, canvas, details, embed, figure, figcaption, footer, header, hgroup, menu, nav, output, ruby, section, summary, time, mark, audio, video {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-size: 100%;<br />
font: inherit;<br />
vertical-align: baseline;<br />
letter-spacing: 0.05em;<br />
}<br />
article, aside, details, figcaption, figure, footer, header, hgroup, menu, nav, section {<br />
display: block;<br />
}<br />
body {<br />
line-height: 1;<br />
}<br />
ol, ul {<br />
list-style: none;<br />
}<br />
<br />
p, ul, ol {<br />
margin: 0 0 0px; <br />
<br />
}<br />
ul, ol {<br />
padding: 1.5em 0 0 2.5em;<br />
}<br />
<br />
<br />
body {<br />
/* background: #f2f2f2;*/<br />
background: #262626;<br />
font-family: "proxima-nova", "HelveticaNeue", "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
font-size: 14px;<br />
line-height: 21px;<br />
color: #262626;<br />
-webkit-font-smoothing: antialiased;<br />
-webkit-text-size-adjust: 100%}<br />
html, body {<br />
height: 100%}<br />
#wrap {<br />
//background: url(https://static.igem.org/mediawiki/2013/f/f4/Gene.jpg) no-repeat fixed;<br />
background-size:cover;<br />
margin-bottom: 0px;<br />
min-height: 100%;<br />
height: auto!important;<br />
height: 100%}<br />
.push {<br />
height: 45px;<br />
}<br />
p img {<br />
margin: 0;<br />
}<br />
em {<br />
font-style: italic;<br />
}<br />
strong {<br />
font-weight: bold;<br />
}<br />
hr {<br />
border: solid #ddd;<br />
border-width: 1px 0 0;<br />
clear: both;<br />
margin: 10px 0 30px;<br />
height: 0;<br />
}<br />
a, a:visited {<br />
color: #666;<br />
text-decoration: none;<br />
outline: 0;<br />
}<br />
a:hover, a:focus {<br />
color: #333;<br />
}<br />
p a, p a:visited {<br />
line-height: inherit;<br />
}<br />
img.scale-with-grid {<br />
max-width: 100%;<br />
height: auto;<br />
}<br />
<br />
header {<br />
width: 100%;<br />
height: 90px;<br />
background: #222;<br />
background: rgba(0, 0, 0, .2);<br />
border-color: #fff;<br />
border-bottom: 1px solid rgba(255, 255, 255, .25);<br />
position: fixed;<br />
top: 0;<br />
z-index: 10;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
-ms-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
}<br />
header.sticky {<br />
height: 60px;<br />
background: #993399;<br />
border: 0;<br />
box-shadow: 0 1px 6px rgba(0, 0, 0, .2);<br />
}<br />
header h1 {<br />
margin: 0;<br />
}<br />
#logo {<br />
width: 84px;<br />
height: 59px;<br />
display: block;<br />
background: url(https://static.igem.org/mediawiki/igem.org/e/e8/Genovo-logo.png) no-repeat;<br />
text-indent: -99999em;<br />
position: absolute;<br />
top: 15px;<br />
left: 15px;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
}<br />
#logo1{<br />
width: 80px;<br />
height: 60px;<br />
display: block;<br />
background: url(https://static.igem.org/mediawiki/2013/d/dd/Igem_logo12.png) no-repeat;<br />
text-indent: -99999em;<br />
position: absolute;<br />
top: 15px;<br />
right: 10px;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
z-index:9999;<br />
}<br />
nav {<br />
text-align: center;<br />
margin-top: 35px;<br />
-webkit-transition: margin .2s ease-in-out;<br />
-moz-transition: margin .2s ease-in-out;<br />
transition: margin .2s ease-in-out;<br />
}<br />
.sticky nav {<br />
margin-top: 20px;<br />
}<br />
nav a, #start-project {<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
color: #555;<br />
text-shadow: 0 1px 0 #fff;<br />
padding: 16px;<br />
font-size: 14px;<br />
}<br />
.light nav a {<br />
color: #ddd;/* top-nav color */<br />
text-shadow: 0 1px 0 rgba(0, 0, 0, .5);<br />
opacity: .5;<br />
-webkit-transition: opacity .1s linear;<br />
-moz-transition: opacity .1s linear;<br />
transition: opacity .1s linear;<br />
}<br />
nav a.current-menu-item, nav a.current_page_parent, nav a:hover, .single-work .light nav a.menu-item-18, .single-lab .light nav a.menu-item-17, .single-post .light nav a.menu-item-16 {<br />
opacity: 1;<br />
}<br />
.single-work nav a.current_page_parent, .single-lab nav a.current_page_parent {<br />
opacity: .5;<br />
}<br />
#blog {<br />
z-index: 6;<br />
}<br />
#blog article {<br />
margin: 10px auto 60px;<br />
max-width: 700px;<br />
position: relative;<br />
}<br />
<br />
<br />
#home-content h2, #fresh h2, h2.section-title {<br />
color: #358;<br />
font-size: 12px;<br />
text-shadow: 0 1px 0 #fff;<br />
font-weight: 600;<br />
width: 150px;<br />
background: #aaa;<br />
margin: -20px auto 20px;<br />
text-align: center;<br />
}<br />
#home-content .column, #fresh {<br />
border-top: 1px solid #d0d0d0;<br />
}<br />
#home-content .one-third {<br />
float: right!important;<br />
}<br />
.mini-post {<br />
float: left;<br />
background: #fff;<br />
box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
border-radius: 2px;<br />
overflow: hidden;<br />
width: 290px;<br />
-webkit-transition: all .2s ease-out;<br />
-moz-transition: all .2s ease-out;<br />
transition: all .2s ease-out;<br />
color: #333;<br />
min-height: 320px;<br />
cursor: pointer;<br />
}<br />
.mini-post:hover {<br />
margin-top: -5px;<br />
box-shadow: 0 3px 3px 0 rgba(0, 0, 0, .4);<br />
}<br />
.mini-post .text {<br />
padding: 20px 20px 10px;<br />
}<br />
.mini-post h3 {<br />
font-size: 16px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
margin: 0;<br />
}<br />
.mini-post .meta {<br />
font-size: 11px;<br />
}<br />
.mini-post p {<br />
font-size: 13px;<br />
}<br />
.mini-post .more {<br />
font-weight: 600;<br />
}<br />
#tweet {<br />
margin: 40px auto;<br />
padding-top: 40px;<br />
border-top: 1px solid #d0d0d0;<br />
}<br />
#tweet .text {<br />
padding: 0 90px;<br />
background: url(art/bird.svg) no-repeat 35px 0;<br />
font-size: 26px;<br />
font-weight: 300;<br />
}<br />
#tweet .text p {<br />
margin: 0 0 10px;<br />
text-align: center;<br />
line-height: 36px;<br />
}<br />
#tweet .text p.author {<br />
font-size: 20px;<br />
}<br />
#page-header {<br />
width: auto;<br />
// height: 220px;<br />
//background: url(https://static.igem.org/mediawiki/2013/3/34/Test-head.jpg) top center;<br />
margin: 0 0 35px;<br />
box-shadow: 2px 1px 12px #272727;<br />
<br />
}<br />
.wf-loading #page-header h1 {<br />
visibility: hidden;<br />
}<br />
<br />
.blog #page-header {<br />
// background: url(https://static.igem.org/mediawiki/2013/3/34/Test-head.jpg) top center;<br />
}<br />
#page-header h1 {<br />
font-family: "abril-fatface", 'Adobe Garamond', 'Garamond', serif;<br />
color: #fff;<br />
text-align: center;<br />
padding: 130px 0 0 0;<br />
text-shadow: 0 2px 0 #000;<br />
font-size: 60px;<br />
}<br />
#blog {<br />
z-index: 6;<br />
}<br />
#blog article {<br />
margin: 10px auto 60px;<br />
max-width: 1200px;<br />
position: relative;<br />
}<br />
#blog article .post {<br />
background: #cf9;<br />
// box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
box-shadow: 2px 1px 6px #272727;<br />
border-radius: 2px;<br />
overflow: hidden;<br />
color: #333;<br />
margin: 0 0 15px;<br />
}<br />
#blog article .post .text {<br />
padding: 20px 20px 10px;<br />
}<br />
.post-content a {<br />
color: #2683a5;<br />
}<br />
.post-content a:hover {<br />
color: #4ea9a2; <br />
}<br />
#blog article .post h2 {<br />
font-family: 'Tangerine', serif;<br />
font-size: 48px;<br />
text-shadow: 4px 4px 4px #aaa;<br />
color: #38f;<br />
letter-spacing: 0.1em;<br />
word-spacing: 0.3em;<br />
font-weight: 700;<br />
line-height: 36px;<br />
margin: 0;<br />
}<br />
#blog article .post h3 {<br />
font-size: 14px;<br />
line-height: 18px;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
}<br />
#blog article .post .meta {<br />
font-size: 11px;<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
}<br />
#blog article .post p {<br />
font-size: 16px;<br />
line-height: 19px;<br />
font-family: Trebuchet MS;<br />
font-weight: 600;<br />
}<br />
.short-url, .share, .categories {<br />
background: #eaeaea left center no-repeat;<br />
border-radius: 2px;<br />
border-bottom: 1px solid #fff;<br />
border-top: 1px solid #d0d0d0;<br />
float: left;<br />
margin: 0 20px 0 0;<br />
padding: 4px 15px 4px 35px;<br />
font-size: 11px;<br />
color: #666;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
text-shadow: 0 1px 0 #fff;<br />
-webkit-transition: all .2s ease-out;<br />
-moz-transition: all .2s ease-out;<br />
transition: all .2s ease-out;<br />
}<br />
.addthis_toolbox {<br />
display: none;<br />
padding: 0 20px 20px;<br />
}<br />
.short-url:hover, .share:hover {<br />
background-color: #ddd;<br />
border-top: 1px solid #aaa;<br />
}<br />
<br />
#blog article.quote {<br />
max-width: 940px;<br />
}<br />
#blog article.quote .quote-content {<br />
background: #676767;<br />
padding: 30px;<br />
border-radius: 3px;<br />
border-top: #111 1px solid;<br />
border-bottom: #fff 1px solid;<br />
margin: 0 0 15px;<br />
}<br />
#blog article.quote .quote-content p {<br />
font-size: 26px;<br />
line-height: 32px;<br />
color: #eee;<br />
font-weight: 300;<br />
}<br />
#blog article.quote p.ref {<br />
color: #fff;<br />
padding: 0;<br />
margin: 0;<br />
}<br />
#blog article.quote .quote-content a {<br />
color: #fff;<br />
text-decoration: underline;<br />
}<br />
#blog-pagination {<br />
display: block;<br />
text-align: center;<br />
margin: 35px 0;<br />
}<br />
.wp-paginate {<br />
display: inline-block;<br />
padding: 0;<br />
box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
border-radius: 3px;<br />
}<br />
.wp-paginate li {<br />
padding: 0!important;<br />
display: inline-block;<br />
background-image: none!important;<br />
background-color: #fff;<br />
margin: 0;<br />
float: left;<br />
}<br />
.wp-paginate a, .wp-paginate .page.current {<br />
color: #333;<br />
padding: 10px 13px;<br />
display: inline-block;<br />
margin-bottom: 0!important;<br />
min-width: 10px;<br />
border-right: 1px solid #eee;<br />
font-size: 12px;<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
-webkit-transition: all .1s ease-in-out;<br />
-moz-transition: all .1s ease-in-out;<br />
transition: all .1s ease-in-out;<br />
}<br />
.wp-paginate span {<br />
margin-bottom: 0!important;<br />
}<br />
.wp-paginate a.next {<br />
border-left: 0;<br />
}<br />
.wp-paginate .page {<br />
margin: 0;<br />
}<br />
.wp-paginate .page.current {<br />
background-color: #fafafa;<br />
color: #888;<br />
}<br />
.wp-paginate a:hover {<br />
background: #555;<br />
color: #fff;<br />
border-right: 1px solid #555;<br />
}<br />
#disqus_thread {<br />
margin: 10px auto 35px!important;<br />
max-width: 660px;<br />
position: relative;<br />
background: #eaeaea;<br />
border-radius: 2px;<br />
border-bottom: 1px solid #fff;<br />
border-top: 1px solid #d0d0d0;<br />
color: #1a1a1a;<br />
padding: 20px;<br />
font-size: 12px;<br />
}<br />
#disqus_thread h3 {<br />
font-size: 14px;<br />
text-transform: uppercase;<br />
text-shadow: 0 1px 0 #fff;<br />
font-weight: 600;<br />
}<br />
#contact {<br />
position: relative;<br />
height: 940px;<br />
}<br />
#location-map {<br />
width: 100%;<br />
height: 940px;<br />
display: block;<br />
position: absolute;<br />
top: 0;<br />
}<br />
#contact .container {<br />
padding-top: 60px;<br />
}<br />
#contact #contact-details, #contact #message {<br />
background: #262626;<br />
float: none;<br />
display: block;<br />
margin: 0 0 35px;<br />
box-shadow: 0 0 25px 0 rgba(0, 0, 0, .25);<br />
}<br />
#phone-address, #work-planner {<br />
padding: 30px 40px;<br />
}<br />
#phone-address {<br />
border-bottom: 1px solid #565656;<br />
}<br />
#phone-address p, #work-planner h2, #message h2 {<br />
text-transform: uppercase;<br />
color: #fff;<br />
font-weight: 600;<br />
font-size: 14px;<br />
}<br />
#phone-address p {<br />
padding-left: 35px;<br />
}<br />
#phone-address p#phone {<br />
background: url(art/phone.png) no-repeat 2px 2px;<br />
}<br />
#phone-address p#address {<br />
background: url(art/map.png) no-repeat 2px 2px;<br />
margin: 0;<br />
}<br />
#work-planner h2, #message h2 {<br />
margin: 0 0 10px;<br />
line-height: normal;<br />
}<br />
#work-planner p {<br />
color: #9c9c9c;<br />
font-size: 13px;<br />
font-weight: 600;<br />
}<br />
#work-planner a {<br />
padding: 12px 40px 12px 12px;<br />
color: #fff;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
font-size: 12px;<br />
background: #ce462b url(art/get-started-arrow.png) no-repeat right center;<br />
margin: 0 0 10px;<br />
display: block;<br />
width: 128px;<br />
-webkit-transition: background-color .2s ease-in-out;<br />
-moz-transition: background-color .2s ease-in-out;<br />
transition: background-color .2s ease-in-out;<br />
}<br />
#work-planner a:hover {<br />
background-color: #4ea9a2;<br />
}<br />
#contact #message .wrapper {<br />
padding: 30px 40px;<br />
}<br />
#contact #message .field {<br />
display: block;<br />
position: relative;<br />
margin: 0 0 15px;<br />
}<br />
#contact #message label {<br />
position: absolute;<br />
top: 9px;<br />
left: 11px;<br />
color: #aaa;<br />
font-size: 13px;<br />
font-weight: 500;<br />
}<br />
#contact #message input, #contact #message textarea {<br />
width: 300px;<br />
max-width: 300px;<br />
background: #000;<br />
border: 0;<br />
border-bottom: 1px solid #373737;<br />
width: 100%;<br />
color: #ddd;<br />
font-size: 13px;<br />
font-weight: 500;<br />
padding: 8px 10px;<br />
}<br />
#contact #message textarea {<br />
height: 80px;<br />
}<br />
#contact #message input:focus, #contact #message textarea:focus {<br />
background: #111;<br />
outline: 0;<br />
}<br />
#contact #message button {<br />
padding: 14px 40px 14px 12px;<br />
color: #fff;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
text-align: left;<br />
font-size: 12px;<br />
background: #343434 url(art/message-arrow.png) no-repeat right center;<br />
display: block;<br />
margin: 0;<br />
width: 180px;<br />
-webkit-transition: background-color .2s ease-in-out;<br />
-moz-transition: background-color .2s ease-in-out;<br />
transition: background-color .2s ease-in-out;<br />
font-family: "proxima-nova", "HelveticaNeue", "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
}<br />
#contact #message button:hover {<br />
background-color: #666;<br />
}<br />
.contact footer {<br />
margin: 0;<br />
}<br />
footer {<br />
padding: 35px 0 20px;<br />
background: #003399;<br />
height: 130px;<br />
box-shadow: 4px 3px 25px #000;<br />
}<br />
footer h3 {<br />
font-size: 13px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
color: #fff;<br />
text-transform: uppercase;<br />
margin: 0 0 20px;<br />
}<br />
footer p {<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
}<br />
footer p a, footer p a:visited, footer p span {<br />
color: #dedede;<br />
}<br />
footer p a:hover {<br />
color: #fff;<br />
}<br />
#footer-contact p {<br />
margin-right: 40px;<br />
float: left;<br />
}<br />
#footer-project p {<br />
max-width: 180px;<br />
}<br />
#footer-newsletter {<br />
position: relative;<br />
}<br />
#footer-newsletter p {<br />
position: absolute;<br />
font-size: 11px;<br />
top: 0;<br />
right: 0;<br />
color: #7c7c7c;<br />
}<br />
#footer-newsletter input {<br />
width: 220px;<br />
height: 19px;<br />
background: #202020;<br />
border: 0;<br />
margin: 0;<br />
padding: 10px;<br />
color: #fff;<br />
font-size: 12px;<br />
-webkit-transition: background .3s ease-in-out;<br />
-moz-transition: background .3s ease-in-out;<br />
transition: background .3s ease-in-out;<br />
float: left;<br />
border-radius: 0;<br />
}<br />
#footer-newsletter input:focus {<br />
outline: 0;<br />
background: #333;<br />
}<br />
#footer-newsletter label {<br />
position: absolute;<br />
top: 49px;<br />
left: 10px;<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
}<br />
#footer-newsletter button {<br />
width: 39px;<br />
height: 39px;<br />
text-indent: -99999em;<br />
background: #202020 url(art/btn-arrow.svg) no-repeat center center;<br />
float: right;<br />
-webkit-transition: background .3s ease-in-out;<br />
-moz-transition: background .3s ease-in-out;<br />
transition: background .3s ease-in-out;<br />
}<br />
#footer-newsletter button:hover {<br />
background-color: #333;<br />
}<br />
#footer-final {<br />
margin: 15px auto;<br />
padding-top: 35px;<br />
border-top: 1px solid #313131;<br />
position: relative;<br />
}<br />
#footer-final a, #footer-final a:visited {<br />
color: #aaa;<br />
}<br />
#footer-final a:hover {<br />
color: #fff;<br />
}<br />
#footer-final p {<br />
font-weight: 600;<br />
font-size: 12px;<br />
display: block;<br />
margin: 0;<br />
}<br />
#footer-nav {<br />
text-align: center;<br />
}<br />
#footer-nav a {<br />
margin: 0 8px;<br />
}<br />
#footer-final p#footer-social {<br />
text-align: right;<br />
margin-left: 40px;<br />
}<br />
#footer-social a, #footer-social a:visited {<br />
margin: 0 0 0 16px;<br />
}<br />
.left {<br />
float: left;<br />
}<br />
.right {<br />
float: right;<br />
}<br />
span.error {<br />
color: red;<br />
font-size: 12px;<br />
}<br />
p.success {<br />
background: #009b00;<br />
padding: 5px;<br />
color: #fff;<br />
text-align: center;<br />
font-weight: 600;<br />
border-radius: 3px;<br />
}<br />
p.fail {<br />
background: red;<br />
padding: 5px;<br />
color: #fff;<br />
text-align: center;<br />
font-weight: 600;<br />
border-radius: 3px;<br />
}<br />
.success {<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
}<br />
.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.aligncenter, div.aligncenter {<br />
display: block;<br />
margin: 5px auto 5px auto;<br />
}<br />
.alignright {<br />
float: right;<br />
margin: 5px 0 20px 20px;<br />
}<br />
.alignleft {<br />
float: left;<br />
margin: 5px 20px 20px 0;<br />
}<br />
.aligncenter {<br />
display: block;<br />
margin: 5px auto 5px auto;<br />
}<br />
a img.alignright {<br />
float: right;<br />
margin: 5px 0 20px 20px;<br />
}<br />
a img.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
a img.alignleft {<br />
float: left;<br />
margin: 5px 20px 20px 0;<br />
}<br />
a img.aligncenter {<br />
display: block;<br />
margin-left: auto;<br />
margin-right: auto;<br />
}<br />
.wp-caption {<br />
background: #fff;<br />
border: 1px solid #f0f0f0;<br />
max-width: 96%;<br />
padding: 5px 3px 10px;<br />
text-align: center;<br />
}<br />
.wp-caption.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.wp-caption.alignleft {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.wp-caption.alignright {<br />
margin: 5px 0 20px 20px;<br />
}<br />
.wp-caption img {<br />
border: 0 none;<br />
height: auto;<br />
margin: 0;<br />
max-width: 98.5%;<br />
padding: 0;<br />
width: auto;<br />
}<br />
.wp-caption p.wp-caption-text {<br />
font-size: 11px;<br />
line-height: 17px;<br />
margin: 0;<br />
padding: 0 4px 5px;<br />
}<br />
.cols_2_left, .cols_2_right, .cols_3_left, .cols_3_middle, .cols_3_right {<br />
margin: 0 0 1.5em;<br />
}<br />
.cols_2_left {<br />
float: left;<br />
width: 47%}<br />
.cols_2_right {<br />
float: right;<br />
width: 47%}<br />
.cols_3_left {<br />
float: left;<br />
width: 30%}<br />
.cols_3_middle {<br />
float: left;<br />
width: 30%;<br />
margin-left: 5%}<br />
.cols_3_right {<br />
float: right;<br />
width: 30%}<br />
.container {<br />
position: relative;<br />
width: 1000px;<br />
margin: 0 auto;<br />
padding: 0;<br />
}<br />
.container.short {<br />
width: 940px;<br />
}<br />
.container .column, .container .columns {<br />
float: left;<br />
display: inline;<br />
margin-left: 10px;<br />
margin-right: 10px;<br />
}<br />
.row {<br />
margin-bottom: 20px;<br />
}<br />
.column.alpha, .columns.alpha {<br />
margin-left: 0;<br />
}<br />
.column.omega, .columns.omega {<br />
margin-right: 0;<br />
}<br />
.container .one.column, .container .one.columns {<br />
width: 40px;<br />
}<br />
.container .two.columns {<br />
width: 100px;<br />
}<br />
.container .three.columns {<br />
width: 160px;<br />
}<br />
.container .four.columns {<br />
width: 220px;<br />
}<br />
.container .five.columns {<br />
width: 180px;<br />
}<br />
.container .six.columns {<br />
width: 340px;<br />
}<br />
.container .seven.columns {<br />
width: 400px;<br />
}<br />
.container .eight.columns {<br />
width: 460px;<br />
}<br />
.container .nine.columns {<br />
width: 520px;<br />
}<br />
.container .ten.columns {<br />
width: 580px;<br />
}<br />
.container .eleven.columns {<br />
width: 640px;<br />
}<br />
.container .twelve.columns {<br />
width: 700px;<br />
}<br />
.container .thirteen.columns {<br />
width: 760px;<br />
}<br />
.container .fourteen.columns {<br />
width: 820px;<br />
}<br />
.container .fifteen.columns {<br />
width: 880px;<br />
}<br />
.container .sixteen.columns {<br />
width: 940px;<br />
}<br />
.container .one-third.column {<br />
width: 290px;<br />
}<br />
.container .two-thirds.column {<br />
width: 615px;<br />
}<br />
.container .offset-by-one {<br />
padding-left: 60px;<br />
}<br />
.container .offset-by-two {<br />
padding-left: 120px;<br />
}<br />
.container .offset-by-three {<br />
padding-left: 180px;<br />
}<br />
.container .offset-by-four {<br />
padding-left: 240px;<br />
}<br />
.container .offset-by-five {<br />
padding-left: 300px;<br />
}<br />
.container .offset-by-six {<br />
padding-left: 360px;<br />
}<br />
.container .offset-by-seven {<br />
padding-left: 420px;<br />
}<br />
.container .offset-by-eight {<br />
padding-left: 480px;<br />
}<br />
.container .offset-by-nine {<br />
padding-left: 540px;<br />
}<br />
.container .offset-by-ten {<br />
padding-left: 600px;<br />
}<br />
.container .offset-by-eleven {<br />
padding-left: 660px;<br />
}<br />
.container .offset-by-twelve {<br />
padding-left: 720px;<br />
}<br />
.container .offset-by-thirteen {<br />
padding-left: 780px;<br />
}<br />
.container .offset-by-fourteen {<br />
padding-left: 840px;<br />
}<br />
.container .offset-by-fifteen {<br />
padding-left: 900px;<br />
}<br />
@media only screen and (max-width:1049px) {<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images.two img {<br />
width: 450px;<br />
}<br />
}@media only screen and (min-width:960px) {<br />
#logo {<br />
-webkit-transform-style: preserve-3d;<br />
}<br />
#logo1 {<br />
-webkit-transform-style: preserve-3d;<br />
}<br />
.sticky #logo {<br />
-webkit-transform: scale(.75);<br />
-moz-transform: scale(.75);<br />
-ms-transform: scale(.75);<br />
-o-transform: scale(.75);<br />
transform: scale(.75);<br />
top: 0;<br />
left: -10px;<br />
}<br />
.sticky #logo1 {<br />
-webkit-transform: scale(.75);<br />
-moz-transform: scale(.75);<br />
-ms-transform: scale(.75);<br />
-o-transform: scale(.75);<br />
transform: scale(.75);<br />
top: 0;<br />
right: -1px;<br />
}<br />
<br />
}@media only screen and (min-device-width :768px) and (max-device-width:1024px) and (orientation:landscape) {<br />
#logo {<br />
-webkit-transform-style: flat;<br />
}<br />
#logo1 {<br />
-webkit-transform-style: flat;<br />
}<br />
.sticky #logo {<br />
-webkit-transform: none;<br />
-moz-transform: none;<br />
-ms-transform: none;<br />
-o-transform: none;<br />
transform: none;<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
-webkit-transform: none;<br />
-moz-transform: none;<br />
-ms-transform: none;<br />
-o-transform: none;<br />
transform: none;<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
}@media only screen and (min-width:768px) and (max-width:959px) {<br />
.container {<br />
width: 768px;<br />
}<br />
.container.short {<br />
width: 748px;<br />
}<br />
.container .column, .container .columns {<br />
margin-left: 10px;<br />
margin-right: 10px;<br />
}<br />
.column.alpha, .columns.alpha {<br />
margin-left: 0;<br />
margin-right: 10px;<br />
}<br />
.column.omega, .columns.omega {<br />
margin-right: 0;<br />
margin-left: 10px;<br />
}<br />
.alpha.omega {<br />
margin-left: 0;<br />
margin-right: 0;<br />
}<br />
.container .one.column, .container .one.columns {<br />
width: 28px;<br />
}<br />
.container .two.columns {<br />
width: 76px;<br />
}<br />
.container .three.columns {<br />
width: 124px;<br />
}<br />
.container .four.columns {<br />
width: 172px;<br />
}<br />
.container .five.columns {<br />
width: 220px;<br />
}<br />
.container .six.columns {<br />
width: 268px;<br />
}<br />
.container .seven.columns {<br />
width: 316px;<br />
}<br />
.container .eight.columns {<br />
width: 364px;<br />
}<br />
.container .nine.columns {<br />
width: 412px;<br />
}<br />
.container .ten.columns {<br />
width: 460px;<br />
}<br />
.container .eleven.columns {<br />
width: 508px;<br />
}<br />
.container .twelve.columns {<br />
width: 556px;<br />
}<br />
.container .thirteen.columns {<br />
width: 604px;<br />
}<br />
.container .fourteen.columns {<br />
width: 652px;<br />
}<br />
.container .fifteen.columns {<br />
width: 700px;<br />
}<br />
.container .sixteen.columns {<br />
width: 748px;<br />
}<br />
.container .one-third.column {<br />
width: 236px;<br />
}<br />
.container .two-thirds.column {<br />
width: 492px;<br />
}<br />
.container .offset-by-one {<br />
padding-left: 48px;<br />
}<br />
.container .offset-by-two {<br />
padding-left: 96px;<br />
}<br />
.container .offset-by-three {<br />
padding-left: 144px;<br />
}<br />
.container .offset-by-four {<br />
padding-left: 192px;<br />
}<br />
.container .offset-by-five {<br />
padding-left: 240px;<br />
}<br />
.container .offset-by-six {<br />
padding-left: 288px;<br />
}<br />
.container .offset-by-seven {<br />
padding-left: 336px;<br />
}<br />
.container .offset-by-eight {<br />
padding-left: 384px;<br />
}<br />
.container .offset-by-nine {<br />
padding-left: 432px;<br />
}<br />
.container .offset-by-ten {<br />
padding-left: 480px;<br />
}<br />
.container .offset-by-eleven {<br />
padding-left: 528px;<br />
}<br />
.container .offset-by-twelve {<br />
padding-left: 576px;<br />
}<br />
.container .offset-by-thirteen {<br />
padding-left: 624px;<br />
}<br />
.container .offset-by-fourteen {<br />
padding-left: 672px;<br />
}<br />
.container .offset-by-fifteen {<br />
padding-left: 720px;<br />
}<br />
.sticky #logo {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
nav a {<br />
padding-left: 10px;<br />
padding-right: 10px;<br />
}<br />
#footer-contact {<br />
width: 220px;<br />
}<br />
#footer-newsletter {<br />
float: right;<br />
width: 280px;<br />
}<br />
.mini-post {<br />
width: 236px;<br />
}<br />
.mini-post img {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images img {<br />
width: 100%}<br />
#case-details .images.two img {<br />
width: 350px;<br />
}<br />
#case-details, #meta .container, .single #page-header .container {<br />
padding: 0 10px;<br />
width: 748px;<br />
}<br />
.about .column-text {<br />
padding: 0 15px;<br />
}<br />
#feature h1 {<br />
font-size: 55px;<br />
}<br />
#page-header.case h1 {<br />
font-size: 40px;<br />
line-height: 34px;<br />
}<br />
#page-header.case h2 {<br />
max-width: 40%;<br />
line-height: 24px;<br />
}<br />
#blog-top #categories {<br />
width: 220px;<br />
}<br />
#blog-top form {<br />
width: 340px;<br />
}<br />
#blog-top #rss {<br />
width: 100px;<br />
}<br />
.container .seven.columns {<br />
width: 400px;<br />
}<br />
.single-work #page-header h2, .single-lab #page-header h2 {<br />
font-weight: 500;<br />
font-size: 16px;<br />
line-height: 22px;<br />
}<br />
<br />
footer {<br />
height: auto;<br />
}<br />
#wrap {<br />
margin-bottom: 0;<br />
min-height: 0;<br />
}<br />
.push {<br />
display: none;<br />
}<br />
#copyright, #footer-social {<br />
width: 150px;<br />
margin: 0!important;<br />
}<br />
#location-map {<br />
display: none;<br />
}<br />
#contact {<br />
height: auto;<br />
}<br />
#contact .container {<br />
padding-top: 10px;<br />
}<br />
#contact #contact-details {<br />
float: left;<br />
width: 340px;<br />
}<br />
#contact #message {<br />
float: right;<br />
width: 400px;<br />
}<br />
#footer-nav {<br />
width: 448px;<br />
}<br />
#processes {<br />
margin: 0 30px;<br />
}<br />
.process .text {<br />
padding: 0 15px;<br />
}<br />
.process p {<br />
font-size: 13px;<br />
line-height: 18px;<br />
}<br />
}@media only screen and (max-width:767px) {<br />
.container, .container.short {<br />
width: 300px;<br />
}<br />
.container .columns, .container .column {<br />
margin: 0;<br />
}<br />
.container .one.column, .container .one.columns, .container .two.columns, .container .three.columns, .container .four.columns, .container .five.columns, .container .six.columns, .container .seven.columns, .container .eight.columns, .container .nine.columns, .container .ten.columns, .container .eleven.columns, .container .twelve.columns, .container .thirteen.columns, .container .fourteen.columns, .container .fifteen.columns, .container .sixteen.columns, .container .one-third.column, .container .two-thirds.column {<br />
width: 300px;<br />
}<br />
.container .offset-by-one, .container .offset-by-two, .container .offset-by-three, .container .offset-by-four, .container .offset-by-five, .container .offset-by-six, .container .offset-by-seven, .container .offset-by-eight, .container .offset-by-nine, .container .offset-by-ten, .container .offset-by-eleven, .container .offset-by-twelve, .container .offset-by-thirteen, .container .offset-by-fourteen, .container .offset-by-fifteen {<br />
padding-left: 0;<br />
}<br />
.sticky #logo {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
#feature {<br />
height: 250px;<br />
}<br />
#feature article, #feature ul {<br />
display: none!important;<br />
}<br />
#feature h1 {<br />
top: 100px;<br />
font-size: 36px;<br />
line-height: 42px;<br />
}<br />
#home-content, #home-content .column, .mini-post {<br />
width: auto;<br />
float: none!important;<br />
display: block;<br />
}<br />
#home-content .column {<br />
margin: 0 0 40px;<br />
}<br />
.mini-post {<br />
margin: 0 auto 20px;<br />
width: 290px;<br />
}<br />
#tweet {<br />
padding: 40px 0 0 0;<br />
margin: 40px 0;<br />
width: auto;<br />
}<br />
#tweet .text {<br />
padding: 40px 20px 0;<br />
background-position: center top;<br />
}<br />
nav a {<br />
padding-left: 6px;<br />
padding-right: 6px;<br />
font-size: 12px;<br />
}<br />
<br />
#work article {<br />
width: 30%;<br />
margin: 10px;<br />
}<br />
#work article .image, #work article a img, .labs#work article .image {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images img, #case-details .images.two img {<br />
width: 100%;<br />
margin: 0 0 20px!important;<br />
}<br />
#page-header.case h1 {<br />
font-size: 30px;<br />
line-height: 28px;<br />
max-width: 55%}<br />
#page-header.case h2 {<br />
max-width: 50%;<br />
line-height: 24px;<br />
}<br />
.labs #page-header h1 {<br />
font-size: 46px;<br />
}<br />
#meta p {<br />
float: right;<br />
margin: 0;<br />
}<br />
#meta p:first-child {<br />
width: 50%;<br />
float: left;<br />
}<br />
#work-with-us {<br />
font-size: 18px;<br />
}<br />
#blog-top #categories {<br />
margin-bottom: 15px;<br />
}<br />
#blog-top form {<br />
width: 200px;<br />
}<br />
#blog-top input {<br />
width: 170px;<br />
}<br />
#blog-top #rss {<br />
width: 80px;<br />
float: right;<br />
}<br />
#blog article img {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#blog article {<br />
margin-bottom: 30px;<br />
}<br />
#blog article iframe {<br />
height: 270px;<br />
}<br />
#blog article .post h2 {<br />
font-size: 20px;<br />
line-height: 22px;<br />
}<br />
#blog .share {<br />
display: none;<br />
}<br />
.short-url {<br />
margin-bottom: 5px;<br />
}<br />
.categories {<br />
float: left;<br />
}<br />
.content h2 {<br />
font-size: 30px;<br />
line-height: 38px;<br />
}<br />
.content p {<br />
font-size: 14px;<br />
line-height: 22px;<br />
font-weight: 500;<br />
}<br />
<br />
footer {<br />
height: auto;<br />
}<br />
#wrap {<br />
margin-bottom: 0;<br />
min-height: 0;<br />
}<br />
.push {<br />
display: none;<br />
}<br />
#processes {<br />
margin: 0 20px;<br />
}<br />
.process .text {<br />
padding: 0 10px;<br />
}<br />
.process p {<br />
font-size: 12px;<br />
line-height: 16px;<br />
}<br />
}@media only screen and (min-width:480px) and (max-width:767px) {<br />
.container, .container.short {<br />
width: 420px;<br />
}<br />
.container .columns, .container .column {<br />
margin: 0;<br />
}<br />
.container .one.column, .container .one.columns, .container .two.columns, .container .three.columns, .container .four.columns, .container .five.columns, .container .six.columns, .container .seven.columns, .container .eight.columns, .container .nine.columns, .container .ten.columns, .container .eleven.columns, .container .twelve.columns, .container .thirteen.columns, .container .fourteen.columns, .container .fifteen.columns, .container .sixteen.columns, .container .one-third.column, .container .two-thirds.column {<br />
width: 420px;<br />
}<br />
#footer-newsletter input {<br />
width: 360px;<br />
}<br />
#blog-top form {<br />
width: 300px;<br />
}<br />
#blog-top input {<br />
width: 270px;<br />
}<br />
#blog-top #rss {<br />
width: 100px;<br />
float: right;<br />
}<br />
.categories {<br />
float: right;<br />
}<br />
.column-text {<br />
-moz-column-count: 1;<br />
-webkit-column-count: 1;<br />
column-count: 1;<br />
}<br />
}@media only screen and (min-width:320px) and (max-width:580px) {<br />
#logo, .sticky #logo {<br />
background-position: 0 -80px;<br />
top: 10px;<br />
left: 10px;<br />
}<br />
#logo1, .sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 10px;<br />
right: 1px;<br />
}<br />
header, header.sticky {<br />
height: 100px;<br />
}<br />
.sticky nav, nav {<br />
margin-top: 64px;<br />
}<br />
nav a {<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
}<br />
#feature h1 {<br />
top: 120px;<br />
font-size: 22px;<br />
line-height: 30px;<br />
}<br />
#tweet .text p {<br />
font-size: 20px;<br />
line-height: 24px;<br />
}<br />
#work article {<br />
width: 45%;<br />
margin: 6px;<br />
}<br />
#page-header {<br />
height: 200px;<br />
}<br />
#page-header h1 {<br />
font-size: 34px;<br />
}<br />
.labs #page-header h1 {<br />
font-size: 25px;<br />
}<br />
#page-header.case h2 {<br />
font-size: 16px;<br />
font-weight: 500;<br />
line-height: 20px;<br />
}<br />
#work-with-us {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#work-with-us span {<br />
background-image: none;<br />
}<br />
#contact #message input, #contact #message textarea {<br />
width: 200px;<br />
max-width: 200px;<br />
}<br />
#fresh ul {<br />
display: none;<br />
}<br />
#blog article iframe {<br />
height: 200px;<br />
}<br />
#process {<br />
display: none;<br />
}<br />
}.container:after {<br />
content: "\0020";<br />
display: block;<br />
height: 0;<br />
clear: both;<br />
visibility: hidden;<br />
}</div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Home
Team:Shenzhen BGIC 0101/Home
2013-10-20T08:16:04Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<!-- lazyload --><br />
<br />
<br />
<br />
<br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style_slider?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/jquery?action=raw&ctype=text/javascript"></script><br />
<br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<br />
<br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<style><br />
h3{<br />
font-family: 'Tangerine', serif;<br />
font-size: 45px;<br />
text-shadow: 4px 4px 4px #aaa;<br />
color: #38f;<br />
letter-spacing: 0.1em;<br />
word-spacing: 0.3em;<br />
font-weight: 700;<br />
line-height: 36px;<br />
margin: 0;<br />
}<br />
<br />
.reference{<br />
clear:both;<br />
top:40px;<br />
left:120px;<br />
<br />
font-size: 16px;<br />
line-height: 19px;<br />
font-family: Trebuchet MS;<br />
font-weight: 600;<br />
position:absolute;<br />
text-align:left;<br />
width:48%;<br />
padding:20px;<br />
background-color:#ffe;<br />
-moz-box-shadow:1px 3px 15px #ddd;<br />
-webkit-box-shadow:1px 3px 15px #ddd;<br />
box-shadow:4px 3px 25px #ddd;<br />
}<br />
<br />
ul.accordion{<br />
list-style:none; <br />
position:absolute;<br />
right:150px;<br />
top:0px;<br />
font-family: Cambria, serif;<br />
font-size: 16px;<br />
font-style: italic;<br />
line-height: 1.5em;<br />
}<br />
ul.accordion li{<br />
float:right;<br />
width:115px;<br />
height:480px;<br />
display:block;<br />
border-right:2px solid #fff;<br />
border-bottom:2px solid #fff;<br />
background-color:#fff;<br />
background-repeat:no-repeat;<br />
background-position:center center;<br />
position:relative;<br />
overflow:hidden;<br />
cursor:pointer;<br />
-moz-box-shadow:1px 3px 15px #555;<br />
-webkit-box-shadow:1px 3px 15px #555;<br />
box-shadow:1px 3px 15px #555;<br />
}<br />
ul.accordion li.bg1{<br />
background-image:url(https://static.igem.org/mediawiki/2013/c/c8/Bki-20101209112236-2125207650.jpg);<br />
}<br />
ul.accordion li.bg2{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bg3{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bg4{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bleft{<br />
border-left:2px solid #fff;<br />
}<br />
ul.accordion li .heading{<br />
background-color:#fff;<br />
padding:10px;<br />
margin-top:60px;<br />
opacity:0.9;<br />
text-transform:uppercase;<br />
font-style:normal;<br />
font-weight:bold;<br />
letter-spacing:1px;<br />
font-size:14px;<br />
color:#444;<br />
text-align:center;<br />
text-shadow:-1px -1px 1px #ccc;<br />
}<br />
ul.accordion li .description{<br />
position:absolute;<br />
width:480px;<br />
height:175px;<br />
bottom:0px;<br />
left:0px;<br />
display:none;<br />
}<br />
ul.accordion li .description h2{<br />
text-transform: uppercase;<br />
font-style: normal;<br />
font-weight: bold;<br />
letter-spacing: 1px;<br />
font-size: 25px;<br />
color: #444;<br />
text-align: left;<br />
margin: -15px 0px 0px 20px;<br />
text-shadow: -1px -1px 1px #ccc;<br />
}<br />
ul.accordion li .description p{<br />
line-height:14px;<br />
margin:10px 22px;<br />
font-family: "Trebuchet MS", sans-serif;<br />
font-size: 12px;<br />
font-style: italic;<br />
font-weight: normal;<br />
text-transform: none;<br />
letter-spacing: normal;<br />
line-height: 1.6em;<br />
}<br />
ul.accordion li .description a{<br />
position:absolute;<br />
bottom:5px;<br />
left:20px;<br />
text-transform:uppercase;<br />
font-style:normal;<br />
font-size:11px;<br />
text-decoration:none;<br />
color:#888;<br />
}<br />
ul.accordion li .description a:hover{<br />
color:#333;<br />
text-decoration:underline;<br />
}<br />
<br />
ul.accordion li .bgDescription{<br />
background:transparent url(https://static.igem.org/mediawiki/igem.org/1/15/BgDescription.png) repeat-x top left;<br />
height:340px;<br />
position:absolute;<br />
bottom:0px;<br />
left:0px;<br />
width:100%;<br />
display:none;<br />
}<br />
<br />
.win {<br />
width: 970px;<br />
margin: 50px auto;<br />
}<br />
.win a {<br />
line-height: 180px;<br />
display: block;<br />
margin: 8px;<br />
text-align: center;<br />
float: left;<br />
opacity: 1;<br />
}<br />
.win8 {<br />
margin: 8px;<br />
display: block;<br />
width : 300px;<br />
<br />
float: left;<br />
color: #015;<br />
font-family: Verdana, 'Times New Roman',serif;<br />
font-weight: 300;<br />
font-size: 13px;<br />
}<br />
h4{<br />
font-weight: 600;<br />
font-size: 17px;<br />
<br />
margin :8px;<br />
}<br />
.win8 img{<br />
width : 150px;<br />
}<br />
<br />
</style><br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/jquery?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
<br />
$(document).ready(function() {<br />
$('.win a').hover(function() {<br />
$(this).stop().animate({<br />
opacity: 0.5<br />
}, 300);<br />
}, function() {<br />
$(this).stop().animate({<br />
opacity: 1<br />
}, 300);<br />
});<br />
});<br />
<br />
</script><br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="wrap" style="font-family: Verdana, Geneva, sans-serif;background-color: #ff9;"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav><br />
<a href="https://2013.igem.org/Main_Page" id="logo1">igem</a> <br />
</header><br />
<br />
<br />
<div id="wowslider-container1"><br />
<div class="ws_images"><ul><br />
<li><img src="https://static.igem.org/mediawiki/2013/e/e5/Ggggg.png" alt="1" title="" id="wows1_0" class="lazy" />Genove</li><br />
<li><img src="https://static.igem.org/mediawiki/igem.org/c/c4/Slider2.jpg" alt="2" title="Nucleotide modification" id="wows1_1" class="lazy"/>Nucleotide modification allow users to modify sequence as their wishes by utilizing codon synonomousness.</li><br />
<li><img src="https://static.igem.org/mediawiki/igem.org/9/99/Slider3.jpg" alt="3" title="chromosome" id="wows1_2" class="lazy"/>We can help you creat a new chromosome.</li><br />
<li><img src="https://static.igem.org/mediawiki/2013/0/0a/Slider_4.jpg" alt="4" title="pathway" id="wows1_3" class="lazy"/>Genove can help you design a new pathway.</li><br />
<li><img src="https://static.igem.org/mediawiki/2013/1/1d/Slider_1.jpg" alt="5" title="team" id="wows1_4" class="lazy"/>All members of our team.</li><br />
</ul></div><br />
<div class="ws_bullets"><div><br />
<a href="#" title="1"><img src="" alt="1"/>1</a><br />
<a href="#" title="2"><img src="https://static.igem.org/mediawiki/igem.org/1/17/Little2.jpg" alt="2"/>2</a><br />
<a href="#" title="3"><img src="https://static.igem.org/mediawiki/igem.org/2/2f/Little3.jpg" alt="3"/>3</a><br />
<a href="#" title="4"><img src="https://static.igem.org/mediawiki/2013/c/c0/Little4.jpg" alt="4"/>4</a><br />
<a href="#" title="5"><img src="https://static.igem.org/mediawiki/2013/b/b2/Little1.jpg" alt="5"/>5</a><br />
</div></div></div><br />
<br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/wowslider?action=raw&ctype=text/javascript"></script> <br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/script?action=raw&ctype=text/javascript"></script><br />
<br />
<br/><br/><br />
<div class="win"><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/2/21/Lxm_3.png" /></a><h4>Neochr</h4>Construct genome's structure</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/c/c8/NucleoMod.png" /></a><h4>NucleoMod</h4>Modify CDS region</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/b/b2/SegmMan.png" /></a><h4>SegmMan</h4>Split into fragments</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial"><img src="https://static.igem.org/mediawiki/2013/c/ce/X_2.png" /></a><h4>Jbrowse GUI</h4>Operation interface</div><br />
<div class="win8"><a href="http://192.185.29.142/~luxujia/jbrowse_no_git/index.html?data=data/NeoChr/"><img src="https://static.igem.org/mediawiki/2013/4/47/Lxm_2.png" /></a><h4>Web sever</h4>Web version of Genovo</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial"><img src="https://static.igem.org/mediawiki/2013/0/08/Zwz.png" /></a> <h4>Tutorial</h4>Instruction for users</div><br />
</div><br />
<br />
<br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br />
<!-- The JavaScript --><br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1/jquery.min.js"></script><br />
<script type="text/javascript"><br />
$(function() {<br />
$('#accordion > li').hover(<br />
function () {<br />
var $this = $(this);<br />
$this.stop().animate({'width':'480px'},500);<br />
$('.heading',$this).stop(true,true).fadeOut();<br />
$('.bgDescription',$this).stop(true,true).slideDown(500);<br />
$('.description',$this).stop(true,true).fadeIn();<br />
},<br />
function () {<br />
var $this = $(this);<br />
$this.stop().animate({'width':'115px'},1000);<br />
$('.heading',$this).stop(true,true).fadeIn();<br />
$('.description',$this).stop(true,true).fadeOut(500);<br />
$('.bgDescription',$this).stop(true,true).slideUp(700);<br />
}<br />
);<br />
});<br />
</script><br />
<br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<br />
<footer><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.cn">gongjianhui@genomics.cn</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="http://www.humaan.com.au/wp-content/themes/humaan/js/scripts.min.js" type="text/javascript"></script><br />
<br />
<br />
</body><br />
</html><br />
{{Scroll}}</div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/style
Team:Shenzhen BGIC 0101/style
2013-10-20T08:14:52Z
<p>Czh: </p>
<hr />
<div>@font-face {<br />
font-family: 'Tangerine';<br />
font-style: normal;<br />
font-weight: 400;<br />
src: local('Tangerine'), url(http://themes.googleusercontent.com/static/fonts/tangerine/v3/HGfsyCL5WASpHOFnouG-RD8E0i7KZn-EPnyo3HZu7kw.woff) format('woff');<br />
}<br />
<br />
html, body, div, span, applet, object, iframe, h1, h2, h3, h4, h5, h6, p, blockquote, pre, a, abbr, acronym, address, big, cite, code, del, dfn, em, img, ins, kbd, q, s, samp, small, strike, strong, sub, sup, tt, var, b, u, i, center, dl, dt, dd, ol, ul, li, fieldset, form, label, legend, table, caption, tbody, tfoot, thead, tr, th, td, article, aside, canvas, details, embed, figure, figcaption, footer, header, hgroup, menu, nav, output, ruby, section, summary, time, mark, audio, video {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-size: 100%;<br />
font: inherit;<br />
vertical-align: baseline;<br />
letter-spacing: 0.05em;<br />
}<br />
article, aside, details, figcaption, figure, footer, header, hgroup, menu, nav, section {<br />
display: block;<br />
}<br />
body {<br />
line-height: 1;<br />
}<br />
ol, ul {<br />
list-style: none;<br />
}<br />
<br />
p, ul, ol {<br />
margin: 0 0 0px; <br />
<br />
}<br />
ul, ol {<br />
padding: 1.5em 0 0 2.5em;<br />
}<br />
<br />
<br />
body {<br />
/* background: #f2f2f2;*/<br />
background: #262626;<br />
font-family: "proxima-nova", "HelveticaNeue", "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
font-size: 14px;<br />
line-height: 21px;<br />
color: #262626;<br />
-webkit-font-smoothing: antialiased;<br />
-webkit-text-size-adjust: 100%}<br />
html, body {<br />
height: 100%}<br />
#wrap {<br />
//background: url(https://static.igem.org/mediawiki/2013/f/f4/Gene.jpg) no-repeat fixed;<br />
background-size:cover;<br />
margin-bottom: 0px;<br />
min-height: 100%;<br />
height: auto!important;<br />
height: 100%}<br />
.push {<br />
height: 45px;<br />
}<br />
p img {<br />
margin: 0;<br />
}<br />
em {<br />
font-style: italic;<br />
}<br />
strong {<br />
font-weight: bold;<br />
}<br />
hr {<br />
border: solid #ddd;<br />
border-width: 1px 0 0;<br />
clear: both;<br />
margin: 10px 0 30px;<br />
height: 0;<br />
}<br />
a, a:visited {<br />
color: #666;<br />
text-decoration: none;<br />
outline: 0;<br />
}<br />
a:hover, a:focus {<br />
color: #333;<br />
}<br />
p a, p a:visited {<br />
line-height: inherit;<br />
}<br />
img.scale-with-grid {<br />
max-width: 100%;<br />
height: auto;<br />
}<br />
<br />
header {<br />
width: 100%;<br />
height: 90px;<br />
background: #222;<br />
background: rgba(0, 0, 0, .2);<br />
border-color: #fff;<br />
border-bottom: 1px solid rgba(255, 255, 255, .25);<br />
position: fixed;<br />
top: 0;<br />
z-index: 10;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
-ms-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
}<br />
header.sticky {<br />
height: 60px;<br />
background: #993399;<br />
border: 0;<br />
box-shadow: 0 1px 6px rgba(0, 0, 0, .2);<br />
}<br />
header h1 {<br />
margin: 0;<br />
}<br />
#logo {<br />
width: 84px;<br />
height: 59px;<br />
display: block;<br />
background: url(https://static.igem.org/mediawiki/igem.org/e/e8/Genovo-logo.png) no-repeat;<br />
text-indent: -99999em;<br />
position: absolute;<br />
top: 15px;<br />
left: 15px;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
}<br />
#logo1{<br />
width: 80px;<br />
height: 60px;<br />
display: block;<br />
background: url(https://static.igem.org/mediawiki/2013/d/dd/Igem_logo12.png) no-repeat;<br />
text-indent: -99999em;<br />
position: absolute;<br />
top: 15px;<br />
right: 10px;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
z-index:9999;<br />
}<br />
nav {<br />
text-align: center;<br />
margin-top: 35px;<br />
-webkit-transition: margin .2s ease-in-out;<br />
-moz-transition: margin .2s ease-in-out;<br />
transition: margin .2s ease-in-out;<br />
}<br />
.sticky nav {<br />
margin-top: 20px;<br />
}<br />
nav a, #start-project {<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
color: #555;<br />
text-shadow: 0 1px 0 #fff;<br />
padding: 16px;<br />
font-size: 14px;<br />
}<br />
.light nav a {<br />
color: #ddd;/* top-nav color */<br />
text-shadow: 0 1px 0 rgba(0, 0, 0, .5);<br />
opacity: .5;<br />
-webkit-transition: opacity .1s linear;<br />
-moz-transition: opacity .1s linear;<br />
transition: opacity .1s linear;<br />
}<br />
nav a.current-menu-item, nav a.current_page_parent, nav a:hover, .single-work .light nav a.menu-item-18, .single-lab .light nav a.menu-item-17, .single-post .light nav a.menu-item-16 {<br />
opacity: 1;<br />
}<br />
.single-work nav a.current_page_parent, .single-lab nav a.current_page_parent {<br />
opacity: .5;<br />
}<br />
#blog {<br />
z-index: 6;<br />
}<br />
#blog article {<br />
margin: 10px auto 60px;<br />
max-width: 700px;<br />
position: relative;<br />
}<br />
<br />
<br />
#home-content h2, #fresh h2, h2.section-title {<br />
color: #358;<br />
font-size: 12px;<br />
text-shadow: 0 1px 0 #fff;<br />
font-weight: 600;<br />
width: 150px;<br />
background: #aaa;<br />
margin: -20px auto 20px;<br />
text-align: center;<br />
}<br />
#home-content .column, #fresh {<br />
border-top: 1px solid #d0d0d0;<br />
}<br />
#home-content .one-third {<br />
float: right!important;<br />
}<br />
.mini-post {<br />
float: left;<br />
background: #fff;<br />
box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
border-radius: 2px;<br />
overflow: hidden;<br />
width: 290px;<br />
-webkit-transition: all .2s ease-out;<br />
-moz-transition: all .2s ease-out;<br />
transition: all .2s ease-out;<br />
color: #333;<br />
min-height: 320px;<br />
cursor: pointer;<br />
}<br />
.mini-post:hover {<br />
margin-top: -5px;<br />
box-shadow: 0 3px 3px 0 rgba(0, 0, 0, .4);<br />
}<br />
.mini-post .text {<br />
padding: 20px 20px 10px;<br />
}<br />
.mini-post h3 {<br />
font-size: 16px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
margin: 0;<br />
}<br />
.mini-post .meta {<br />
font-size: 11px;<br />
}<br />
.mini-post p {<br />
font-size: 13px;<br />
}<br />
.mini-post .more {<br />
font-weight: 600;<br />
}<br />
#tweet {<br />
margin: 40px auto;<br />
padding-top: 40px;<br />
border-top: 1px solid #d0d0d0;<br />
}<br />
#tweet .text {<br />
padding: 0 90px;<br />
background: url(art/bird.svg) no-repeat 35px 0;<br />
font-size: 26px;<br />
font-weight: 300;<br />
}<br />
#tweet .text p {<br />
margin: 0 0 10px;<br />
text-align: center;<br />
line-height: 36px;<br />
}<br />
#tweet .text p.author {<br />
font-size: 20px;<br />
}<br />
#page-header {<br />
width: auto;<br />
// height: 220px;<br />
//background: url(https://static.igem.org/mediawiki/2013/3/34/Test-head.jpg) top center;<br />
margin: 0 0 35px;<br />
box-shadow: 2px 1px 12px #272727;<br />
<br />
}<br />
.wf-loading #page-header h1 {<br />
visibility: hidden;<br />
}<br />
<br />
.blog #page-header {<br />
// background: url(https://static.igem.org/mediawiki/2013/3/34/Test-head.jpg) top center;<br />
}<br />
#page-header h1 {<br />
font-family: "abril-fatface", 'Adobe Garamond', 'Garamond', serif;<br />
color: #fff;<br />
text-align: center;<br />
padding: 130px 0 0 0;<br />
text-shadow: 0 2px 0 #000;<br />
font-size: 60px;<br />
}<br />
#blog {<br />
z-index: 6;<br />
}<br />
#blog article {<br />
margin: 10px auto 60px;<br />
max-width: 1200px;<br />
position: relative;<br />
}<br />
#blog article .post {<br />
background: #fff;<br />
// box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
box-shadow: 2px 1px 6px #272727;<br />
border-radius: 2px;<br />
overflow: hidden;<br />
color: #333;<br />
margin: 0 0 15px;<br />
}<br />
#blog article .post .text {<br />
padding: 20px 20px 10px;<br />
}<br />
.post-content a {<br />
color: #2683a5;<br />
}<br />
.post-content a:hover {<br />
color: #4ea9a2; <br />
}<br />
#blog article .post h2 {<br />
font-family: 'Tangerine', serif;<br />
font-size: 48px;<br />
text-shadow: 4px 4px 4px #aaa;<br />
color: #38f;<br />
letter-spacing: 0.1em;<br />
word-spacing: 0.3em;<br />
font-weight: 700;<br />
line-height: 36px;<br />
margin: 0;<br />
}<br />
#blog article .post h3 {<br />
font-size: 14px;<br />
line-height: 18px;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
}<br />
#blog article .post .meta {<br />
font-size: 11px;<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
}<br />
#blog article .post p {<br />
font-size: 16px;<br />
line-height: 19px;<br />
font-family: Trebuchet MS;<br />
font-weight: 600;<br />
}<br />
.short-url, .share, .categories {<br />
background: #eaeaea left center no-repeat;<br />
border-radius: 2px;<br />
border-bottom: 1px solid #fff;<br />
border-top: 1px solid #d0d0d0;<br />
float: left;<br />
margin: 0 20px 0 0;<br />
padding: 4px 15px 4px 35px;<br />
font-size: 11px;<br />
color: #666;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
text-shadow: 0 1px 0 #fff;<br />
-webkit-transition: all .2s ease-out;<br />
-moz-transition: all .2s ease-out;<br />
transition: all .2s ease-out;<br />
}<br />
.addthis_toolbox {<br />
display: none;<br />
padding: 0 20px 20px;<br />
}<br />
.short-url:hover, .share:hover {<br />
background-color: #ddd;<br />
border-top: 1px solid #aaa;<br />
}<br />
<br />
#blog article.quote {<br />
max-width: 940px;<br />
}<br />
#blog article.quote .quote-content {<br />
background: #676767;<br />
padding: 30px;<br />
border-radius: 3px;<br />
border-top: #111 1px solid;<br />
border-bottom: #fff 1px solid;<br />
margin: 0 0 15px;<br />
}<br />
#blog article.quote .quote-content p {<br />
font-size: 26px;<br />
line-height: 32px;<br />
color: #eee;<br />
font-weight: 300;<br />
}<br />
#blog article.quote p.ref {<br />
color: #fff;<br />
padding: 0;<br />
margin: 0;<br />
}<br />
#blog article.quote .quote-content a {<br />
color: #fff;<br />
text-decoration: underline;<br />
}<br />
#blog-pagination {<br />
display: block;<br />
text-align: center;<br />
margin: 35px 0;<br />
}<br />
.wp-paginate {<br />
display: inline-block;<br />
padding: 0;<br />
box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
border-radius: 3px;<br />
}<br />
.wp-paginate li {<br />
padding: 0!important;<br />
display: inline-block;<br />
background-image: none!important;<br />
background-color: #fff;<br />
margin: 0;<br />
float: left;<br />
}<br />
.wp-paginate a, .wp-paginate .page.current {<br />
color: #333;<br />
padding: 10px 13px;<br />
display: inline-block;<br />
margin-bottom: 0!important;<br />
min-width: 10px;<br />
border-right: 1px solid #eee;<br />
font-size: 12px;<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
-webkit-transition: all .1s ease-in-out;<br />
-moz-transition: all .1s ease-in-out;<br />
transition: all .1s ease-in-out;<br />
}<br />
.wp-paginate span {<br />
margin-bottom: 0!important;<br />
}<br />
.wp-paginate a.next {<br />
border-left: 0;<br />
}<br />
.wp-paginate .page {<br />
margin: 0;<br />
}<br />
.wp-paginate .page.current {<br />
background-color: #fafafa;<br />
color: #888;<br />
}<br />
.wp-paginate a:hover {<br />
background: #555;<br />
color: #fff;<br />
border-right: 1px solid #555;<br />
}<br />
#disqus_thread {<br />
margin: 10px auto 35px!important;<br />
max-width: 660px;<br />
position: relative;<br />
background: #eaeaea;<br />
border-radius: 2px;<br />
border-bottom: 1px solid #fff;<br />
border-top: 1px solid #d0d0d0;<br />
color: #1a1a1a;<br />
padding: 20px;<br />
font-size: 12px;<br />
}<br />
#disqus_thread h3 {<br />
font-size: 14px;<br />
text-transform: uppercase;<br />
text-shadow: 0 1px 0 #fff;<br />
font-weight: 600;<br />
}<br />
#contact {<br />
position: relative;<br />
height: 940px;<br />
}<br />
#location-map {<br />
width: 100%;<br />
height: 940px;<br />
display: block;<br />
position: absolute;<br />
top: 0;<br />
}<br />
#contact .container {<br />
padding-top: 60px;<br />
}<br />
#contact #contact-details, #contact #message {<br />
background: #262626;<br />
float: none;<br />
display: block;<br />
margin: 0 0 35px;<br />
box-shadow: 0 0 25px 0 rgba(0, 0, 0, .25);<br />
}<br />
#phone-address, #work-planner {<br />
padding: 30px 40px;<br />
}<br />
#phone-address {<br />
border-bottom: 1px solid #565656;<br />
}<br />
#phone-address p, #work-planner h2, #message h2 {<br />
text-transform: uppercase;<br />
color: #fff;<br />
font-weight: 600;<br />
font-size: 14px;<br />
}<br />
#phone-address p {<br />
padding-left: 35px;<br />
}<br />
#phone-address p#phone {<br />
background: url(art/phone.png) no-repeat 2px 2px;<br />
}<br />
#phone-address p#address {<br />
background: url(art/map.png) no-repeat 2px 2px;<br />
margin: 0;<br />
}<br />
#work-planner h2, #message h2 {<br />
margin: 0 0 10px;<br />
line-height: normal;<br />
}<br />
#work-planner p {<br />
color: #9c9c9c;<br />
font-size: 13px;<br />
font-weight: 600;<br />
}<br />
#work-planner a {<br />
padding: 12px 40px 12px 12px;<br />
color: #fff;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
font-size: 12px;<br />
background: #ce462b url(art/get-started-arrow.png) no-repeat right center;<br />
margin: 0 0 10px;<br />
display: block;<br />
width: 128px;<br />
-webkit-transition: background-color .2s ease-in-out;<br />
-moz-transition: background-color .2s ease-in-out;<br />
transition: background-color .2s ease-in-out;<br />
}<br />
#work-planner a:hover {<br />
background-color: #4ea9a2;<br />
}<br />
#contact #message .wrapper {<br />
padding: 30px 40px;<br />
}<br />
#contact #message .field {<br />
display: block;<br />
position: relative;<br />
margin: 0 0 15px;<br />
}<br />
#contact #message label {<br />
position: absolute;<br />
top: 9px;<br />
left: 11px;<br />
color: #aaa;<br />
font-size: 13px;<br />
font-weight: 500;<br />
}<br />
#contact #message input, #contact #message textarea {<br />
width: 300px;<br />
max-width: 300px;<br />
background: #000;<br />
border: 0;<br />
border-bottom: 1px solid #373737;<br />
width: 100%;<br />
color: #ddd;<br />
font-size: 13px;<br />
font-weight: 500;<br />
padding: 8px 10px;<br />
}<br />
#contact #message textarea {<br />
height: 80px;<br />
}<br />
#contact #message input:focus, #contact #message textarea:focus {<br />
background: #111;<br />
outline: 0;<br />
}<br />
#contact #message button {<br />
padding: 14px 40px 14px 12px;<br />
color: #fff;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
text-align: left;<br />
font-size: 12px;<br />
background: #343434 url(art/message-arrow.png) no-repeat right center;<br />
display: block;<br />
margin: 0;<br />
width: 180px;<br />
-webkit-transition: background-color .2s ease-in-out;<br />
-moz-transition: background-color .2s ease-in-out;<br />
transition: background-color .2s ease-in-out;<br />
font-family: "proxima-nova", "HelveticaNeue", "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
}<br />
#contact #message button:hover {<br />
background-color: #666;<br />
}<br />
.contact footer {<br />
margin: 0;<br />
}<br />
footer {<br />
padding: 35px 0 20px;<br />
background: #003399;<br />
height: 130px;<br />
box-shadow: 4px 3px 25px #000;<br />
}<br />
footer h3 {<br />
font-size: 13px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
color: #fff;<br />
text-transform: uppercase;<br />
margin: 0 0 20px;<br />
}<br />
footer p {<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
}<br />
footer p a, footer p a:visited, footer p span {<br />
color: #dedede;<br />
}<br />
footer p a:hover {<br />
color: #fff;<br />
}<br />
#footer-contact p {<br />
margin-right: 40px;<br />
float: left;<br />
}<br />
#footer-project p {<br />
max-width: 180px;<br />
}<br />
#footer-newsletter {<br />
position: relative;<br />
}<br />
#footer-newsletter p {<br />
position: absolute;<br />
font-size: 11px;<br />
top: 0;<br />
right: 0;<br />
color: #7c7c7c;<br />
}<br />
#footer-newsletter input {<br />
width: 220px;<br />
height: 19px;<br />
background: #202020;<br />
border: 0;<br />
margin: 0;<br />
padding: 10px;<br />
color: #fff;<br />
font-size: 12px;<br />
-webkit-transition: background .3s ease-in-out;<br />
-moz-transition: background .3s ease-in-out;<br />
transition: background .3s ease-in-out;<br />
float: left;<br />
border-radius: 0;<br />
}<br />
#footer-newsletter input:focus {<br />
outline: 0;<br />
background: #333;<br />
}<br />
#footer-newsletter label {<br />
position: absolute;<br />
top: 49px;<br />
left: 10px;<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
}<br />
#footer-newsletter button {<br />
width: 39px;<br />
height: 39px;<br />
text-indent: -99999em;<br />
background: #202020 url(art/btn-arrow.svg) no-repeat center center;<br />
float: right;<br />
-webkit-transition: background .3s ease-in-out;<br />
-moz-transition: background .3s ease-in-out;<br />
transition: background .3s ease-in-out;<br />
}<br />
#footer-newsletter button:hover {<br />
background-color: #333;<br />
}<br />
#footer-final {<br />
margin: 15px auto;<br />
padding-top: 35px;<br />
border-top: 1px solid #313131;<br />
position: relative;<br />
}<br />
#footer-final a, #footer-final a:visited {<br />
color: #aaa;<br />
}<br />
#footer-final a:hover {<br />
color: #fff;<br />
}<br />
#footer-final p {<br />
font-weight: 600;<br />
font-size: 12px;<br />
display: block;<br />
margin: 0;<br />
}<br />
#footer-nav {<br />
text-align: center;<br />
}<br />
#footer-nav a {<br />
margin: 0 8px;<br />
}<br />
#footer-final p#footer-social {<br />
text-align: right;<br />
margin-left: 40px;<br />
}<br />
#footer-social a, #footer-social a:visited {<br />
margin: 0 0 0 16px;<br />
}<br />
.left {<br />
float: left;<br />
}<br />
.right {<br />
float: right;<br />
}<br />
span.error {<br />
color: red;<br />
font-size: 12px;<br />
}<br />
p.success {<br />
background: #009b00;<br />
padding: 5px;<br />
color: #fff;<br />
text-align: center;<br />
font-weight: 600;<br />
border-radius: 3px;<br />
}<br />
p.fail {<br />
background: red;<br />
padding: 5px;<br />
color: #fff;<br />
text-align: center;<br />
font-weight: 600;<br />
border-radius: 3px;<br />
}<br />
.success {<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
}<br />
.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.aligncenter, div.aligncenter {<br />
display: block;<br />
margin: 5px auto 5px auto;<br />
}<br />
.alignright {<br />
float: right;<br />
margin: 5px 0 20px 20px;<br />
}<br />
.alignleft {<br />
float: left;<br />
margin: 5px 20px 20px 0;<br />
}<br />
.aligncenter {<br />
display: block;<br />
margin: 5px auto 5px auto;<br />
}<br />
a img.alignright {<br />
float: right;<br />
margin: 5px 0 20px 20px;<br />
}<br />
a img.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
a img.alignleft {<br />
float: left;<br />
margin: 5px 20px 20px 0;<br />
}<br />
a img.aligncenter {<br />
display: block;<br />
margin-left: auto;<br />
margin-right: auto;<br />
}<br />
.wp-caption {<br />
background: #fff;<br />
border: 1px solid #f0f0f0;<br />
max-width: 96%;<br />
padding: 5px 3px 10px;<br />
text-align: center;<br />
}<br />
.wp-caption.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.wp-caption.alignleft {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.wp-caption.alignright {<br />
margin: 5px 0 20px 20px;<br />
}<br />
.wp-caption img {<br />
border: 0 none;<br />
height: auto;<br />
margin: 0;<br />
max-width: 98.5%;<br />
padding: 0;<br />
width: auto;<br />
}<br />
.wp-caption p.wp-caption-text {<br />
font-size: 11px;<br />
line-height: 17px;<br />
margin: 0;<br />
padding: 0 4px 5px;<br />
}<br />
.cols_2_left, .cols_2_right, .cols_3_left, .cols_3_middle, .cols_3_right {<br />
margin: 0 0 1.5em;<br />
}<br />
.cols_2_left {<br />
float: left;<br />
width: 47%}<br />
.cols_2_right {<br />
float: right;<br />
width: 47%}<br />
.cols_3_left {<br />
float: left;<br />
width: 30%}<br />
.cols_3_middle {<br />
float: left;<br />
width: 30%;<br />
margin-left: 5%}<br />
.cols_3_right {<br />
float: right;<br />
width: 30%}<br />
.container {<br />
position: relative;<br />
width: 1000px;<br />
margin: 0 auto;<br />
padding: 0;<br />
}<br />
.container.short {<br />
width: 940px;<br />
}<br />
.container .column, .container .columns {<br />
float: left;<br />
display: inline;<br />
margin-left: 10px;<br />
margin-right: 10px;<br />
}<br />
.row {<br />
margin-bottom: 20px;<br />
}<br />
.column.alpha, .columns.alpha {<br />
margin-left: 0;<br />
}<br />
.column.omega, .columns.omega {<br />
margin-right: 0;<br />
}<br />
.container .one.column, .container .one.columns {<br />
width: 40px;<br />
}<br />
.container .two.columns {<br />
width: 100px;<br />
}<br />
.container .three.columns {<br />
width: 160px;<br />
}<br />
.container .four.columns {<br />
width: 220px;<br />
}<br />
.container .five.columns {<br />
width: 180px;<br />
}<br />
.container .six.columns {<br />
width: 340px;<br />
}<br />
.container .seven.columns {<br />
width: 400px;<br />
}<br />
.container .eight.columns {<br />
width: 460px;<br />
}<br />
.container .nine.columns {<br />
width: 520px;<br />
}<br />
.container .ten.columns {<br />
width: 580px;<br />
}<br />
.container .eleven.columns {<br />
width: 640px;<br />
}<br />
.container .twelve.columns {<br />
width: 700px;<br />
}<br />
.container .thirteen.columns {<br />
width: 760px;<br />
}<br />
.container .fourteen.columns {<br />
width: 820px;<br />
}<br />
.container .fifteen.columns {<br />
width: 880px;<br />
}<br />
.container .sixteen.columns {<br />
width: 940px;<br />
}<br />
.container .one-third.column {<br />
width: 290px;<br />
}<br />
.container .two-thirds.column {<br />
width: 615px;<br />
}<br />
.container .offset-by-one {<br />
padding-left: 60px;<br />
}<br />
.container .offset-by-two {<br />
padding-left: 120px;<br />
}<br />
.container .offset-by-three {<br />
padding-left: 180px;<br />
}<br />
.container .offset-by-four {<br />
padding-left: 240px;<br />
}<br />
.container .offset-by-five {<br />
padding-left: 300px;<br />
}<br />
.container .offset-by-six {<br />
padding-left: 360px;<br />
}<br />
.container .offset-by-seven {<br />
padding-left: 420px;<br />
}<br />
.container .offset-by-eight {<br />
padding-left: 480px;<br />
}<br />
.container .offset-by-nine {<br />
padding-left: 540px;<br />
}<br />
.container .offset-by-ten {<br />
padding-left: 600px;<br />
}<br />
.container .offset-by-eleven {<br />
padding-left: 660px;<br />
}<br />
.container .offset-by-twelve {<br />
padding-left: 720px;<br />
}<br />
.container .offset-by-thirteen {<br />
padding-left: 780px;<br />
}<br />
.container .offset-by-fourteen {<br />
padding-left: 840px;<br />
}<br />
.container .offset-by-fifteen {<br />
padding-left: 900px;<br />
}<br />
@media only screen and (max-width:1049px) {<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images.two img {<br />
width: 450px;<br />
}<br />
}@media only screen and (min-width:960px) {<br />
#logo {<br />
-webkit-transform-style: preserve-3d;<br />
}<br />
#logo1 {<br />
-webkit-transform-style: preserve-3d;<br />
}<br />
.sticky #logo {<br />
-webkit-transform: scale(.75);<br />
-moz-transform: scale(.75);<br />
-ms-transform: scale(.75);<br />
-o-transform: scale(.75);<br />
transform: scale(.75);<br />
top: 0;<br />
left: -10px;<br />
}<br />
.sticky #logo1 {<br />
-webkit-transform: scale(.75);<br />
-moz-transform: scale(.75);<br />
-ms-transform: scale(.75);<br />
-o-transform: scale(.75);<br />
transform: scale(.75);<br />
top: 0;<br />
right: -1px;<br />
}<br />
<br />
}@media only screen and (min-device-width :768px) and (max-device-width:1024px) and (orientation:landscape) {<br />
#logo {<br />
-webkit-transform-style: flat;<br />
}<br />
#logo1 {<br />
-webkit-transform-style: flat;<br />
}<br />
.sticky #logo {<br />
-webkit-transform: none;<br />
-moz-transform: none;<br />
-ms-transform: none;<br />
-o-transform: none;<br />
transform: none;<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
-webkit-transform: none;<br />
-moz-transform: none;<br />
-ms-transform: none;<br />
-o-transform: none;<br />
transform: none;<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
}@media only screen and (min-width:768px) and (max-width:959px) {<br />
.container {<br />
width: 768px;<br />
}<br />
.container.short {<br />
width: 748px;<br />
}<br />
.container .column, .container .columns {<br />
margin-left: 10px;<br />
margin-right: 10px;<br />
}<br />
.column.alpha, .columns.alpha {<br />
margin-left: 0;<br />
margin-right: 10px;<br />
}<br />
.column.omega, .columns.omega {<br />
margin-right: 0;<br />
margin-left: 10px;<br />
}<br />
.alpha.omega {<br />
margin-left: 0;<br />
margin-right: 0;<br />
}<br />
.container .one.column, .container .one.columns {<br />
width: 28px;<br />
}<br />
.container .two.columns {<br />
width: 76px;<br />
}<br />
.container .three.columns {<br />
width: 124px;<br />
}<br />
.container .four.columns {<br />
width: 172px;<br />
}<br />
.container .five.columns {<br />
width: 220px;<br />
}<br />
.container .six.columns {<br />
width: 268px;<br />
}<br />
.container .seven.columns {<br />
width: 316px;<br />
}<br />
.container .eight.columns {<br />
width: 364px;<br />
}<br />
.container .nine.columns {<br />
width: 412px;<br />
}<br />
.container .ten.columns {<br />
width: 460px;<br />
}<br />
.container .eleven.columns {<br />
width: 508px;<br />
}<br />
.container .twelve.columns {<br />
width: 556px;<br />
}<br />
.container .thirteen.columns {<br />
width: 604px;<br />
}<br />
.container .fourteen.columns {<br />
width: 652px;<br />
}<br />
.container .fifteen.columns {<br />
width: 700px;<br />
}<br />
.container .sixteen.columns {<br />
width: 748px;<br />
}<br />
.container .one-third.column {<br />
width: 236px;<br />
}<br />
.container .two-thirds.column {<br />
width: 492px;<br />
}<br />
.container .offset-by-one {<br />
padding-left: 48px;<br />
}<br />
.container .offset-by-two {<br />
padding-left: 96px;<br />
}<br />
.container .offset-by-three {<br />
padding-left: 144px;<br />
}<br />
.container .offset-by-four {<br />
padding-left: 192px;<br />
}<br />
.container .offset-by-five {<br />
padding-left: 240px;<br />
}<br />
.container .offset-by-six {<br />
padding-left: 288px;<br />
}<br />
.container .offset-by-seven {<br />
padding-left: 336px;<br />
}<br />
.container .offset-by-eight {<br />
padding-left: 384px;<br />
}<br />
.container .offset-by-nine {<br />
padding-left: 432px;<br />
}<br />
.container .offset-by-ten {<br />
padding-left: 480px;<br />
}<br />
.container .offset-by-eleven {<br />
padding-left: 528px;<br />
}<br />
.container .offset-by-twelve {<br />
padding-left: 576px;<br />
}<br />
.container .offset-by-thirteen {<br />
padding-left: 624px;<br />
}<br />
.container .offset-by-fourteen {<br />
padding-left: 672px;<br />
}<br />
.container .offset-by-fifteen {<br />
padding-left: 720px;<br />
}<br />
.sticky #logo {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
nav a {<br />
padding-left: 10px;<br />
padding-right: 10px;<br />
}<br />
#footer-contact {<br />
width: 220px;<br />
}<br />
#footer-newsletter {<br />
float: right;<br />
width: 280px;<br />
}<br />
.mini-post {<br />
width: 236px;<br />
}<br />
.mini-post img {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images img {<br />
width: 100%}<br />
#case-details .images.two img {<br />
width: 350px;<br />
}<br />
#case-details, #meta .container, .single #page-header .container {<br />
padding: 0 10px;<br />
width: 748px;<br />
}<br />
.about .column-text {<br />
padding: 0 15px;<br />
}<br />
#feature h1 {<br />
font-size: 55px;<br />
}<br />
#page-header.case h1 {<br />
font-size: 40px;<br />
line-height: 34px;<br />
}<br />
#page-header.case h2 {<br />
max-width: 40%;<br />
line-height: 24px;<br />
}<br />
#blog-top #categories {<br />
width: 220px;<br />
}<br />
#blog-top form {<br />
width: 340px;<br />
}<br />
#blog-top #rss {<br />
width: 100px;<br />
}<br />
.container .seven.columns {<br />
width: 400px;<br />
}<br />
.single-work #page-header h2, .single-lab #page-header h2 {<br />
font-weight: 500;<br />
font-size: 16px;<br />
line-height: 22px;<br />
}<br />
<br />
footer {<br />
height: auto;<br />
}<br />
#wrap {<br />
margin-bottom: 0;<br />
min-height: 0;<br />
}<br />
.push {<br />
display: none;<br />
}<br />
#copyright, #footer-social {<br />
width: 150px;<br />
margin: 0!important;<br />
}<br />
#location-map {<br />
display: none;<br />
}<br />
#contact {<br />
height: auto;<br />
}<br />
#contact .container {<br />
padding-top: 10px;<br />
}<br />
#contact #contact-details {<br />
float: left;<br />
width: 340px;<br />
}<br />
#contact #message {<br />
float: right;<br />
width: 400px;<br />
}<br />
#footer-nav {<br />
width: 448px;<br />
}<br />
#processes {<br />
margin: 0 30px;<br />
}<br />
.process .text {<br />
padding: 0 15px;<br />
}<br />
.process p {<br />
font-size: 13px;<br />
line-height: 18px;<br />
}<br />
}@media only screen and (max-width:767px) {<br />
.container, .container.short {<br />
width: 300px;<br />
}<br />
.container .columns, .container .column {<br />
margin: 0;<br />
}<br />
.container .one.column, .container .one.columns, .container .two.columns, .container .three.columns, .container .four.columns, .container .five.columns, .container .six.columns, .container .seven.columns, .container .eight.columns, .container .nine.columns, .container .ten.columns, .container .eleven.columns, .container .twelve.columns, .container .thirteen.columns, .container .fourteen.columns, .container .fifteen.columns, .container .sixteen.columns, .container .one-third.column, .container .two-thirds.column {<br />
width: 300px;<br />
}<br />
.container .offset-by-one, .container .offset-by-two, .container .offset-by-three, .container .offset-by-four, .container .offset-by-five, .container .offset-by-six, .container .offset-by-seven, .container .offset-by-eight, .container .offset-by-nine, .container .offset-by-ten, .container .offset-by-eleven, .container .offset-by-twelve, .container .offset-by-thirteen, .container .offset-by-fourteen, .container .offset-by-fifteen {<br />
padding-left: 0;<br />
}<br />
.sticky #logo {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
#feature {<br />
height: 250px;<br />
}<br />
#feature article, #feature ul {<br />
display: none!important;<br />
}<br />
#feature h1 {<br />
top: 100px;<br />
font-size: 36px;<br />
line-height: 42px;<br />
}<br />
#home-content, #home-content .column, .mini-post {<br />
width: auto;<br />
float: none!important;<br />
display: block;<br />
}<br />
#home-content .column {<br />
margin: 0 0 40px;<br />
}<br />
.mini-post {<br />
margin: 0 auto 20px;<br />
width: 290px;<br />
}<br />
#tweet {<br />
padding: 40px 0 0 0;<br />
margin: 40px 0;<br />
width: auto;<br />
}<br />
#tweet .text {<br />
padding: 40px 20px 0;<br />
background-position: center top;<br />
}<br />
nav a {<br />
padding-left: 6px;<br />
padding-right: 6px;<br />
font-size: 12px;<br />
}<br />
<br />
#work article {<br />
width: 30%;<br />
margin: 10px;<br />
}<br />
#work article .image, #work article a img, .labs#work article .image {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images img, #case-details .images.two img {<br />
width: 100%;<br />
margin: 0 0 20px!important;<br />
}<br />
#page-header.case h1 {<br />
font-size: 30px;<br />
line-height: 28px;<br />
max-width: 55%}<br />
#page-header.case h2 {<br />
max-width: 50%;<br />
line-height: 24px;<br />
}<br />
.labs #page-header h1 {<br />
font-size: 46px;<br />
}<br />
#meta p {<br />
float: right;<br />
margin: 0;<br />
}<br />
#meta p:first-child {<br />
width: 50%;<br />
float: left;<br />
}<br />
#work-with-us {<br />
font-size: 18px;<br />
}<br />
#blog-top #categories {<br />
margin-bottom: 15px;<br />
}<br />
#blog-top form {<br />
width: 200px;<br />
}<br />
#blog-top input {<br />
width: 170px;<br />
}<br />
#blog-top #rss {<br />
width: 80px;<br />
float: right;<br />
}<br />
#blog article img {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#blog article {<br />
margin-bottom: 30px;<br />
}<br />
#blog article iframe {<br />
height: 270px;<br />
}<br />
#blog article .post h2 {<br />
font-size: 20px;<br />
line-height: 22px;<br />
}<br />
#blog .share {<br />
display: none;<br />
}<br />
.short-url {<br />
margin-bottom: 5px;<br />
}<br />
.categories {<br />
float: left;<br />
}<br />
.content h2 {<br />
font-size: 30px;<br />
line-height: 38px;<br />
}<br />
.content p {<br />
font-size: 14px;<br />
line-height: 22px;<br />
font-weight: 500;<br />
}<br />
<br />
footer {<br />
height: auto;<br />
}<br />
#wrap {<br />
margin-bottom: 0;<br />
min-height: 0;<br />
}<br />
.push {<br />
display: none;<br />
}<br />
#processes {<br />
margin: 0 20px;<br />
}<br />
.process .text {<br />
padding: 0 10px;<br />
}<br />
.process p {<br />
font-size: 12px;<br />
line-height: 16px;<br />
}<br />
}@media only screen and (min-width:480px) and (max-width:767px) {<br />
.container, .container.short {<br />
width: 420px;<br />
}<br />
.container .columns, .container .column {<br />
margin: 0;<br />
}<br />
.container .one.column, .container .one.columns, .container .two.columns, .container .three.columns, .container .four.columns, .container .five.columns, .container .six.columns, .container .seven.columns, .container .eight.columns, .container .nine.columns, .container .ten.columns, .container .eleven.columns, .container .twelve.columns, .container .thirteen.columns, .container .fourteen.columns, .container .fifteen.columns, .container .sixteen.columns, .container .one-third.column, .container .two-thirds.column {<br />
width: 420px;<br />
}<br />
#footer-newsletter input {<br />
width: 360px;<br />
}<br />
#blog-top form {<br />
width: 300px;<br />
}<br />
#blog-top input {<br />
width: 270px;<br />
}<br />
#blog-top #rss {<br />
width: 100px;<br />
float: right;<br />
}<br />
.categories {<br />
float: right;<br />
}<br />
.column-text {<br />
-moz-column-count: 1;<br />
-webkit-column-count: 1;<br />
column-count: 1;<br />
}<br />
}@media only screen and (min-width:320px) and (max-width:580px) {<br />
#logo, .sticky #logo {<br />
background-position: 0 -80px;<br />
top: 10px;<br />
left: 10px;<br />
}<br />
#logo1, .sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 10px;<br />
right: 1px;<br />
}<br />
header, header.sticky {<br />
height: 100px;<br />
}<br />
.sticky nav, nav {<br />
margin-top: 64px;<br />
}<br />
nav a {<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
}<br />
#feature h1 {<br />
top: 120px;<br />
font-size: 22px;<br />
line-height: 30px;<br />
}<br />
#tweet .text p {<br />
font-size: 20px;<br />
line-height: 24px;<br />
}<br />
#work article {<br />
width: 45%;<br />
margin: 6px;<br />
}<br />
#page-header {<br />
height: 200px;<br />
}<br />
#page-header h1 {<br />
font-size: 34px;<br />
}<br />
.labs #page-header h1 {<br />
font-size: 25px;<br />
}<br />
#page-header.case h2 {<br />
font-size: 16px;<br />
font-weight: 500;<br />
line-height: 20px;<br />
}<br />
#work-with-us {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#work-with-us span {<br />
background-image: none;<br />
}<br />
#contact #message input, #contact #message textarea {<br />
width: 200px;<br />
max-width: 200px;<br />
}<br />
#fresh ul {<br />
display: none;<br />
}<br />
#blog article iframe {<br />
height: 200px;<br />
}<br />
#process {<br />
display: none;<br />
}<br />
}.container:after {<br />
content: "\0020";<br />
display: block;<br />
height: 0;<br />
clear: both;<br />
visibility: hidden;<br />
}</div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/style
Team:Shenzhen BGIC 0101/style
2013-10-20T08:13:08Z
<p>Czh: </p>
<hr />
<div>@font-face {<br />
font-family: 'Tangerine';<br />
font-style: normal;<br />
font-weight: 400;<br />
src: local('Tangerine'), url(http://themes.googleusercontent.com/static/fonts/tangerine/v3/HGfsyCL5WASpHOFnouG-RD8E0i7KZn-EPnyo3HZu7kw.woff) format('woff');<br />
}<br />
<br />
html, body, div, span, applet, object, iframe, h1, h2, h3, h4, h5, h6, p, blockquote, pre, a, abbr, acronym, address, big, cite, code, del, dfn, em, img, ins, kbd, q, s, samp, small, strike, strong, sub, sup, tt, var, b, u, i, center, dl, dt, dd, ol, ul, li, fieldset, form, label, legend, table, caption, tbody, tfoot, thead, tr, th, td, article, aside, canvas, details, embed, figure, figcaption, footer, header, hgroup, menu, nav, output, ruby, section, summary, time, mark, audio, video {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-size: 100%;<br />
font: inherit;<br />
vertical-align: baseline;<br />
letter-spacing: 0.05em;<br />
}<br />
article, aside, details, figcaption, figure, footer, header, hgroup, menu, nav, section {<br />
display: block;<br />
}<br />
body {<br />
line-height: 1;<br />
}<br />
ol, ul {<br />
list-style: none;<br />
}<br />
<br />
p, ul, ol {<br />
margin: 0 0 0px; <br />
<br />
}<br />
ul, ol {<br />
padding: 1.5em 0 0 2.5em;<br />
}<br />
<br />
<br />
body {<br />
/* background: #f2f2f2;*/<br />
background: #262626;<br />
font-family: "proxima-nova", "HelveticaNeue", "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
font-size: 14px;<br />
line-height: 21px;<br />
color: #262626;<br />
-webkit-font-smoothing: antialiased;<br />
-webkit-text-size-adjust: 100%}<br />
html, body {<br />
height: 100%}<br />
#wrap {<br />
//background: url(https://static.igem.org/mediawiki/2013/f/f4/Gene.jpg) no-repeat fixed;<br />
background-size:cover;<br />
margin-bottom: 0px;<br />
min-height: 100%;<br />
height: auto!important;<br />
height: 100%}<br />
.push {<br />
height: 245px;<br />
}<br />
p img {<br />
margin: 0;<br />
}<br />
em {<br />
font-style: italic;<br />
}<br />
strong {<br />
font-weight: bold;<br />
}<br />
hr {<br />
border: solid #ddd;<br />
border-width: 1px 0 0;<br />
clear: both;<br />
margin: 10px 0 30px;<br />
height: 0;<br />
}<br />
a, a:visited {<br />
color: #666;<br />
text-decoration: none;<br />
outline: 0;<br />
}<br />
a:hover, a:focus {<br />
color: #333;<br />
}<br />
p a, p a:visited {<br />
line-height: inherit;<br />
}<br />
img.scale-with-grid {<br />
max-width: 100%;<br />
height: auto;<br />
}<br />
<br />
header {<br />
width: 100%;<br />
height: 90px;<br />
background: #222;<br />
background: rgba(0, 0, 0, .2);<br />
border-color: #fff;<br />
border-bottom: 1px solid rgba(255, 255, 255, .25);<br />
position: fixed;<br />
top: 0;<br />
z-index: 10;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
-ms-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
}<br />
header.sticky {<br />
height: 60px;<br />
background: #993399;<br />
border: 0;<br />
box-shadow: 0 1px 6px rgba(0, 0, 0, .2);<br />
}<br />
header h1 {<br />
margin: 0;<br />
}<br />
#logo {<br />
width: 84px;<br />
height: 59px;<br />
display: block;<br />
background: url(https://static.igem.org/mediawiki/igem.org/e/e8/Genovo-logo.png) no-repeat;<br />
text-indent: -99999em;<br />
position: absolute;<br />
top: 15px;<br />
left: 15px;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
}<br />
#logo1{<br />
width: 80px;<br />
height: 60px;<br />
display: block;<br />
background: url(https://static.igem.org/mediawiki/2013/d/dd/Igem_logo12.png) no-repeat;<br />
text-indent: -99999em;<br />
position: absolute;<br />
top: 15px;<br />
right: 10px;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
z-index:9999;<br />
}<br />
nav {<br />
text-align: center;<br />
margin-top: 35px;<br />
-webkit-transition: margin .2s ease-in-out;<br />
-moz-transition: margin .2s ease-in-out;<br />
transition: margin .2s ease-in-out;<br />
}<br />
.sticky nav {<br />
margin-top: 20px;<br />
}<br />
nav a, #start-project {<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
color: #555;<br />
text-shadow: 0 1px 0 #fff;<br />
padding: 16px;<br />
font-size: 14px;<br />
}<br />
.light nav a {<br />
color: #ddd;/* top-nav color */<br />
text-shadow: 0 1px 0 rgba(0, 0, 0, .5);<br />
opacity: .5;<br />
-webkit-transition: opacity .1s linear;<br />
-moz-transition: opacity .1s linear;<br />
transition: opacity .1s linear;<br />
}<br />
nav a.current-menu-item, nav a.current_page_parent, nav a:hover, .single-work .light nav a.menu-item-18, .single-lab .light nav a.menu-item-17, .single-post .light nav a.menu-item-16 {<br />
opacity: 1;<br />
}<br />
.single-work nav a.current_page_parent, .single-lab nav a.current_page_parent {<br />
opacity: .5;<br />
}<br />
#blog {<br />
z-index: 6;<br />
}<br />
#blog article {<br />
margin: 10px auto 60px;<br />
max-width: 700px;<br />
position: relative;<br />
}<br />
<br />
<br />
#home-content h2, #fresh h2, h2.section-title {<br />
color: #358;<br />
font-size: 12px;<br />
text-shadow: 0 1px 0 #fff;<br />
font-weight: 600;<br />
width: 150px;<br />
background: #aaa;<br />
margin: -20px auto 20px;<br />
text-align: center;<br />
}<br />
#home-content .column, #fresh {<br />
border-top: 1px solid #d0d0d0;<br />
}<br />
#home-content .one-third {<br />
float: right!important;<br />
}<br />
.mini-post {<br />
float: left;<br />
background: #fff;<br />
box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
border-radius: 2px;<br />
overflow: hidden;<br />
width: 290px;<br />
-webkit-transition: all .2s ease-out;<br />
-moz-transition: all .2s ease-out;<br />
transition: all .2s ease-out;<br />
color: #333;<br />
min-height: 320px;<br />
cursor: pointer;<br />
}<br />
.mini-post:hover {<br />
margin-top: -5px;<br />
box-shadow: 0 3px 3px 0 rgba(0, 0, 0, .4);<br />
}<br />
.mini-post .text {<br />
padding: 20px 20px 10px;<br />
}<br />
.mini-post h3 {<br />
font-size: 16px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
margin: 0;<br />
}<br />
.mini-post .meta {<br />
font-size: 11px;<br />
}<br />
.mini-post p {<br />
font-size: 13px;<br />
}<br />
.mini-post .more {<br />
font-weight: 600;<br />
}<br />
#tweet {<br />
margin: 40px auto;<br />
padding-top: 40px;<br />
border-top: 1px solid #d0d0d0;<br />
}<br />
#tweet .text {<br />
padding: 0 90px;<br />
background: url(art/bird.svg) no-repeat 35px 0;<br />
font-size: 26px;<br />
font-weight: 300;<br />
}<br />
#tweet .text p {<br />
margin: 0 0 10px;<br />
text-align: center;<br />
line-height: 36px;<br />
}<br />
#tweet .text p.author {<br />
font-size: 20px;<br />
}<br />
#page-header {<br />
width: auto;<br />
// height: 220px;<br />
//background: url(https://static.igem.org/mediawiki/2013/3/34/Test-head.jpg) top center;<br />
margin: 0 0 35px;<br />
box-shadow: 2px 1px 12px #272727;<br />
<br />
}<br />
.wf-loading #page-header h1 {<br />
visibility: hidden;<br />
}<br />
<br />
.blog #page-header {<br />
// background: url(https://static.igem.org/mediawiki/2013/3/34/Test-head.jpg) top center;<br />
}<br />
#page-header h1 {<br />
font-family: "abril-fatface", 'Adobe Garamond', 'Garamond', serif;<br />
color: #fff;<br />
text-align: center;<br />
padding: 130px 0 0 0;<br />
text-shadow: 0 2px 0 #000;<br />
font-size: 60px;<br />
}<br />
#blog {<br />
z-index: 6;<br />
}<br />
#blog article {<br />
margin: 10px auto 60px;<br />
max-width: 1200px;<br />
position: relative;<br />
}<br />
#blog article .post {<br />
background: #fff;<br />
// box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
box-shadow: 2px 1px 6px #272727;<br />
border-radius: 2px;<br />
overflow: hidden;<br />
color: #333;<br />
margin: 0 0 15px;<br />
}<br />
#blog article .post .text {<br />
padding: 20px 20px 10px;<br />
}<br />
.post-content a {<br />
color: #2683a5;<br />
}<br />
.post-content a:hover {<br />
color: #4ea9a2; <br />
}<br />
#blog article .post h2 {<br />
font-family: 'Tangerine', serif;<br />
font-size: 48px;<br />
text-shadow: 4px 4px 4px #aaa;<br />
color: #38f;<br />
letter-spacing: 0.1em;<br />
word-spacing: 0.3em;<br />
font-weight: 700;<br />
line-height: 36px;<br />
margin: 0;<br />
}<br />
#blog article .post h3 {<br />
font-size: 14px;<br />
line-height: 18px;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
}<br />
#blog article .post .meta {<br />
font-size: 11px;<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
}<br />
#blog article .post p {<br />
font-size: 16px;<br />
line-height: 19px;<br />
font-family: Trebuchet MS;<br />
font-weight: 600;<br />
}<br />
.short-url, .share, .categories {<br />
background: #eaeaea left center no-repeat;<br />
border-radius: 2px;<br />
border-bottom: 1px solid #fff;<br />
border-top: 1px solid #d0d0d0;<br />
float: left;<br />
margin: 0 20px 0 0;<br />
padding: 4px 15px 4px 35px;<br />
font-size: 11px;<br />
color: #666;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
text-shadow: 0 1px 0 #fff;<br />
-webkit-transition: all .2s ease-out;<br />
-moz-transition: all .2s ease-out;<br />
transition: all .2s ease-out;<br />
}<br />
.addthis_toolbox {<br />
display: none;<br />
padding: 0 20px 20px;<br />
}<br />
.short-url:hover, .share:hover {<br />
background-color: #ddd;<br />
border-top: 1px solid #aaa;<br />
}<br />
<br />
#blog article.quote {<br />
max-width: 940px;<br />
}<br />
#blog article.quote .quote-content {<br />
background: #676767;<br />
padding: 30px;<br />
border-radius: 3px;<br />
border-top: #111 1px solid;<br />
border-bottom: #fff 1px solid;<br />
margin: 0 0 15px;<br />
}<br />
#blog article.quote .quote-content p {<br />
font-size: 26px;<br />
line-height: 32px;<br />
color: #eee;<br />
font-weight: 300;<br />
}<br />
#blog article.quote p.ref {<br />
color: #fff;<br />
padding: 0;<br />
margin: 0;<br />
}<br />
#blog article.quote .quote-content a {<br />
color: #fff;<br />
text-decoration: underline;<br />
}<br />
#blog-pagination {<br />
display: block;<br />
text-align: center;<br />
margin: 35px 0;<br />
}<br />
.wp-paginate {<br />
display: inline-block;<br />
padding: 0;<br />
box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
border-radius: 3px;<br />
}<br />
.wp-paginate li {<br />
padding: 0!important;<br />
display: inline-block;<br />
background-image: none!important;<br />
background-color: #fff;<br />
margin: 0;<br />
float: left;<br />
}<br />
.wp-paginate a, .wp-paginate .page.current {<br />
color: #333;<br />
padding: 10px 13px;<br />
display: inline-block;<br />
margin-bottom: 0!important;<br />
min-width: 10px;<br />
border-right: 1px solid #eee;<br />
font-size: 12px;<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
-webkit-transition: all .1s ease-in-out;<br />
-moz-transition: all .1s ease-in-out;<br />
transition: all .1s ease-in-out;<br />
}<br />
.wp-paginate span {<br />
margin-bottom: 0!important;<br />
}<br />
.wp-paginate a.next {<br />
border-left: 0;<br />
}<br />
.wp-paginate .page {<br />
margin: 0;<br />
}<br />
.wp-paginate .page.current {<br />
background-color: #fafafa;<br />
color: #888;<br />
}<br />
.wp-paginate a:hover {<br />
background: #555;<br />
color: #fff;<br />
border-right: 1px solid #555;<br />
}<br />
#disqus_thread {<br />
margin: 10px auto 35px!important;<br />
max-width: 660px;<br />
position: relative;<br />
background: #eaeaea;<br />
border-radius: 2px;<br />
border-bottom: 1px solid #fff;<br />
border-top: 1px solid #d0d0d0;<br />
color: #1a1a1a;<br />
padding: 20px;<br />
font-size: 12px;<br />
}<br />
#disqus_thread h3 {<br />
font-size: 14px;<br />
text-transform: uppercase;<br />
text-shadow: 0 1px 0 #fff;<br />
font-weight: 600;<br />
}<br />
#contact {<br />
position: relative;<br />
height: 940px;<br />
}<br />
#location-map {<br />
width: 100%;<br />
height: 940px;<br />
display: block;<br />
position: absolute;<br />
top: 0;<br />
}<br />
#contact .container {<br />
padding-top: 60px;<br />
}<br />
#contact #contact-details, #contact #message {<br />
background: #262626;<br />
float: none;<br />
display: block;<br />
margin: 0 0 35px;<br />
box-shadow: 0 0 25px 0 rgba(0, 0, 0, .25);<br />
}<br />
#phone-address, #work-planner {<br />
padding: 30px 40px;<br />
}<br />
#phone-address {<br />
border-bottom: 1px solid #565656;<br />
}<br />
#phone-address p, #work-planner h2, #message h2 {<br />
text-transform: uppercase;<br />
color: #fff;<br />
font-weight: 600;<br />
font-size: 14px;<br />
}<br />
#phone-address p {<br />
padding-left: 35px;<br />
}<br />
#phone-address p#phone {<br />
background: url(art/phone.png) no-repeat 2px 2px;<br />
}<br />
#phone-address p#address {<br />
background: url(art/map.png) no-repeat 2px 2px;<br />
margin: 0;<br />
}<br />
#work-planner h2, #message h2 {<br />
margin: 0 0 10px;<br />
line-height: normal;<br />
}<br />
#work-planner p {<br />
color: #9c9c9c;<br />
font-size: 13px;<br />
font-weight: 600;<br />
}<br />
#work-planner a {<br />
padding: 12px 40px 12px 12px;<br />
color: #fff;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
font-size: 12px;<br />
background: #ce462b url(art/get-started-arrow.png) no-repeat right center;<br />
margin: 0 0 10px;<br />
display: block;<br />
width: 128px;<br />
-webkit-transition: background-color .2s ease-in-out;<br />
-moz-transition: background-color .2s ease-in-out;<br />
transition: background-color .2s ease-in-out;<br />
}<br />
#work-planner a:hover {<br />
background-color: #4ea9a2;<br />
}<br />
#contact #message .wrapper {<br />
padding: 30px 40px;<br />
}<br />
#contact #message .field {<br />
display: block;<br />
position: relative;<br />
margin: 0 0 15px;<br />
}<br />
#contact #message label {<br />
position: absolute;<br />
top: 9px;<br />
left: 11px;<br />
color: #aaa;<br />
font-size: 13px;<br />
font-weight: 500;<br />
}<br />
#contact #message input, #contact #message textarea {<br />
width: 300px;<br />
max-width: 300px;<br />
background: #000;<br />
border: 0;<br />
border-bottom: 1px solid #373737;<br />
width: 100%;<br />
color: #ddd;<br />
font-size: 13px;<br />
font-weight: 500;<br />
padding: 8px 10px;<br />
}<br />
#contact #message textarea {<br />
height: 80px;<br />
}<br />
#contact #message input:focus, #contact #message textarea:focus {<br />
background: #111;<br />
outline: 0;<br />
}<br />
#contact #message button {<br />
padding: 14px 40px 14px 12px;<br />
color: #fff;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
text-align: left;<br />
font-size: 12px;<br />
background: #343434 url(art/message-arrow.png) no-repeat right center;<br />
display: block;<br />
margin: 0;<br />
width: 180px;<br />
-webkit-transition: background-color .2s ease-in-out;<br />
-moz-transition: background-color .2s ease-in-out;<br />
transition: background-color .2s ease-in-out;<br />
font-family: "proxima-nova", "HelveticaNeue", "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
}<br />
#contact #message button:hover {<br />
background-color: #666;<br />
}<br />
.contact footer {<br />
margin: 0;<br />
}<br />
footer {<br />
padding: 35px 0 20px;<br />
background: #003399;<br />
height: 130px;<br />
box-shadow: 4px 3px 25px #000;<br />
}<br />
footer h3 {<br />
font-size: 13px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
color: #fff;<br />
text-transform: uppercase;<br />
margin: 0 0 20px;<br />
}<br />
footer p {<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
}<br />
footer p a, footer p a:visited, footer p span {<br />
color: #dedede;<br />
}<br />
footer p a:hover {<br />
color: #fff;<br />
}<br />
#footer-contact p {<br />
margin-right: 40px;<br />
float: left;<br />
}<br />
#footer-project p {<br />
max-width: 180px;<br />
}<br />
#footer-newsletter {<br />
position: relative;<br />
}<br />
#footer-newsletter p {<br />
position: absolute;<br />
font-size: 11px;<br />
top: 0;<br />
right: 0;<br />
color: #7c7c7c;<br />
}<br />
#footer-newsletter input {<br />
width: 220px;<br />
height: 19px;<br />
background: #202020;<br />
border: 0;<br />
margin: 0;<br />
padding: 10px;<br />
color: #fff;<br />
font-size: 12px;<br />
-webkit-transition: background .3s ease-in-out;<br />
-moz-transition: background .3s ease-in-out;<br />
transition: background .3s ease-in-out;<br />
float: left;<br />
border-radius: 0;<br />
}<br />
#footer-newsletter input:focus {<br />
outline: 0;<br />
background: #333;<br />
}<br />
#footer-newsletter label {<br />
position: absolute;<br />
top: 49px;<br />
left: 10px;<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
}<br />
#footer-newsletter button {<br />
width: 39px;<br />
height: 39px;<br />
text-indent: -99999em;<br />
background: #202020 url(art/btn-arrow.svg) no-repeat center center;<br />
float: right;<br />
-webkit-transition: background .3s ease-in-out;<br />
-moz-transition: background .3s ease-in-out;<br />
transition: background .3s ease-in-out;<br />
}<br />
#footer-newsletter button:hover {<br />
background-color: #333;<br />
}<br />
#footer-final {<br />
margin: 15px auto;<br />
padding-top: 35px;<br />
border-top: 1px solid #313131;<br />
position: relative;<br />
}<br />
#footer-final a, #footer-final a:visited {<br />
color: #aaa;<br />
}<br />
#footer-final a:hover {<br />
color: #fff;<br />
}<br />
#footer-final p {<br />
font-weight: 600;<br />
font-size: 12px;<br />
display: block;<br />
margin: 0;<br />
}<br />
#footer-nav {<br />
text-align: center;<br />
}<br />
#footer-nav a {<br />
margin: 0 8px;<br />
}<br />
#footer-final p#footer-social {<br />
text-align: right;<br />
margin-left: 40px;<br />
}<br />
#footer-social a, #footer-social a:visited {<br />
margin: 0 0 0 16px;<br />
}<br />
.left {<br />
float: left;<br />
}<br />
.right {<br />
float: right;<br />
}<br />
span.error {<br />
color: red;<br />
font-size: 12px;<br />
}<br />
p.success {<br />
background: #009b00;<br />
padding: 5px;<br />
color: #fff;<br />
text-align: center;<br />
font-weight: 600;<br />
border-radius: 3px;<br />
}<br />
p.fail {<br />
background: red;<br />
padding: 5px;<br />
color: #fff;<br />
text-align: center;<br />
font-weight: 600;<br />
border-radius: 3px;<br />
}<br />
.success {<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
}<br />
.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.aligncenter, div.aligncenter {<br />
display: block;<br />
margin: 5px auto 5px auto;<br />
}<br />
.alignright {<br />
float: right;<br />
margin: 5px 0 20px 20px;<br />
}<br />
.alignleft {<br />
float: left;<br />
margin: 5px 20px 20px 0;<br />
}<br />
.aligncenter {<br />
display: block;<br />
margin: 5px auto 5px auto;<br />
}<br />
a img.alignright {<br />
float: right;<br />
margin: 5px 0 20px 20px;<br />
}<br />
a img.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
a img.alignleft {<br />
float: left;<br />
margin: 5px 20px 20px 0;<br />
}<br />
a img.aligncenter {<br />
display: block;<br />
margin-left: auto;<br />
margin-right: auto;<br />
}<br />
.wp-caption {<br />
background: #fff;<br />
border: 1px solid #f0f0f0;<br />
max-width: 96%;<br />
padding: 5px 3px 10px;<br />
text-align: center;<br />
}<br />
.wp-caption.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.wp-caption.alignleft {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.wp-caption.alignright {<br />
margin: 5px 0 20px 20px;<br />
}<br />
.wp-caption img {<br />
border: 0 none;<br />
height: auto;<br />
margin: 0;<br />
max-width: 98.5%;<br />
padding: 0;<br />
width: auto;<br />
}<br />
.wp-caption p.wp-caption-text {<br />
font-size: 11px;<br />
line-height: 17px;<br />
margin: 0;<br />
padding: 0 4px 5px;<br />
}<br />
.cols_2_left, .cols_2_right, .cols_3_left, .cols_3_middle, .cols_3_right {<br />
margin: 0 0 1.5em;<br />
}<br />
.cols_2_left {<br />
float: left;<br />
width: 47%}<br />
.cols_2_right {<br />
float: right;<br />
width: 47%}<br />
.cols_3_left {<br />
float: left;<br />
width: 30%}<br />
.cols_3_middle {<br />
float: left;<br />
width: 30%;<br />
margin-left: 5%}<br />
.cols_3_right {<br />
float: right;<br />
width: 30%}<br />
.container {<br />
position: relative;<br />
width: 1000px;<br />
margin: 0 auto;<br />
padding: 0;<br />
}<br />
.container.short {<br />
width: 940px;<br />
}<br />
.container .column, .container .columns {<br />
float: left;<br />
display: inline;<br />
margin-left: 10px;<br />
margin-right: 10px;<br />
}<br />
.row {<br />
margin-bottom: 20px;<br />
}<br />
.column.alpha, .columns.alpha {<br />
margin-left: 0;<br />
}<br />
.column.omega, .columns.omega {<br />
margin-right: 0;<br />
}<br />
.container .one.column, .container .one.columns {<br />
width: 40px;<br />
}<br />
.container .two.columns {<br />
width: 100px;<br />
}<br />
.container .three.columns {<br />
width: 160px;<br />
}<br />
.container .four.columns {<br />
width: 220px;<br />
}<br />
.container .five.columns {<br />
width: 180px;<br />
}<br />
.container .six.columns {<br />
width: 340px;<br />
}<br />
.container .seven.columns {<br />
width: 400px;<br />
}<br />
.container .eight.columns {<br />
width: 460px;<br />
}<br />
.container .nine.columns {<br />
width: 520px;<br />
}<br />
.container .ten.columns {<br />
width: 580px;<br />
}<br />
.container .eleven.columns {<br />
width: 640px;<br />
}<br />
.container .twelve.columns {<br />
width: 700px;<br />
}<br />
.container .thirteen.columns {<br />
width: 760px;<br />
}<br />
.container .fourteen.columns {<br />
width: 820px;<br />
}<br />
.container .fifteen.columns {<br />
width: 880px;<br />
}<br />
.container .sixteen.columns {<br />
width: 940px;<br />
}<br />
.container .one-third.column {<br />
width: 290px;<br />
}<br />
.container .two-thirds.column {<br />
width: 615px;<br />
}<br />
.container .offset-by-one {<br />
padding-left: 60px;<br />
}<br />
.container .offset-by-two {<br />
padding-left: 120px;<br />
}<br />
.container .offset-by-three {<br />
padding-left: 180px;<br />
}<br />
.container .offset-by-four {<br />
padding-left: 240px;<br />
}<br />
.container .offset-by-five {<br />
padding-left: 300px;<br />
}<br />
.container .offset-by-six {<br />
padding-left: 360px;<br />
}<br />
.container .offset-by-seven {<br />
padding-left: 420px;<br />
}<br />
.container .offset-by-eight {<br />
padding-left: 480px;<br />
}<br />
.container .offset-by-nine {<br />
padding-left: 540px;<br />
}<br />
.container .offset-by-ten {<br />
padding-left: 600px;<br />
}<br />
.container .offset-by-eleven {<br />
padding-left: 660px;<br />
}<br />
.container .offset-by-twelve {<br />
padding-left: 720px;<br />
}<br />
.container .offset-by-thirteen {<br />
padding-left: 780px;<br />
}<br />
.container .offset-by-fourteen {<br />
padding-left: 840px;<br />
}<br />
.container .offset-by-fifteen {<br />
padding-left: 900px;<br />
}<br />
@media only screen and (max-width:1049px) {<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images.two img {<br />
width: 450px;<br />
}<br />
}@media only screen and (min-width:960px) {<br />
#logo {<br />
-webkit-transform-style: preserve-3d;<br />
}<br />
#logo1 {<br />
-webkit-transform-style: preserve-3d;<br />
}<br />
.sticky #logo {<br />
-webkit-transform: scale(.75);<br />
-moz-transform: scale(.75);<br />
-ms-transform: scale(.75);<br />
-o-transform: scale(.75);<br />
transform: scale(.75);<br />
top: 0;<br />
left: -10px;<br />
}<br />
.sticky #logo1 {<br />
-webkit-transform: scale(.75);<br />
-moz-transform: scale(.75);<br />
-ms-transform: scale(.75);<br />
-o-transform: scale(.75);<br />
transform: scale(.75);<br />
top: 0;<br />
right: -1px;<br />
}<br />
<br />
}@media only screen and (min-device-width :768px) and (max-device-width:1024px) and (orientation:landscape) {<br />
#logo {<br />
-webkit-transform-style: flat;<br />
}<br />
#logo1 {<br />
-webkit-transform-style: flat;<br />
}<br />
.sticky #logo {<br />
-webkit-transform: none;<br />
-moz-transform: none;<br />
-ms-transform: none;<br />
-o-transform: none;<br />
transform: none;<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
-webkit-transform: none;<br />
-moz-transform: none;<br />
-ms-transform: none;<br />
-o-transform: none;<br />
transform: none;<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
}@media only screen and (min-width:768px) and (max-width:959px) {<br />
.container {<br />
width: 768px;<br />
}<br />
.container.short {<br />
width: 748px;<br />
}<br />
.container .column, .container .columns {<br />
margin-left: 10px;<br />
margin-right: 10px;<br />
}<br />
.column.alpha, .columns.alpha {<br />
margin-left: 0;<br />
margin-right: 10px;<br />
}<br />
.column.omega, .columns.omega {<br />
margin-right: 0;<br />
margin-left: 10px;<br />
}<br />
.alpha.omega {<br />
margin-left: 0;<br />
margin-right: 0;<br />
}<br />
.container .one.column, .container .one.columns {<br />
width: 28px;<br />
}<br />
.container .two.columns {<br />
width: 76px;<br />
}<br />
.container .three.columns {<br />
width: 124px;<br />
}<br />
.container .four.columns {<br />
width: 172px;<br />
}<br />
.container .five.columns {<br />
width: 220px;<br />
}<br />
.container .six.columns {<br />
width: 268px;<br />
}<br />
.container .seven.columns {<br />
width: 316px;<br />
}<br />
.container .eight.columns {<br />
width: 364px;<br />
}<br />
.container .nine.columns {<br />
width: 412px;<br />
}<br />
.container .ten.columns {<br />
width: 460px;<br />
}<br />
.container .eleven.columns {<br />
width: 508px;<br />
}<br />
.container .twelve.columns {<br />
width: 556px;<br />
}<br />
.container .thirteen.columns {<br />
width: 604px;<br />
}<br />
.container .fourteen.columns {<br />
width: 652px;<br />
}<br />
.container .fifteen.columns {<br />
width: 700px;<br />
}<br />
.container .sixteen.columns {<br />
width: 748px;<br />
}<br />
.container .one-third.column {<br />
width: 236px;<br />
}<br />
.container .two-thirds.column {<br />
width: 492px;<br />
}<br />
.container .offset-by-one {<br />
padding-left: 48px;<br />
}<br />
.container .offset-by-two {<br />
padding-left: 96px;<br />
}<br />
.container .offset-by-three {<br />
padding-left: 144px;<br />
}<br />
.container .offset-by-four {<br />
padding-left: 192px;<br />
}<br />
.container .offset-by-five {<br />
padding-left: 240px;<br />
}<br />
.container .offset-by-six {<br />
padding-left: 288px;<br />
}<br />
.container .offset-by-seven {<br />
padding-left: 336px;<br />
}<br />
.container .offset-by-eight {<br />
padding-left: 384px;<br />
}<br />
.container .offset-by-nine {<br />
padding-left: 432px;<br />
}<br />
.container .offset-by-ten {<br />
padding-left: 480px;<br />
}<br />
.container .offset-by-eleven {<br />
padding-left: 528px;<br />
}<br />
.container .offset-by-twelve {<br />
padding-left: 576px;<br />
}<br />
.container .offset-by-thirteen {<br />
padding-left: 624px;<br />
}<br />
.container .offset-by-fourteen {<br />
padding-left: 672px;<br />
}<br />
.container .offset-by-fifteen {<br />
padding-left: 720px;<br />
}<br />
.sticky #logo {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
nav a {<br />
padding-left: 10px;<br />
padding-right: 10px;<br />
}<br />
#footer-contact {<br />
width: 220px;<br />
}<br />
#footer-newsletter {<br />
float: right;<br />
width: 280px;<br />
}<br />
.mini-post {<br />
width: 236px;<br />
}<br />
.mini-post img {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images img {<br />
width: 100%}<br />
#case-details .images.two img {<br />
width: 350px;<br />
}<br />
#case-details, #meta .container, .single #page-header .container {<br />
padding: 0 10px;<br />
width: 748px;<br />
}<br />
.about .column-text {<br />
padding: 0 15px;<br />
}<br />
#feature h1 {<br />
font-size: 55px;<br />
}<br />
#page-header.case h1 {<br />
font-size: 40px;<br />
line-height: 34px;<br />
}<br />
#page-header.case h2 {<br />
max-width: 40%;<br />
line-height: 24px;<br />
}<br />
#blog-top #categories {<br />
width: 220px;<br />
}<br />
#blog-top form {<br />
width: 340px;<br />
}<br />
#blog-top #rss {<br />
width: 100px;<br />
}<br />
.container .seven.columns {<br />
width: 400px;<br />
}<br />
.single-work #page-header h2, .single-lab #page-header h2 {<br />
font-weight: 500;<br />
font-size: 16px;<br />
line-height: 22px;<br />
}<br />
<br />
footer {<br />
height: auto;<br />
}<br />
#wrap {<br />
margin-bottom: 0;<br />
min-height: 0;<br />
}<br />
.push {<br />
display: none;<br />
}<br />
#copyright, #footer-social {<br />
width: 150px;<br />
margin: 0!important;<br />
}<br />
#location-map {<br />
display: none;<br />
}<br />
#contact {<br />
height: auto;<br />
}<br />
#contact .container {<br />
padding-top: 10px;<br />
}<br />
#contact #contact-details {<br />
float: left;<br />
width: 340px;<br />
}<br />
#contact #message {<br />
float: right;<br />
width: 400px;<br />
}<br />
#footer-nav {<br />
width: 448px;<br />
}<br />
#processes {<br />
margin: 0 30px;<br />
}<br />
.process .text {<br />
padding: 0 15px;<br />
}<br />
.process p {<br />
font-size: 13px;<br />
line-height: 18px;<br />
}<br />
}@media only screen and (max-width:767px) {<br />
.container, .container.short {<br />
width: 300px;<br />
}<br />
.container .columns, .container .column {<br />
margin: 0;<br />
}<br />
.container .one.column, .container .one.columns, .container .two.columns, .container .three.columns, .container .four.columns, .container .five.columns, .container .six.columns, .container .seven.columns, .container .eight.columns, .container .nine.columns, .container .ten.columns, .container .eleven.columns, .container .twelve.columns, .container .thirteen.columns, .container .fourteen.columns, .container .fifteen.columns, .container .sixteen.columns, .container .one-third.column, .container .two-thirds.column {<br />
width: 300px;<br />
}<br />
.container .offset-by-one, .container .offset-by-two, .container .offset-by-three, .container .offset-by-four, .container .offset-by-five, .container .offset-by-six, .container .offset-by-seven, .container .offset-by-eight, .container .offset-by-nine, .container .offset-by-ten, .container .offset-by-eleven, .container .offset-by-twelve, .container .offset-by-thirteen, .container .offset-by-fourteen, .container .offset-by-fifteen {<br />
padding-left: 0;<br />
}<br />
.sticky #logo {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
#feature {<br />
height: 250px;<br />
}<br />
#feature article, #feature ul {<br />
display: none!important;<br />
}<br />
#feature h1 {<br />
top: 100px;<br />
font-size: 36px;<br />
line-height: 42px;<br />
}<br />
#home-content, #home-content .column, .mini-post {<br />
width: auto;<br />
float: none!important;<br />
display: block;<br />
}<br />
#home-content .column {<br />
margin: 0 0 40px;<br />
}<br />
.mini-post {<br />
margin: 0 auto 20px;<br />
width: 290px;<br />
}<br />
#tweet {<br />
padding: 40px 0 0 0;<br />
margin: 40px 0;<br />
width: auto;<br />
}<br />
#tweet .text {<br />
padding: 40px 20px 0;<br />
background-position: center top;<br />
}<br />
nav a {<br />
padding-left: 6px;<br />
padding-right: 6px;<br />
font-size: 12px;<br />
}<br />
<br />
#work article {<br />
width: 30%;<br />
margin: 10px;<br />
}<br />
#work article .image, #work article a img, .labs#work article .image {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images img, #case-details .images.two img {<br />
width: 100%;<br />
margin: 0 0 20px!important;<br />
}<br />
#page-header.case h1 {<br />
font-size: 30px;<br />
line-height: 28px;<br />
max-width: 55%}<br />
#page-header.case h2 {<br />
max-width: 50%;<br />
line-height: 24px;<br />
}<br />
.labs #page-header h1 {<br />
font-size: 46px;<br />
}<br />
#meta p {<br />
float: right;<br />
margin: 0;<br />
}<br />
#meta p:first-child {<br />
width: 50%;<br />
float: left;<br />
}<br />
#work-with-us {<br />
font-size: 18px;<br />
}<br />
#blog-top #categories {<br />
margin-bottom: 15px;<br />
}<br />
#blog-top form {<br />
width: 200px;<br />
}<br />
#blog-top input {<br />
width: 170px;<br />
}<br />
#blog-top #rss {<br />
width: 80px;<br />
float: right;<br />
}<br />
#blog article img {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#blog article {<br />
margin-bottom: 30px;<br />
}<br />
#blog article iframe {<br />
height: 270px;<br />
}<br />
#blog article .post h2 {<br />
font-size: 20px;<br />
line-height: 22px;<br />
}<br />
#blog .share {<br />
display: none;<br />
}<br />
.short-url {<br />
margin-bottom: 5px;<br />
}<br />
.categories {<br />
float: left;<br />
}<br />
.content h2 {<br />
font-size: 30px;<br />
line-height: 38px;<br />
}<br />
.content p {<br />
font-size: 14px;<br />
line-height: 22px;<br />
font-weight: 500;<br />
}<br />
<br />
footer {<br />
height: auto;<br />
}<br />
#wrap {<br />
margin-bottom: 0;<br />
min-height: 0;<br />
}<br />
.push {<br />
display: none;<br />
}<br />
#processes {<br />
margin: 0 20px;<br />
}<br />
.process .text {<br />
padding: 0 10px;<br />
}<br />
.process p {<br />
font-size: 12px;<br />
line-height: 16px;<br />
}<br />
}@media only screen and (min-width:480px) and (max-width:767px) {<br />
.container, .container.short {<br />
width: 420px;<br />
}<br />
.container .columns, .container .column {<br />
margin: 0;<br />
}<br />
.container .one.column, .container .one.columns, .container .two.columns, .container .three.columns, .container .four.columns, .container .five.columns, .container .six.columns, .container .seven.columns, .container .eight.columns, .container .nine.columns, .container .ten.columns, .container .eleven.columns, .container .twelve.columns, .container .thirteen.columns, .container .fourteen.columns, .container .fifteen.columns, .container .sixteen.columns, .container .one-third.column, .container .two-thirds.column {<br />
width: 420px;<br />
}<br />
#footer-newsletter input {<br />
width: 360px;<br />
}<br />
#blog-top form {<br />
width: 300px;<br />
}<br />
#blog-top input {<br />
width: 270px;<br />
}<br />
#blog-top #rss {<br />
width: 100px;<br />
float: right;<br />
}<br />
.categories {<br />
float: right;<br />
}<br />
.column-text {<br />
-moz-column-count: 1;<br />
-webkit-column-count: 1;<br />
column-count: 1;<br />
}<br />
}@media only screen and (min-width:320px) and (max-width:580px) {<br />
#logo, .sticky #logo {<br />
background-position: 0 -80px;<br />
top: 10px;<br />
left: 10px;<br />
}<br />
#logo1, .sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 10px;<br />
right: 1px;<br />
}<br />
header, header.sticky {<br />
height: 100px;<br />
}<br />
.sticky nav, nav {<br />
margin-top: 64px;<br />
}<br />
nav a {<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
}<br />
#feature h1 {<br />
top: 120px;<br />
font-size: 22px;<br />
line-height: 30px;<br />
}<br />
#tweet .text p {<br />
font-size: 20px;<br />
line-height: 24px;<br />
}<br />
#work article {<br />
width: 45%;<br />
margin: 6px;<br />
}<br />
#page-header {<br />
height: 200px;<br />
}<br />
#page-header h1 {<br />
font-size: 34px;<br />
}<br />
.labs #page-header h1 {<br />
font-size: 25px;<br />
}<br />
#page-header.case h2 {<br />
font-size: 16px;<br />
font-weight: 500;<br />
line-height: 20px;<br />
}<br />
#work-with-us {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#work-with-us span {<br />
background-image: none;<br />
}<br />
#contact #message input, #contact #message textarea {<br />
width: 200px;<br />
max-width: 200px;<br />
}<br />
#fresh ul {<br />
display: none;<br />
}<br />
#blog article iframe {<br />
height: 200px;<br />
}<br />
#process {<br />
display: none;<br />
}<br />
}.container:after {<br />
content: "\0020";<br />
display: block;<br />
height: 0;<br />
clear: both;<br />
visibility: hidden;<br />
}</div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Home
Team:Shenzhen BGIC 0101/Home
2013-10-20T08:03:06Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<!-- lazyload --><br />
<br />
<br />
<br />
<br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style_slider?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/jquery?action=raw&ctype=text/javascript"></script><br />
<br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<br />
<br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<style><br />
h3{<br />
font-family: 'Tangerine', serif;<br />
font-size: 45px;<br />
text-shadow: 4px 4px 4px #aaa;<br />
color: #38f;<br />
letter-spacing: 0.1em;<br />
word-spacing: 0.3em;<br />
font-weight: 700;<br />
line-height: 36px;<br />
margin: 0;<br />
}<br />
<br />
.reference{<br />
clear:both;<br />
top:40px;<br />
left:120px;<br />
<br />
font-size: 16px;<br />
line-height: 19px;<br />
font-family: Trebuchet MS;<br />
font-weight: 600;<br />
position:absolute;<br />
text-align:left;<br />
width:48%;<br />
padding:20px;<br />
background-color:#ffe;<br />
-moz-box-shadow:1px 3px 15px #ddd;<br />
-webkit-box-shadow:1px 3px 15px #ddd;<br />
box-shadow:4px 3px 25px #ddd;<br />
}<br />
<br />
ul.accordion{<br />
list-style:none; <br />
position:absolute;<br />
right:150px;<br />
top:0px;<br />
font-family: Cambria, serif;<br />
font-size: 16px;<br />
font-style: italic;<br />
line-height: 1.5em;<br />
}<br />
ul.accordion li{<br />
float:right;<br />
width:115px;<br />
height:480px;<br />
display:block;<br />
border-right:2px solid #fff;<br />
border-bottom:2px solid #fff;<br />
background-color:#fff;<br />
background-repeat:no-repeat;<br />
background-position:center center;<br />
position:relative;<br />
overflow:hidden;<br />
cursor:pointer;<br />
-moz-box-shadow:1px 3px 15px #555;<br />
-webkit-box-shadow:1px 3px 15px #555;<br />
box-shadow:1px 3px 15px #555;<br />
}<br />
ul.accordion li.bg1{<br />
background-image:url(https://static.igem.org/mediawiki/2013/c/c8/Bki-20101209112236-2125207650.jpg);<br />
}<br />
ul.accordion li.bg2{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bg3{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bg4{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bleft{<br />
border-left:2px solid #fff;<br />
}<br />
ul.accordion li .heading{<br />
background-color:#fff;<br />
padding:10px;<br />
margin-top:60px;<br />
opacity:0.9;<br />
text-transform:uppercase;<br />
font-style:normal;<br />
font-weight:bold;<br />
letter-spacing:1px;<br />
font-size:14px;<br />
color:#444;<br />
text-align:center;<br />
text-shadow:-1px -1px 1px #ccc;<br />
}<br />
ul.accordion li .description{<br />
position:absolute;<br />
width:480px;<br />
height:175px;<br />
bottom:0px;<br />
left:0px;<br />
display:none;<br />
}<br />
ul.accordion li .description h2{<br />
text-transform: uppercase;<br />
font-style: normal;<br />
font-weight: bold;<br />
letter-spacing: 1px;<br />
font-size: 25px;<br />
color: #444;<br />
text-align: left;<br />
margin: -15px 0px 0px 20px;<br />
text-shadow: -1px -1px 1px #ccc;<br />
}<br />
ul.accordion li .description p{<br />
line-height:14px;<br />
margin:10px 22px;<br />
font-family: "Trebuchet MS", sans-serif;<br />
font-size: 12px;<br />
font-style: italic;<br />
font-weight: normal;<br />
text-transform: none;<br />
letter-spacing: normal;<br />
line-height: 1.6em;<br />
}<br />
ul.accordion li .description a{<br />
position:absolute;<br />
bottom:5px;<br />
left:20px;<br />
text-transform:uppercase;<br />
font-style:normal;<br />
font-size:11px;<br />
text-decoration:none;<br />
color:#888;<br />
}<br />
ul.accordion li .description a:hover{<br />
color:#333;<br />
text-decoration:underline;<br />
}<br />
<br />
ul.accordion li .bgDescription{<br />
background:transparent url(https://static.igem.org/mediawiki/igem.org/1/15/BgDescription.png) repeat-x top left;<br />
height:340px;<br />
position:absolute;<br />
bottom:0px;<br />
left:0px;<br />
width:100%;<br />
display:none;<br />
}<br />
<br />
.win {<br />
width: 970px;<br />
margin: 50px auto;<br />
}<br />
.win a {<br />
line-height: 180px;<br />
display: block;<br />
margin: 8px;<br />
text-align: center;<br />
float: left;<br />
opacity: 1;<br />
}<br />
.win8 {<br />
margin: 8px;<br />
display: block;<br />
width : 300px;<br />
<br />
float: left;<br />
color: #015;<br />
font-family: Verdana, 'Times New Roman',serif;<br />
font-weight: 300;<br />
font-size: 13px;<br />
}<br />
h4{<br />
font-weight: 600;<br />
font-size: 17px;<br />
<br />
margin :8px;<br />
}<br />
.win8 img{<br />
width : 150px;<br />
}<br />
<br />
</style><br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/jquery?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
<br />
$(document).ready(function() {<br />
$('.win a').hover(function() {<br />
$(this).stop().animate({<br />
opacity: 0.5<br />
}, 300);<br />
}, function() {<br />
$(this).stop().animate({<br />
opacity: 1<br />
}, 300);<br />
});<br />
});<br />
<br />
</script><br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="wrap" style="font-family: Verdana, Geneva, sans-serif;background-color: #ff9;"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav><br />
<a href="https://2013.igem.org/Main_Page" id="logo1">igem</a> <br />
</header><br />
<br />
<br />
<div id="wowslider-container1"><br />
<div class="ws_images"><ul><br />
<li><img src="https://static.igem.org/mediawiki/2013/e/e5/Ggggg.png" alt="1" title="" id="wows1_0" class="lazy" />Genove</li><br />
<li><img src="https://static.igem.org/mediawiki/igem.org/c/c4/Slider2.jpg" alt="2" title="Nucleotide modification" id="wows1_1" class="lazy"/>Nucleotide modification allow users to modify sequence as their wishes by utilizing codon synonomousness.</li><br />
<li><img src="https://static.igem.org/mediawiki/igem.org/9/99/Slider3.jpg" alt="3" title="chromosome" id="wows1_2" class="lazy"/>We can help you creat a new chromosome.</li><br />
<li><img src="https://static.igem.org/mediawiki/2013/0/0a/Slider_4.jpg" alt="4" title="pathway" id="wows1_3" class="lazy"/>Genove can help you design a new pathway.</li><br />
<li><img src="https://static.igem.org/mediawiki/2013/1/1d/Slider_1.jpg" alt="5" title="team" id="wows1_4" class="lazy"/>All members of our team.</li><br />
</ul></div><br />
<div class="ws_bullets"><div><br />
<a href="#" title="1"><img src="" alt="1"/>1</a><br />
<a href="#" title="2"><img src="https://static.igem.org/mediawiki/igem.org/1/17/Little2.jpg" alt="2"/>2</a><br />
<a href="#" title="3"><img src="https://static.igem.org/mediawiki/igem.org/2/2f/Little3.jpg" alt="3"/>3</a><br />
<a href="#" title="4"><img src="https://static.igem.org/mediawiki/2013/c/c0/Little4.jpg" alt="4"/>4</a><br />
<a href="#" title="5"><img src="https://static.igem.org/mediawiki/2013/b/b2/Little1.jpg" alt="5"/>5</a><br />
</div></div></div><br />
<br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/wowslider?action=raw&ctype=text/javascript"></script> <br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/script?action=raw&ctype=text/javascript"></script><br />
<br />
<br/><br/><br />
<div class="win"><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/2/21/Lxm_3.png" /></a><h4>Neochr</h4>Construct genome's structure</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/c/c8/NucleoMod.png" /></a><h4>NucleoMod</h4>Modify CDS region</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/b/b2/SegmMan.png" /></a><h4>SegmMan</h4>Split into fragments</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial"><img src="https://static.igem.org/mediawiki/2013/c/ce/X_2.png" /></a><h4>Jbrowse GUI</h4>Operation interface</div><br />
<div class="win8"><a href="http://192.185.29.142/~luxujia/jbrowse_no_git/index.html?data=data/NeoChr/"><img src="https://static.igem.org/mediawiki/2013/4/47/Lxm_2.png" /></a><h4>Web sever</h4>Web version of Genovo</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial"><img src="https://static.igem.org/mediawiki/2013/0/08/Zwz.png" /></a> <h4>Tutorial</h4>Instruction for users</div><br />
</div><br />
<br />
<br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br />
<!-- The JavaScript --><br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1/jquery.min.js"></script><br />
<script type="text/javascript"><br />
$(function() {<br />
$('#accordion > li').hover(<br />
function () {<br />
var $this = $(this);<br />
$this.stop().animate({'width':'480px'},500);<br />
$('.heading',$this).stop(true,true).fadeOut();<br />
$('.bgDescription',$this).stop(true,true).slideDown(500);<br />
$('.description',$this).stop(true,true).fadeIn();<br />
},<br />
function () {<br />
var $this = $(this);<br />
$this.stop().animate({'width':'115px'},1000);<br />
$('.heading',$this).stop(true,true).fadeIn();<br />
$('.description',$this).stop(true,true).fadeOut(500);<br />
$('.bgDescription',$this).stop(true,true).slideUp(700);<br />
}<br />
);<br />
});<br />
</script><br />
<br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<br />
<footer><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.cn">gongjianhui@genomics.cn</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="http://www.humaan.com.au/wp-content/themes/humaan/js/scripts.min.js" type="text/javascript"></script><br />
<br />
<br />
</body><br />
</html><br />
{{Scroll}}</div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/style
Team:Shenzhen BGIC 0101/style
2013-10-20T08:02:13Z
<p>Czh: </p>
<hr />
<div>@font-face {<br />
font-family: 'Tangerine';<br />
font-style: normal;<br />
font-weight: 400;<br />
src: local('Tangerine'), url(http://themes.googleusercontent.com/static/fonts/tangerine/v3/HGfsyCL5WASpHOFnouG-RD8E0i7KZn-EPnyo3HZu7kw.woff) format('woff');<br />
}<br />
<br />
html, body, div, span, applet, object, iframe, h1, h2, h3, h4, h5, h6, p, blockquote, pre, a, abbr, acronym, address, big, cite, code, del, dfn, em, img, ins, kbd, q, s, samp, small, strike, strong, sub, sup, tt, var, b, u, i, center, dl, dt, dd, ol, ul, li, fieldset, form, label, legend, table, caption, tbody, tfoot, thead, tr, th, td, article, aside, canvas, details, embed, figure, figcaption, footer, header, hgroup, menu, nav, output, ruby, section, summary, time, mark, audio, video {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-size: 100%;<br />
font: inherit;<br />
vertical-align: baseline;<br />
letter-spacing: 0.05em;<br />
}<br />
article, aside, details, figcaption, figure, footer, header, hgroup, menu, nav, section {<br />
display: block;<br />
}<br />
body {<br />
line-height: 1;<br />
}<br />
ol, ul {<br />
list-style: none;<br />
}<br />
<br />
p, ul, ol {<br />
margin: 0 0 0px; <br />
<br />
}<br />
ul, ol {<br />
padding: 1.5em 0 0 2.5em;<br />
}<br />
<br />
<br />
body {<br />
/* background: #f2f2f2;*/<br />
background: #262626;<br />
font-family: "proxima-nova", "HelveticaNeue", "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
font-size: 14px;<br />
line-height: 21px;<br />
color: #262626;<br />
-webkit-font-smoothing: antialiased;<br />
-webkit-text-size-adjust: 100%}<br />
html, body {<br />
height: 100%}<br />
#wrap {<br />
//background: url(https://static.igem.org/mediawiki/2013/f/f4/Gene.jpg) no-repeat fixed;<br />
background-size:cover;<br />
margin-bottom: -245px;<br />
min-height: 100%;<br />
height: auto!important;<br />
height: 100%}<br />
.push {<br />
height: 245px;<br />
}<br />
p img {<br />
margin: 0;<br />
}<br />
em {<br />
font-style: italic;<br />
}<br />
strong {<br />
font-weight: bold;<br />
}<br />
hr {<br />
border: solid #ddd;<br />
border-width: 1px 0 0;<br />
clear: both;<br />
margin: 10px 0 30px;<br />
height: 0;<br />
}<br />
a, a:visited {<br />
color: #666;<br />
text-decoration: none;<br />
outline: 0;<br />
}<br />
a:hover, a:focus {<br />
color: #333;<br />
}<br />
p a, p a:visited {<br />
line-height: inherit;<br />
}<br />
img.scale-with-grid {<br />
max-width: 100%;<br />
height: auto;<br />
}<br />
<br />
header {<br />
width: 100%;<br />
height: 90px;<br />
background: #222;<br />
background: rgba(0, 0, 0, .2);<br />
border-color: #fff;<br />
border-bottom: 1px solid rgba(255, 255, 255, .25);<br />
position: fixed;<br />
top: 0;<br />
z-index: 10;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
-ms-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
}<br />
header.sticky {<br />
height: 60px;<br />
background: #993399;<br />
border: 0;<br />
box-shadow: 0 1px 6px rgba(0, 0, 0, .2);<br />
}<br />
header h1 {<br />
margin: 0;<br />
}<br />
#logo {<br />
width: 84px;<br />
height: 59px;<br />
display: block;<br />
background: url(https://static.igem.org/mediawiki/igem.org/e/e8/Genovo-logo.png) no-repeat;<br />
text-indent: -99999em;<br />
position: absolute;<br />
top: 15px;<br />
left: 15px;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
}<br />
#logo1{<br />
width: 80px;<br />
height: 60px;<br />
display: block;<br />
background: url(https://static.igem.org/mediawiki/2013/d/dd/Igem_logo12.png) no-repeat;<br />
text-indent: -99999em;<br />
position: absolute;<br />
top: 15px;<br />
right: 10px;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
z-index:9999;<br />
}<br />
nav {<br />
text-align: center;<br />
margin-top: 35px;<br />
-webkit-transition: margin .2s ease-in-out;<br />
-moz-transition: margin .2s ease-in-out;<br />
transition: margin .2s ease-in-out;<br />
}<br />
.sticky nav {<br />
margin-top: 20px;<br />
}<br />
nav a, #start-project {<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
color: #555;<br />
text-shadow: 0 1px 0 #fff;<br />
padding: 16px;<br />
font-size: 14px;<br />
}<br />
.light nav a {<br />
color: #ddd;/* top-nav color */<br />
text-shadow: 0 1px 0 rgba(0, 0, 0, .5);<br />
opacity: .5;<br />
-webkit-transition: opacity .1s linear;<br />
-moz-transition: opacity .1s linear;<br />
transition: opacity .1s linear;<br />
}<br />
nav a.current-menu-item, nav a.current_page_parent, nav a:hover, .single-work .light nav a.menu-item-18, .single-lab .light nav a.menu-item-17, .single-post .light nav a.menu-item-16 {<br />
opacity: 1;<br />
}<br />
.single-work nav a.current_page_parent, .single-lab nav a.current_page_parent {<br />
opacity: .5;<br />
}<br />
#blog {<br />
z-index: 6;<br />
}<br />
#blog article {<br />
margin: 10px auto 60px;<br />
max-width: 700px;<br />
position: relative;<br />
}<br />
<br />
<br />
#home-content h2, #fresh h2, h2.section-title {<br />
color: #358;<br />
font-size: 12px;<br />
text-shadow: 0 1px 0 #fff;<br />
font-weight: 600;<br />
width: 150px;<br />
background: #aaa;<br />
margin: -20px auto 20px;<br />
text-align: center;<br />
}<br />
#home-content .column, #fresh {<br />
border-top: 1px solid #d0d0d0;<br />
}<br />
#home-content .one-third {<br />
float: right!important;<br />
}<br />
.mini-post {<br />
float: left;<br />
background: #fff;<br />
box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
border-radius: 2px;<br />
overflow: hidden;<br />
width: 290px;<br />
-webkit-transition: all .2s ease-out;<br />
-moz-transition: all .2s ease-out;<br />
transition: all .2s ease-out;<br />
color: #333;<br />
min-height: 320px;<br />
cursor: pointer;<br />
}<br />
.mini-post:hover {<br />
margin-top: -5px;<br />
box-shadow: 0 3px 3px 0 rgba(0, 0, 0, .4);<br />
}<br />
.mini-post .text {<br />
padding: 20px 20px 10px;<br />
}<br />
.mini-post h3 {<br />
font-size: 16px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
margin: 0;<br />
}<br />
.mini-post .meta {<br />
font-size: 11px;<br />
}<br />
.mini-post p {<br />
font-size: 13px;<br />
}<br />
.mini-post .more {<br />
font-weight: 600;<br />
}<br />
#tweet {<br />
margin: 40px auto;<br />
padding-top: 40px;<br />
border-top: 1px solid #d0d0d0;<br />
}<br />
#tweet .text {<br />
padding: 0 90px;<br />
background: url(art/bird.svg) no-repeat 35px 0;<br />
font-size: 26px;<br />
font-weight: 300;<br />
}<br />
#tweet .text p {<br />
margin: 0 0 10px;<br />
text-align: center;<br />
line-height: 36px;<br />
}<br />
#tweet .text p.author {<br />
font-size: 20px;<br />
}<br />
#page-header {<br />
width: auto;<br />
// height: 220px;<br />
//background: url(https://static.igem.org/mediawiki/2013/3/34/Test-head.jpg) top center;<br />
margin: 0 0 35px;<br />
box-shadow: 2px 1px 12px #272727;<br />
<br />
}<br />
.wf-loading #page-header h1 {<br />
visibility: hidden;<br />
}<br />
<br />
.blog #page-header {<br />
// background: url(https://static.igem.org/mediawiki/2013/3/34/Test-head.jpg) top center;<br />
}<br />
#page-header h1 {<br />
font-family: "abril-fatface", 'Adobe Garamond', 'Garamond', serif;<br />
color: #fff;<br />
text-align: center;<br />
padding: 130px 0 0 0;<br />
text-shadow: 0 2px 0 #000;<br />
font-size: 60px;<br />
}<br />
#blog {<br />
z-index: 6;<br />
}<br />
#blog article {<br />
margin: 10px auto 60px;<br />
max-width: 1200px;<br />
position: relative;<br />
}<br />
#blog article .post {<br />
background: #fff;<br />
// box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
box-shadow: 2px 1px 6px #272727;<br />
border-radius: 2px;<br />
overflow: hidden;<br />
color: #333;<br />
margin: 0 0 15px;<br />
}<br />
#blog article .post .text {<br />
padding: 20px 20px 10px;<br />
}<br />
.post-content a {<br />
color: #2683a5;<br />
}<br />
.post-content a:hover {<br />
color: #4ea9a2; <br />
}<br />
#blog article .post h2 {<br />
font-family: 'Tangerine', serif;<br />
font-size: 48px;<br />
text-shadow: 4px 4px 4px #aaa;<br />
color: #38f;<br />
letter-spacing: 0.1em;<br />
word-spacing: 0.3em;<br />
font-weight: 700;<br />
line-height: 36px;<br />
margin: 0;<br />
}<br />
#blog article .post h3 {<br />
font-size: 14px;<br />
line-height: 18px;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
}<br />
#blog article .post .meta {<br />
font-size: 11px;<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
}<br />
#blog article .post p {<br />
font-size: 16px;<br />
line-height: 19px;<br />
font-family: Trebuchet MS;<br />
font-weight: 600;<br />
}<br />
.short-url, .share, .categories {<br />
background: #eaeaea left center no-repeat;<br />
border-radius: 2px;<br />
border-bottom: 1px solid #fff;<br />
border-top: 1px solid #d0d0d0;<br />
float: left;<br />
margin: 0 20px 0 0;<br />
padding: 4px 15px 4px 35px;<br />
font-size: 11px;<br />
color: #666;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
text-shadow: 0 1px 0 #fff;<br />
-webkit-transition: all .2s ease-out;<br />
-moz-transition: all .2s ease-out;<br />
transition: all .2s ease-out;<br />
}<br />
.addthis_toolbox {<br />
display: none;<br />
padding: 0 20px 20px;<br />
}<br />
.short-url:hover, .share:hover {<br />
background-color: #ddd;<br />
border-top: 1px solid #aaa;<br />
}<br />
<br />
#blog article.quote {<br />
max-width: 940px;<br />
}<br />
#blog article.quote .quote-content {<br />
background: #676767;<br />
padding: 30px;<br />
border-radius: 3px;<br />
border-top: #111 1px solid;<br />
border-bottom: #fff 1px solid;<br />
margin: 0 0 15px;<br />
}<br />
#blog article.quote .quote-content p {<br />
font-size: 26px;<br />
line-height: 32px;<br />
color: #eee;<br />
font-weight: 300;<br />
}<br />
#blog article.quote p.ref {<br />
color: #fff;<br />
padding: 0;<br />
margin: 0;<br />
}<br />
#blog article.quote .quote-content a {<br />
color: #fff;<br />
text-decoration: underline;<br />
}<br />
#blog-pagination {<br />
display: block;<br />
text-align: center;<br />
margin: 35px 0;<br />
}<br />
.wp-paginate {<br />
display: inline-block;<br />
padding: 0;<br />
box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
border-radius: 3px;<br />
}<br />
.wp-paginate li {<br />
padding: 0!important;<br />
display: inline-block;<br />
background-image: none!important;<br />
background-color: #fff;<br />
margin: 0;<br />
float: left;<br />
}<br />
.wp-paginate a, .wp-paginate .page.current {<br />
color: #333;<br />
padding: 10px 13px;<br />
display: inline-block;<br />
margin-bottom: 0!important;<br />
min-width: 10px;<br />
border-right: 1px solid #eee;<br />
font-size: 12px;<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
-webkit-transition: all .1s ease-in-out;<br />
-moz-transition: all .1s ease-in-out;<br />
transition: all .1s ease-in-out;<br />
}<br />
.wp-paginate span {<br />
margin-bottom: 0!important;<br />
}<br />
.wp-paginate a.next {<br />
border-left: 0;<br />
}<br />
.wp-paginate .page {<br />
margin: 0;<br />
}<br />
.wp-paginate .page.current {<br />
background-color: #fafafa;<br />
color: #888;<br />
}<br />
.wp-paginate a:hover {<br />
background: #555;<br />
color: #fff;<br />
border-right: 1px solid #555;<br />
}<br />
#disqus_thread {<br />
margin: 10px auto 35px!important;<br />
max-width: 660px;<br />
position: relative;<br />
background: #eaeaea;<br />
border-radius: 2px;<br />
border-bottom: 1px solid #fff;<br />
border-top: 1px solid #d0d0d0;<br />
color: #1a1a1a;<br />
padding: 20px;<br />
font-size: 12px;<br />
}<br />
#disqus_thread h3 {<br />
font-size: 14px;<br />
text-transform: uppercase;<br />
text-shadow: 0 1px 0 #fff;<br />
font-weight: 600;<br />
}<br />
#contact {<br />
position: relative;<br />
height: 940px;<br />
}<br />
#location-map {<br />
width: 100%;<br />
height: 940px;<br />
display: block;<br />
position: absolute;<br />
top: 0;<br />
}<br />
#contact .container {<br />
padding-top: 60px;<br />
}<br />
#contact #contact-details, #contact #message {<br />
background: #262626;<br />
float: none;<br />
display: block;<br />
margin: 0 0 35px;<br />
box-shadow: 0 0 25px 0 rgba(0, 0, 0, .25);<br />
}<br />
#phone-address, #work-planner {<br />
padding: 30px 40px;<br />
}<br />
#phone-address {<br />
border-bottom: 1px solid #565656;<br />
}<br />
#phone-address p, #work-planner h2, #message h2 {<br />
text-transform: uppercase;<br />
color: #fff;<br />
font-weight: 600;<br />
font-size: 14px;<br />
}<br />
#phone-address p {<br />
padding-left: 35px;<br />
}<br />
#phone-address p#phone {<br />
background: url(art/phone.png) no-repeat 2px 2px;<br />
}<br />
#phone-address p#address {<br />
background: url(art/map.png) no-repeat 2px 2px;<br />
margin: 0;<br />
}<br />
#work-planner h2, #message h2 {<br />
margin: 0 0 10px;<br />
line-height: normal;<br />
}<br />
#work-planner p {<br />
color: #9c9c9c;<br />
font-size: 13px;<br />
font-weight: 600;<br />
}<br />
#work-planner a {<br />
padding: 12px 40px 12px 12px;<br />
color: #fff;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
font-size: 12px;<br />
background: #ce462b url(art/get-started-arrow.png) no-repeat right center;<br />
margin: 0 0 10px;<br />
display: block;<br />
width: 128px;<br />
-webkit-transition: background-color .2s ease-in-out;<br />
-moz-transition: background-color .2s ease-in-out;<br />
transition: background-color .2s ease-in-out;<br />
}<br />
#work-planner a:hover {<br />
background-color: #4ea9a2;<br />
}<br />
#contact #message .wrapper {<br />
padding: 30px 40px;<br />
}<br />
#contact #message .field {<br />
display: block;<br />
position: relative;<br />
margin: 0 0 15px;<br />
}<br />
#contact #message label {<br />
position: absolute;<br />
top: 9px;<br />
left: 11px;<br />
color: #aaa;<br />
font-size: 13px;<br />
font-weight: 500;<br />
}<br />
#contact #message input, #contact #message textarea {<br />
width: 300px;<br />
max-width: 300px;<br />
background: #000;<br />
border: 0;<br />
border-bottom: 1px solid #373737;<br />
width: 100%;<br />
color: #ddd;<br />
font-size: 13px;<br />
font-weight: 500;<br />
padding: 8px 10px;<br />
}<br />
#contact #message textarea {<br />
height: 80px;<br />
}<br />
#contact #message input:focus, #contact #message textarea:focus {<br />
background: #111;<br />
outline: 0;<br />
}<br />
#contact #message button {<br />
padding: 14px 40px 14px 12px;<br />
color: #fff;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
text-align: left;<br />
font-size: 12px;<br />
background: #343434 url(art/message-arrow.png) no-repeat right center;<br />
display: block;<br />
margin: 0;<br />
width: 180px;<br />
-webkit-transition: background-color .2s ease-in-out;<br />
-moz-transition: background-color .2s ease-in-out;<br />
transition: background-color .2s ease-in-out;<br />
font-family: "proxima-nova", "HelveticaNeue", "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
}<br />
#contact #message button:hover {<br />
background-color: #666;<br />
}<br />
.contact footer {<br />
margin: 0;<br />
}<br />
footer {<br />
padding: 35px 0 20px;<br />
background: #003399;<br />
height: 190px;<br />
box-shadow: 4px 3px 25px #000;<br />
}<br />
footer h3 {<br />
font-size: 13px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
color: #fff;<br />
text-transform: uppercase;<br />
margin: 0 0 20px;<br />
}<br />
footer p {<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
}<br />
footer p a, footer p a:visited, footer p span {<br />
color: #dedede;<br />
}<br />
footer p a:hover {<br />
color: #fff;<br />
}<br />
#footer-contact p {<br />
margin-right: 40px;<br />
float: left;<br />
}<br />
#footer-project p {<br />
max-width: 180px;<br />
}<br />
#footer-newsletter {<br />
position: relative;<br />
}<br />
#footer-newsletter p {<br />
position: absolute;<br />
font-size: 11px;<br />
top: 0;<br />
right: 0;<br />
color: #7c7c7c;<br />
}<br />
#footer-newsletter input {<br />
width: 220px;<br />
height: 19px;<br />
background: #202020;<br />
border: 0;<br />
margin: 0;<br />
padding: 10px;<br />
color: #fff;<br />
font-size: 12px;<br />
-webkit-transition: background .3s ease-in-out;<br />
-moz-transition: background .3s ease-in-out;<br />
transition: background .3s ease-in-out;<br />
float: left;<br />
border-radius: 0;<br />
}<br />
#footer-newsletter input:focus {<br />
outline: 0;<br />
background: #333;<br />
}<br />
#footer-newsletter label {<br />
position: absolute;<br />
top: 49px;<br />
left: 10px;<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
}<br />
#footer-newsletter button {<br />
width: 39px;<br />
height: 39px;<br />
text-indent: -99999em;<br />
background: #202020 url(art/btn-arrow.svg) no-repeat center center;<br />
float: right;<br />
-webkit-transition: background .3s ease-in-out;<br />
-moz-transition: background .3s ease-in-out;<br />
transition: background .3s ease-in-out;<br />
}<br />
#footer-newsletter button:hover {<br />
background-color: #333;<br />
}<br />
#footer-final {<br />
margin: 15px auto;<br />
padding-top: 35px;<br />
border-top: 1px solid #313131;<br />
position: relative;<br />
}<br />
#footer-final a, #footer-final a:visited {<br />
color: #aaa;<br />
}<br />
#footer-final a:hover {<br />
color: #fff;<br />
}<br />
#footer-final p {<br />
font-weight: 600;<br />
font-size: 12px;<br />
display: block;<br />
margin: 0;<br />
}<br />
#footer-nav {<br />
text-align: center;<br />
}<br />
#footer-nav a {<br />
margin: 0 8px;<br />
}<br />
#footer-final p#footer-social {<br />
text-align: right;<br />
margin-left: 40px;<br />
}<br />
#footer-social a, #footer-social a:visited {<br />
margin: 0 0 0 16px;<br />
}<br />
.left {<br />
float: left;<br />
}<br />
.right {<br />
float: right;<br />
}<br />
span.error {<br />
color: red;<br />
font-size: 12px;<br />
}<br />
p.success {<br />
background: #009b00;<br />
padding: 5px;<br />
color: #fff;<br />
text-align: center;<br />
font-weight: 600;<br />
border-radius: 3px;<br />
}<br />
p.fail {<br />
background: red;<br />
padding: 5px;<br />
color: #fff;<br />
text-align: center;<br />
font-weight: 600;<br />
border-radius: 3px;<br />
}<br />
.success {<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
}<br />
.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.aligncenter, div.aligncenter {<br />
display: block;<br />
margin: 5px auto 5px auto;<br />
}<br />
.alignright {<br />
float: right;<br />
margin: 5px 0 20px 20px;<br />
}<br />
.alignleft {<br />
float: left;<br />
margin: 5px 20px 20px 0;<br />
}<br />
.aligncenter {<br />
display: block;<br />
margin: 5px auto 5px auto;<br />
}<br />
a img.alignright {<br />
float: right;<br />
margin: 5px 0 20px 20px;<br />
}<br />
a img.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
a img.alignleft {<br />
float: left;<br />
margin: 5px 20px 20px 0;<br />
}<br />
a img.aligncenter {<br />
display: block;<br />
margin-left: auto;<br />
margin-right: auto;<br />
}<br />
.wp-caption {<br />
background: #fff;<br />
border: 1px solid #f0f0f0;<br />
max-width: 96%;<br />
padding: 5px 3px 10px;<br />
text-align: center;<br />
}<br />
.wp-caption.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.wp-caption.alignleft {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.wp-caption.alignright {<br />
margin: 5px 0 20px 20px;<br />
}<br />
.wp-caption img {<br />
border: 0 none;<br />
height: auto;<br />
margin: 0;<br />
max-width: 98.5%;<br />
padding: 0;<br />
width: auto;<br />
}<br />
.wp-caption p.wp-caption-text {<br />
font-size: 11px;<br />
line-height: 17px;<br />
margin: 0;<br />
padding: 0 4px 5px;<br />
}<br />
.cols_2_left, .cols_2_right, .cols_3_left, .cols_3_middle, .cols_3_right {<br />
margin: 0 0 1.5em;<br />
}<br />
.cols_2_left {<br />
float: left;<br />
width: 47%}<br />
.cols_2_right {<br />
float: right;<br />
width: 47%}<br />
.cols_3_left {<br />
float: left;<br />
width: 30%}<br />
.cols_3_middle {<br />
float: left;<br />
width: 30%;<br />
margin-left: 5%}<br />
.cols_3_right {<br />
float: right;<br />
width: 30%}<br />
.container {<br />
position: relative;<br />
width: 1000px;<br />
margin: 0 auto;<br />
padding: 0;<br />
}<br />
.container.short {<br />
width: 940px;<br />
}<br />
.container .column, .container .columns {<br />
float: left;<br />
display: inline;<br />
margin-left: 10px;<br />
margin-right: 10px;<br />
}<br />
.row {<br />
margin-bottom: 20px;<br />
}<br />
.column.alpha, .columns.alpha {<br />
margin-left: 0;<br />
}<br />
.column.omega, .columns.omega {<br />
margin-right: 0;<br />
}<br />
.container .one.column, .container .one.columns {<br />
width: 40px;<br />
}<br />
.container .two.columns {<br />
width: 100px;<br />
}<br />
.container .three.columns {<br />
width: 160px;<br />
}<br />
.container .four.columns {<br />
width: 220px;<br />
}<br />
.container .five.columns {<br />
width: 180px;<br />
}<br />
.container .six.columns {<br />
width: 340px;<br />
}<br />
.container .seven.columns {<br />
width: 400px;<br />
}<br />
.container .eight.columns {<br />
width: 460px;<br />
}<br />
.container .nine.columns {<br />
width: 520px;<br />
}<br />
.container .ten.columns {<br />
width: 580px;<br />
}<br />
.container .eleven.columns {<br />
width: 640px;<br />
}<br />
.container .twelve.columns {<br />
width: 700px;<br />
}<br />
.container .thirteen.columns {<br />
width: 760px;<br />
}<br />
.container .fourteen.columns {<br />
width: 820px;<br />
}<br />
.container .fifteen.columns {<br />
width: 880px;<br />
}<br />
.container .sixteen.columns {<br />
width: 940px;<br />
}<br />
.container .one-third.column {<br />
width: 290px;<br />
}<br />
.container .two-thirds.column {<br />
width: 615px;<br />
}<br />
.container .offset-by-one {<br />
padding-left: 60px;<br />
}<br />
.container .offset-by-two {<br />
padding-left: 120px;<br />
}<br />
.container .offset-by-three {<br />
padding-left: 180px;<br />
}<br />
.container .offset-by-four {<br />
padding-left: 240px;<br />
}<br />
.container .offset-by-five {<br />
padding-left: 300px;<br />
}<br />
.container .offset-by-six {<br />
padding-left: 360px;<br />
}<br />
.container .offset-by-seven {<br />
padding-left: 420px;<br />
}<br />
.container .offset-by-eight {<br />
padding-left: 480px;<br />
}<br />
.container .offset-by-nine {<br />
padding-left: 540px;<br />
}<br />
.container .offset-by-ten {<br />
padding-left: 600px;<br />
}<br />
.container .offset-by-eleven {<br />
padding-left: 660px;<br />
}<br />
.container .offset-by-twelve {<br />
padding-left: 720px;<br />
}<br />
.container .offset-by-thirteen {<br />
padding-left: 780px;<br />
}<br />
.container .offset-by-fourteen {<br />
padding-left: 840px;<br />
}<br />
.container .offset-by-fifteen {<br />
padding-left: 900px;<br />
}<br />
@media only screen and (max-width:1049px) {<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images.two img {<br />
width: 450px;<br />
}<br />
}@media only screen and (min-width:960px) {<br />
#logo {<br />
-webkit-transform-style: preserve-3d;<br />
}<br />
#logo1 {<br />
-webkit-transform-style: preserve-3d;<br />
}<br />
.sticky #logo {<br />
-webkit-transform: scale(.75);<br />
-moz-transform: scale(.75);<br />
-ms-transform: scale(.75);<br />
-o-transform: scale(.75);<br />
transform: scale(.75);<br />
top: 0;<br />
left: -10px;<br />
}<br />
.sticky #logo1 {<br />
-webkit-transform: scale(.75);<br />
-moz-transform: scale(.75);<br />
-ms-transform: scale(.75);<br />
-o-transform: scale(.75);<br />
transform: scale(.75);<br />
top: 0;<br />
right: -1px;<br />
}<br />
<br />
}@media only screen and (min-device-width :768px) and (max-device-width:1024px) and (orientation:landscape) {<br />
#logo {<br />
-webkit-transform-style: flat;<br />
}<br />
#logo1 {<br />
-webkit-transform-style: flat;<br />
}<br />
.sticky #logo {<br />
-webkit-transform: none;<br />
-moz-transform: none;<br />
-ms-transform: none;<br />
-o-transform: none;<br />
transform: none;<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
-webkit-transform: none;<br />
-moz-transform: none;<br />
-ms-transform: none;<br />
-o-transform: none;<br />
transform: none;<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
}@media only screen and (min-width:768px) and (max-width:959px) {<br />
.container {<br />
width: 768px;<br />
}<br />
.container.short {<br />
width: 748px;<br />
}<br />
.container .column, .container .columns {<br />
margin-left: 10px;<br />
margin-right: 10px;<br />
}<br />
.column.alpha, .columns.alpha {<br />
margin-left: 0;<br />
margin-right: 10px;<br />
}<br />
.column.omega, .columns.omega {<br />
margin-right: 0;<br />
margin-left: 10px;<br />
}<br />
.alpha.omega {<br />
margin-left: 0;<br />
margin-right: 0;<br />
}<br />
.container .one.column, .container .one.columns {<br />
width: 28px;<br />
}<br />
.container .two.columns {<br />
width: 76px;<br />
}<br />
.container .three.columns {<br />
width: 124px;<br />
}<br />
.container .four.columns {<br />
width: 172px;<br />
}<br />
.container .five.columns {<br />
width: 220px;<br />
}<br />
.container .six.columns {<br />
width: 268px;<br />
}<br />
.container .seven.columns {<br />
width: 316px;<br />
}<br />
.container .eight.columns {<br />
width: 364px;<br />
}<br />
.container .nine.columns {<br />
width: 412px;<br />
}<br />
.container .ten.columns {<br />
width: 460px;<br />
}<br />
.container .eleven.columns {<br />
width: 508px;<br />
}<br />
.container .twelve.columns {<br />
width: 556px;<br />
}<br />
.container .thirteen.columns {<br />
width: 604px;<br />
}<br />
.container .fourteen.columns {<br />
width: 652px;<br />
}<br />
.container .fifteen.columns {<br />
width: 700px;<br />
}<br />
.container .sixteen.columns {<br />
width: 748px;<br />
}<br />
.container .one-third.column {<br />
width: 236px;<br />
}<br />
.container .two-thirds.column {<br />
width: 492px;<br />
}<br />
.container .offset-by-one {<br />
padding-left: 48px;<br />
}<br />
.container .offset-by-two {<br />
padding-left: 96px;<br />
}<br />
.container .offset-by-three {<br />
padding-left: 144px;<br />
}<br />
.container .offset-by-four {<br />
padding-left: 192px;<br />
}<br />
.container .offset-by-five {<br />
padding-left: 240px;<br />
}<br />
.container .offset-by-six {<br />
padding-left: 288px;<br />
}<br />
.container .offset-by-seven {<br />
padding-left: 336px;<br />
}<br />
.container .offset-by-eight {<br />
padding-left: 384px;<br />
}<br />
.container .offset-by-nine {<br />
padding-left: 432px;<br />
}<br />
.container .offset-by-ten {<br />
padding-left: 480px;<br />
}<br />
.container .offset-by-eleven {<br />
padding-left: 528px;<br />
}<br />
.container .offset-by-twelve {<br />
padding-left: 576px;<br />
}<br />
.container .offset-by-thirteen {<br />
padding-left: 624px;<br />
}<br />
.container .offset-by-fourteen {<br />
padding-left: 672px;<br />
}<br />
.container .offset-by-fifteen {<br />
padding-left: 720px;<br />
}<br />
.sticky #logo {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
nav a {<br />
padding-left: 10px;<br />
padding-right: 10px;<br />
}<br />
#footer-contact {<br />
width: 220px;<br />
}<br />
#footer-newsletter {<br />
float: right;<br />
width: 280px;<br />
}<br />
.mini-post {<br />
width: 236px;<br />
}<br />
.mini-post img {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images img {<br />
width: 100%}<br />
#case-details .images.two img {<br />
width: 350px;<br />
}<br />
#case-details, #meta .container, .single #page-header .container {<br />
padding: 0 10px;<br />
width: 748px;<br />
}<br />
.about .column-text {<br />
padding: 0 15px;<br />
}<br />
#feature h1 {<br />
font-size: 55px;<br />
}<br />
#page-header.case h1 {<br />
font-size: 40px;<br />
line-height: 34px;<br />
}<br />
#page-header.case h2 {<br />
max-width: 40%;<br />
line-height: 24px;<br />
}<br />
#blog-top #categories {<br />
width: 220px;<br />
}<br />
#blog-top form {<br />
width: 340px;<br />
}<br />
#blog-top #rss {<br />
width: 100px;<br />
}<br />
.container .seven.columns {<br />
width: 400px;<br />
}<br />
.single-work #page-header h2, .single-lab #page-header h2 {<br />
font-weight: 500;<br />
font-size: 16px;<br />
line-height: 22px;<br />
}<br />
<br />
footer {<br />
height: auto;<br />
}<br />
#wrap {<br />
margin-bottom: 0;<br />
min-height: 0;<br />
}<br />
.push {<br />
display: none;<br />
}<br />
#copyright, #footer-social {<br />
width: 150px;<br />
margin: 0!important;<br />
}<br />
#location-map {<br />
display: none;<br />
}<br />
#contact {<br />
height: auto;<br />
}<br />
#contact .container {<br />
padding-top: 10px;<br />
}<br />
#contact #contact-details {<br />
float: left;<br />
width: 340px;<br />
}<br />
#contact #message {<br />
float: right;<br />
width: 400px;<br />
}<br />
#footer-nav {<br />
width: 448px;<br />
}<br />
#processes {<br />
margin: 0 30px;<br />
}<br />
.process .text {<br />
padding: 0 15px;<br />
}<br />
.process p {<br />
font-size: 13px;<br />
line-height: 18px;<br />
}<br />
}@media only screen and (max-width:767px) {<br />
.container, .container.short {<br />
width: 300px;<br />
}<br />
.container .columns, .container .column {<br />
margin: 0;<br />
}<br />
.container .one.column, .container .one.columns, .container .two.columns, .container .three.columns, .container .four.columns, .container .five.columns, .container .six.columns, .container .seven.columns, .container .eight.columns, .container .nine.columns, .container .ten.columns, .container .eleven.columns, .container .twelve.columns, .container .thirteen.columns, .container .fourteen.columns, .container .fifteen.columns, .container .sixteen.columns, .container .one-third.column, .container .two-thirds.column {<br />
width: 300px;<br />
}<br />
.container .offset-by-one, .container .offset-by-two, .container .offset-by-three, .container .offset-by-four, .container .offset-by-five, .container .offset-by-six, .container .offset-by-seven, .container .offset-by-eight, .container .offset-by-nine, .container .offset-by-ten, .container .offset-by-eleven, .container .offset-by-twelve, .container .offset-by-thirteen, .container .offset-by-fourteen, .container .offset-by-fifteen {<br />
padding-left: 0;<br />
}<br />
.sticky #logo {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
#feature {<br />
height: 250px;<br />
}<br />
#feature article, #feature ul {<br />
display: none!important;<br />
}<br />
#feature h1 {<br />
top: 100px;<br />
font-size: 36px;<br />
line-height: 42px;<br />
}<br />
#home-content, #home-content .column, .mini-post {<br />
width: auto;<br />
float: none!important;<br />
display: block;<br />
}<br />
#home-content .column {<br />
margin: 0 0 40px;<br />
}<br />
.mini-post {<br />
margin: 0 auto 20px;<br />
width: 290px;<br />
}<br />
#tweet {<br />
padding: 40px 0 0 0;<br />
margin: 40px 0;<br />
width: auto;<br />
}<br />
#tweet .text {<br />
padding: 40px 20px 0;<br />
background-position: center top;<br />
}<br />
nav a {<br />
padding-left: 6px;<br />
padding-right: 6px;<br />
font-size: 12px;<br />
}<br />
<br />
#work article {<br />
width: 30%;<br />
margin: 10px;<br />
}<br />
#work article .image, #work article a img, .labs#work article .image {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images img, #case-details .images.two img {<br />
width: 100%;<br />
margin: 0 0 20px!important;<br />
}<br />
#page-header.case h1 {<br />
font-size: 30px;<br />
line-height: 28px;<br />
max-width: 55%}<br />
#page-header.case h2 {<br />
max-width: 50%;<br />
line-height: 24px;<br />
}<br />
.labs #page-header h1 {<br />
font-size: 46px;<br />
}<br />
#meta p {<br />
float: right;<br />
margin: 0;<br />
}<br />
#meta p:first-child {<br />
width: 50%;<br />
float: left;<br />
}<br />
#work-with-us {<br />
font-size: 18px;<br />
}<br />
#blog-top #categories {<br />
margin-bottom: 15px;<br />
}<br />
#blog-top form {<br />
width: 200px;<br />
}<br />
#blog-top input {<br />
width: 170px;<br />
}<br />
#blog-top #rss {<br />
width: 80px;<br />
float: right;<br />
}<br />
#blog article img {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#blog article {<br />
margin-bottom: 30px;<br />
}<br />
#blog article iframe {<br />
height: 270px;<br />
}<br />
#blog article .post h2 {<br />
font-size: 20px;<br />
line-height: 22px;<br />
}<br />
#blog .share {<br />
display: none;<br />
}<br />
.short-url {<br />
margin-bottom: 5px;<br />
}<br />
.categories {<br />
float: left;<br />
}<br />
.content h2 {<br />
font-size: 30px;<br />
line-height: 38px;<br />
}<br />
.content p {<br />
font-size: 14px;<br />
line-height: 22px;<br />
font-weight: 500;<br />
}<br />
<br />
footer {<br />
height: auto;<br />
}<br />
#wrap {<br />
margin-bottom: 0;<br />
min-height: 0;<br />
}<br />
.push {<br />
display: none;<br />
}<br />
#processes {<br />
margin: 0 20px;<br />
}<br />
.process .text {<br />
padding: 0 10px;<br />
}<br />
.process p {<br />
font-size: 12px;<br />
line-height: 16px;<br />
}<br />
}@media only screen and (min-width:480px) and (max-width:767px) {<br />
.container, .container.short {<br />
width: 420px;<br />
}<br />
.container .columns, .container .column {<br />
margin: 0;<br />
}<br />
.container .one.column, .container .one.columns, .container .two.columns, .container .three.columns, .container .four.columns, .container .five.columns, .container .six.columns, .container .seven.columns, .container .eight.columns, .container .nine.columns, .container .ten.columns, .container .eleven.columns, .container .twelve.columns, .container .thirteen.columns, .container .fourteen.columns, .container .fifteen.columns, .container .sixteen.columns, .container .one-third.column, .container .two-thirds.column {<br />
width: 420px;<br />
}<br />
#footer-newsletter input {<br />
width: 360px;<br />
}<br />
#blog-top form {<br />
width: 300px;<br />
}<br />
#blog-top input {<br />
width: 270px;<br />
}<br />
#blog-top #rss {<br />
width: 100px;<br />
float: right;<br />
}<br />
.categories {<br />
float: right;<br />
}<br />
.column-text {<br />
-moz-column-count: 1;<br />
-webkit-column-count: 1;<br />
column-count: 1;<br />
}<br />
}@media only screen and (min-width:320px) and (max-width:580px) {<br />
#logo, .sticky #logo {<br />
background-position: 0 -80px;<br />
top: 10px;<br />
left: 10px;<br />
}<br />
#logo1, .sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 10px;<br />
right: 1px;<br />
}<br />
header, header.sticky {<br />
height: 100px;<br />
}<br />
.sticky nav, nav {<br />
margin-top: 64px;<br />
}<br />
nav a {<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
}<br />
#feature h1 {<br />
top: 120px;<br />
font-size: 22px;<br />
line-height: 30px;<br />
}<br />
#tweet .text p {<br />
font-size: 20px;<br />
line-height: 24px;<br />
}<br />
#work article {<br />
width: 45%;<br />
margin: 6px;<br />
}<br />
#page-header {<br />
height: 200px;<br />
}<br />
#page-header h1 {<br />
font-size: 34px;<br />
}<br />
.labs #page-header h1 {<br />
font-size: 25px;<br />
}<br />
#page-header.case h2 {<br />
font-size: 16px;<br />
font-weight: 500;<br />
line-height: 20px;<br />
}<br />
#work-with-us {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#work-with-us span {<br />
background-image: none;<br />
}<br />
#contact #message input, #contact #message textarea {<br />
width: 200px;<br />
max-width: 200px;<br />
}<br />
#fresh ul {<br />
display: none;<br />
}<br />
#blog article iframe {<br />
height: 200px;<br />
}<br />
#process {<br />
display: none;<br />
}<br />
}.container:after {<br />
content: "\0020";<br />
display: block;<br />
height: 0;<br />
clear: both;<br />
visibility: hidden;<br />
}</div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Home
Team:Shenzhen BGIC 0101/Home
2013-10-20T08:00:17Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<!-- lazyload --><br />
<br />
<br />
<br />
<br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style_slider?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/jquery?action=raw&ctype=text/javascript"></script><br />
<br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<br />
<br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<style><br />
h3{<br />
font-family: 'Tangerine', serif;<br />
font-size: 45px;<br />
text-shadow: 4px 4px 4px #aaa;<br />
color: #38f;<br />
letter-spacing: 0.1em;<br />
word-spacing: 0.3em;<br />
font-weight: 700;<br />
line-height: 36px;<br />
margin: 0;<br />
}<br />
<br />
.reference{<br />
clear:both;<br />
top:40px;<br />
left:120px;<br />
<br />
font-size: 16px;<br />
line-height: 19px;<br />
font-family: Trebuchet MS;<br />
font-weight: 600;<br />
position:absolute;<br />
text-align:left;<br />
width:48%;<br />
padding:20px;<br />
background-color:#ffe;<br />
-moz-box-shadow:1px 3px 15px #ddd;<br />
-webkit-box-shadow:1px 3px 15px #ddd;<br />
box-shadow:4px 3px 25px #ddd;<br />
}<br />
<br />
ul.accordion{<br />
list-style:none; <br />
position:absolute;<br />
right:150px;<br />
top:0px;<br />
font-family: Cambria, serif;<br />
font-size: 16px;<br />
font-style: italic;<br />
line-height: 1.5em;<br />
}<br />
ul.accordion li{<br />
float:right;<br />
width:115px;<br />
height:480px;<br />
display:block;<br />
border-right:2px solid #fff;<br />
border-bottom:2px solid #fff;<br />
background-color:#fff;<br />
background-repeat:no-repeat;<br />
background-position:center center;<br />
position:relative;<br />
overflow:hidden;<br />
cursor:pointer;<br />
-moz-box-shadow:1px 3px 15px #555;<br />
-webkit-box-shadow:1px 3px 15px #555;<br />
box-shadow:1px 3px 15px #555;<br />
}<br />
ul.accordion li.bg1{<br />
background-image:url(https://static.igem.org/mediawiki/2013/c/c8/Bki-20101209112236-2125207650.jpg);<br />
}<br />
ul.accordion li.bg2{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bg3{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bg4{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bleft{<br />
border-left:2px solid #fff;<br />
}<br />
ul.accordion li .heading{<br />
background-color:#fff;<br />
padding:10px;<br />
margin-top:60px;<br />
opacity:0.9;<br />
text-transform:uppercase;<br />
font-style:normal;<br />
font-weight:bold;<br />
letter-spacing:1px;<br />
font-size:14px;<br />
color:#444;<br />
text-align:center;<br />
text-shadow:-1px -1px 1px #ccc;<br />
}<br />
ul.accordion li .description{<br />
position:absolute;<br />
width:480px;<br />
height:175px;<br />
bottom:0px;<br />
left:0px;<br />
display:none;<br />
}<br />
ul.accordion li .description h2{<br />
text-transform: uppercase;<br />
font-style: normal;<br />
font-weight: bold;<br />
letter-spacing: 1px;<br />
font-size: 25px;<br />
color: #444;<br />
text-align: left;<br />
margin: -15px 0px 0px 20px;<br />
text-shadow: -1px -1px 1px #ccc;<br />
}<br />
ul.accordion li .description p{<br />
line-height:14px;<br />
margin:10px 22px;<br />
font-family: "Trebuchet MS", sans-serif;<br />
font-size: 12px;<br />
font-style: italic;<br />
font-weight: normal;<br />
text-transform: none;<br />
letter-spacing: normal;<br />
line-height: 1.6em;<br />
}<br />
ul.accordion li .description a{<br />
position:absolute;<br />
bottom:5px;<br />
left:20px;<br />
text-transform:uppercase;<br />
font-style:normal;<br />
font-size:11px;<br />
text-decoration:none;<br />
color:#888;<br />
}<br />
ul.accordion li .description a:hover{<br />
color:#333;<br />
text-decoration:underline;<br />
}<br />
<br />
ul.accordion li .bgDescription{<br />
background:transparent url(https://static.igem.org/mediawiki/igem.org/1/15/BgDescription.png) repeat-x top left;<br />
height:340px;<br />
position:absolute;<br />
bottom:0px;<br />
left:0px;<br />
width:100%;<br />
display:none;<br />
}<br />
<br />
.win {<br />
width: 970px;<br />
margin: 50px auto;<br />
}<br />
.win a {<br />
line-height: 180px;<br />
display: block;<br />
margin: 8px;<br />
text-align: center;<br />
float: left;<br />
opacity: 1;<br />
}<br />
.win8 {<br />
margin: 8px;<br />
display: block;<br />
width : 300px;<br />
<br />
float: left;<br />
color: #015;<br />
font-family: Verdana, 'Times New Roman',serif;<br />
font-weight: 300;<br />
font-size: 13px;<br />
}<br />
h4{<br />
font-weight: 600;<br />
font-size: 17px;<br />
<br />
margin :8px;<br />
}<br />
.win8 img{<br />
width : 150px;<br />
}<br />
<br />
</style><br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/jquery?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
<br />
$(document).ready(function() {<br />
$('.win a').hover(function() {<br />
$(this).stop().animate({<br />
opacity: 0.5<br />
}, 300);<br />
}, function() {<br />
$(this).stop().animate({<br />
opacity: 1<br />
}, 300);<br />
});<br />
});<br />
<br />
</script><br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="wrap" style="font-family: Verdana, Geneva, sans-serif;background-color: #ff9;"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav><br />
<a href="https://2013.igem.org/Main_Page" id="logo1">igem</a> <br />
</header><br />
<br />
<br />
<div id="wowslider-container1"><br />
<div class="ws_images"><ul><br />
<li><img src="https://static.igem.org/mediawiki/2013/e/e5/Ggggg.png" alt="1" title="" id="wows1_0" class="lazy" />Genove</li><br />
<li><img src="https://static.igem.org/mediawiki/igem.org/c/c4/Slider2.jpg" alt="2" title="Nucleotide modification" id="wows1_1" class="lazy"/>Nucleotide modification allow users to modify sequence as their wishes by utilizing codon synonomousness.</li><br />
<li><img src="https://static.igem.org/mediawiki/igem.org/9/99/Slider3.jpg" alt="3" title="chromosome" id="wows1_2" class="lazy"/>We can help you creat a new chromosome.</li><br />
<li><img src="https://static.igem.org/mediawiki/2013/0/0a/Slider_4.jpg" alt="4" title="pathway" id="wows1_3" class="lazy"/>Genove can help you design a new pathway.</li><br />
<li><img src="https://static.igem.org/mediawiki/2013/1/1d/Slider_1.jpg" alt="5" title="team" id="wows1_4" class="lazy"/>All members of our team.</li><br />
</ul></div><br />
<div class="ws_bullets"><div><br />
<a href="#" title="1"><img src="https://static.igem.org/mediawiki/2013/b/b2/Little1.jpg" alt="1"/>1</a><br />
<a href="#" title="2"><img src="https://static.igem.org/mediawiki/igem.org/1/17/Little2.jpg" alt="2"/>2</a><br />
<a href="#" title="3"><img src="https://static.igem.org/mediawiki/igem.org/2/2f/Little3.jpg" alt="3"/>3</a><br />
<a href="#" title="4"><img src="https://static.igem.org/mediawiki/2013/c/c0/Little4.jpg" alt="4"/>4</a><br />
<a href="#" title="5"><img src="https://static.igem.org/mediawiki/2013/5/50/Little5.jpg" alt="5"/>5</a><br />
</div></div></div><br />
<br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/wowslider?action=raw&ctype=text/javascript"></script> <br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/script?action=raw&ctype=text/javascript"></script><br />
<br />
<br/><br/><br />
<div class="win"><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/2/21/Lxm_3.png" /></a><h4>Neochr</h4>Construct genome's structure</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/c/c8/NucleoMod.png" /></a><h4>NucleoMod</h4>Modify CDS region</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/b/b2/SegmMan.png" /></a><h4>SegmMan</h4>Split into fragments</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial"><img src="https://static.igem.org/mediawiki/2013/c/ce/X_2.png" /></a><h4>Jbrowse GUI</h4>Operation interface</div><br />
<div class="win8"><a href="http://192.185.29.142/~luxujia/jbrowse_no_git/index.html?data=data/NeoChr/"><img src="https://static.igem.org/mediawiki/2013/4/47/Lxm_2.png" /></a><h4>Web sever</h4>Web version of Genovo</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial"><img src="https://static.igem.org/mediawiki/2013/0/08/Zwz.png" /></a> <h4>Tutorial</h4>Instruction for users</div><br />
</div><br />
<br />
<br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br />
<!-- The JavaScript --><br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1/jquery.min.js"></script><br />
<script type="text/javascript"><br />
$(function() {<br />
$('#accordion > li').hover(<br />
function () {<br />
var $this = $(this);<br />
$this.stop().animate({'width':'480px'},500);<br />
$('.heading',$this).stop(true,true).fadeOut();<br />
$('.bgDescription',$this).stop(true,true).slideDown(500);<br />
$('.description',$this).stop(true,true).fadeIn();<br />
},<br />
function () {<br />
var $this = $(this);<br />
$this.stop().animate({'width':'115px'},1000);<br />
$('.heading',$this).stop(true,true).fadeIn();<br />
$('.description',$this).stop(true,true).fadeOut(500);<br />
$('.bgDescription',$this).stop(true,true).slideUp(700);<br />
}<br />
);<br />
});<br />
</script><br />
<br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<br />
<footer><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.cn">gongjianhui@genomics.cn</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="http://www.humaan.com.au/wp-content/themes/humaan/js/scripts.min.js" type="text/javascript"></script><br />
<br />
<br />
</body><br />
</html><br />
{{Scroll}}</div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/style
Team:Shenzhen BGIC 0101/style
2013-10-20T07:57:33Z
<p>Czh: </p>
<hr />
<div>@font-face {<br />
font-family: 'Tangerine';<br />
font-style: normal;<br />
font-weight: 400;<br />
src: local('Tangerine'), url(http://themes.googleusercontent.com/static/fonts/tangerine/v3/HGfsyCL5WASpHOFnouG-RD8E0i7KZn-EPnyo3HZu7kw.woff) format('woff');<br />
}<br />
<br />
html, body, div, span, applet, object, iframe, h1, h2, h3, h4, h5, h6, p, blockquote, pre, a, abbr, acronym, address, big, cite, code, del, dfn, em, img, ins, kbd, q, s, samp, small, strike, strong, sub, sup, tt, var, b, u, i, center, dl, dt, dd, ol, ul, li, fieldset, form, label, legend, table, caption, tbody, tfoot, thead, tr, th, td, article, aside, canvas, details, embed, figure, figcaption, footer, header, hgroup, menu, nav, output, ruby, section, summary, time, mark, audio, video {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-size: 100%;<br />
font: inherit;<br />
vertical-align: baseline;<br />
letter-spacing: 0.05em;<br />
}<br />
article, aside, details, figcaption, figure, footer, header, hgroup, menu, nav, section {<br />
display: block;<br />
}<br />
body {<br />
line-height: 1;<br />
}<br />
ol, ul {<br />
list-style: none;<br />
}<br />
<br />
p, ul, ol {<br />
margin: 0 0 0px; <br />
<br />
}<br />
ul, ol {<br />
padding: 1.5em 0 0 2.5em;<br />
}<br />
<br />
<br />
body {<br />
/* background: #f2f2f2;*/<br />
background: #262626;<br />
font-family: "proxima-nova", "HelveticaNeue", "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
font-size: 14px;<br />
line-height: 21px;<br />
color: #262626;<br />
-webkit-font-smoothing: antialiased;<br />
-webkit-text-size-adjust: 100%}<br />
html, body {<br />
height: 100%}<br />
#wrap {<br />
//background: url(https://static.igem.org/mediawiki/2013/f/f4/Gene.jpg) no-repeat fixed;<br />
background-size:cover;<br />
margin-bottom: -245px;<br />
min-height: 100%;<br />
height: auto!important;<br />
height: 100%}<br />
.push {<br />
height: 245px;<br />
}<br />
p img {<br />
margin: 0;<br />
}<br />
em {<br />
font-style: italic;<br />
}<br />
strong {<br />
font-weight: bold;<br />
}<br />
hr {<br />
border: solid #ddd;<br />
border-width: 1px 0 0;<br />
clear: both;<br />
margin: 10px 0 30px;<br />
height: 0;<br />
}<br />
a, a:visited {<br />
color: #666;<br />
text-decoration: none;<br />
outline: 0;<br />
}<br />
a:hover, a:focus {<br />
color: #333;<br />
}<br />
p a, p a:visited {<br />
line-height: inherit;<br />
}<br />
img.scale-with-grid {<br />
max-width: 100%;<br />
height: auto;<br />
}<br />
<br />
header {<br />
width: 100%;<br />
height: 90px;<br />
background: #222;<br />
background: rgba(0, 0, 0, .2);<br />
border-color: #fff;<br />
border-bottom: 1px solid rgba(255, 255, 255, .25);<br />
position: fixed;<br />
top: 0;<br />
z-index: 10;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
-ms-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
}<br />
header.sticky {<br />
height: 60px;<br />
background: #993399;<br />
border: 0;<br />
box-shadow: 0 1px 6px rgba(0, 0, 0, .2);<br />
}<br />
header h1 {<br />
margin: 0;<br />
}<br />
#logo {<br />
width: 84px;<br />
height: 59px;<br />
display: block;<br />
background: url(https://static.igem.org/mediawiki/igem.org/e/e8/Genovo-logo.png) no-repeat;<br />
text-indent: -99999em;<br />
position: absolute;<br />
top: 15px;<br />
left: 15px;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
}<br />
#logo1{<br />
width: 80px;<br />
height: 60px;<br />
display: block;<br />
background: url(https://static.igem.org/mediawiki/2013/d/dd/Igem_logo12.png) no-repeat;<br />
text-indent: -99999em;<br />
position: absolute;<br />
top: 15px;<br />
right: 10px;<br />
-webkit-transition: all .2s ease-in-out;<br />
-moz-transition: all .2s ease-in-out;<br />
transition: all .2s ease-in-out;<br />
z-index:9999;<br />
}<br />
nav {<br />
text-align: center;<br />
margin-top: 35px;<br />
-webkit-transition: margin .2s ease-in-out;<br />
-moz-transition: margin .2s ease-in-out;<br />
transition: margin .2s ease-in-out;<br />
}<br />
.sticky nav {<br />
margin-top: 20px;<br />
}<br />
nav a, #start-project {<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
color: #555;<br />
text-shadow: 0 1px 0 #fff;<br />
padding: 16px;<br />
font-size: 14px;<br />
}<br />
.light nav a {<br />
color: #ddd;/* top-nav color */<br />
text-shadow: 0 1px 0 rgba(0, 0, 0, .5);<br />
opacity: .5;<br />
-webkit-transition: opacity .1s linear;<br />
-moz-transition: opacity .1s linear;<br />
transition: opacity .1s linear;<br />
}<br />
nav a.current-menu-item, nav a.current_page_parent, nav a:hover, .single-work .light nav a.menu-item-18, .single-lab .light nav a.menu-item-17, .single-post .light nav a.menu-item-16 {<br />
opacity: 1;<br />
}<br />
.single-work nav a.current_page_parent, .single-lab nav a.current_page_parent {<br />
opacity: .5;<br />
}<br />
#blog {<br />
z-index: 6;<br />
}<br />
#blog article {<br />
margin: 10px auto 60px;<br />
max-width: 700px;<br />
position: relative;<br />
}<br />
<br />
<br />
#home-content h2, #fresh h2, h2.section-title {<br />
color: #358;<br />
font-size: 12px;<br />
text-shadow: 0 1px 0 #fff;<br />
font-weight: 600;<br />
width: 150px;<br />
background: #aaa;<br />
margin: -20px auto 20px;<br />
text-align: center;<br />
}<br />
#home-content .column, #fresh {<br />
border-top: 1px solid #d0d0d0;<br />
}<br />
#home-content .one-third {<br />
float: right!important;<br />
}<br />
.mini-post {<br />
float: left;<br />
background: #fff;<br />
box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
border-radius: 2px;<br />
overflow: hidden;<br />
width: 290px;<br />
-webkit-transition: all .2s ease-out;<br />
-moz-transition: all .2s ease-out;<br />
transition: all .2s ease-out;<br />
color: #333;<br />
min-height: 320px;<br />
cursor: pointer;<br />
}<br />
.mini-post:hover {<br />
margin-top: -5px;<br />
box-shadow: 0 3px 3px 0 rgba(0, 0, 0, .4);<br />
}<br />
.mini-post .text {<br />
padding: 20px 20px 10px;<br />
}<br />
.mini-post h3 {<br />
font-size: 16px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
margin: 0;<br />
}<br />
.mini-post .meta {<br />
font-size: 11px;<br />
}<br />
.mini-post p {<br />
font-size: 13px;<br />
}<br />
.mini-post .more {<br />
font-weight: 600;<br />
}<br />
#tweet {<br />
margin: 40px auto;<br />
padding-top: 40px;<br />
border-top: 1px solid #d0d0d0;<br />
}<br />
#tweet .text {<br />
padding: 0 90px;<br />
background: url(art/bird.svg) no-repeat 35px 0;<br />
font-size: 26px;<br />
font-weight: 300;<br />
}<br />
#tweet .text p {<br />
margin: 0 0 10px;<br />
text-align: center;<br />
line-height: 36px;<br />
}<br />
#tweet .text p.author {<br />
font-size: 20px;<br />
}<br />
#page-header {<br />
width: auto;<br />
// height: 220px;<br />
//background: url(https://static.igem.org/mediawiki/2013/3/34/Test-head.jpg) top center;<br />
margin: 0 0 35px;<br />
box-shadow: 2px 1px 12px #272727;<br />
<br />
}<br />
.wf-loading #page-header h1 {<br />
visibility: hidden;<br />
}<br />
<br />
.blog #page-header {<br />
// background: url(https://static.igem.org/mediawiki/2013/3/34/Test-head.jpg) top center;<br />
}<br />
#page-header h1 {<br />
font-family: "abril-fatface", 'Adobe Garamond', 'Garamond', serif;<br />
color: #fff;<br />
text-align: center;<br />
padding: 130px 0 0 0;<br />
text-shadow: 0 2px 0 #000;<br />
font-size: 60px;<br />
}<br />
#blog {<br />
z-index: 6;<br />
}<br />
#blog article {<br />
margin: 10px auto 60px;<br />
max-width: 1200px;<br />
position: relative;<br />
}<br />
#blog article .post {<br />
background: #fff;<br />
// box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
box-shadow: 2px 1px 6px #272727;<br />
border-radius: 2px;<br />
overflow: hidden;<br />
color: #333;<br />
margin: 0 0 15px;<br />
}<br />
#blog article .post .text {<br />
padding: 20px 20px 10px;<br />
}<br />
.post-content a {<br />
color: #2683a5;<br />
}<br />
.post-content a:hover {<br />
color: #4ea9a2; <br />
}<br />
#blog article .post h2 {<br />
font-family: 'Tangerine', serif;<br />
font-size: 48px;<br />
text-shadow: 4px 4px 4px #aaa;<br />
color: #38f;<br />
letter-spacing: 0.1em;<br />
word-spacing: 0.3em;<br />
font-weight: 700;<br />
line-height: 36px;<br />
margin: 0;<br />
}<br />
#blog article .post h3 {<br />
font-size: 14px;<br />
line-height: 18px;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
}<br />
#blog article .post .meta {<br />
font-size: 11px;<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
}<br />
#blog article .post p {<br />
font-size: 16px;<br />
line-height: 19px;<br />
font-family: Trebuchet MS;<br />
font-weight: 600;<br />
}<br />
.short-url, .share, .categories {<br />
background: #eaeaea left center no-repeat;<br />
border-radius: 2px;<br />
border-bottom: 1px solid #fff;<br />
border-top: 1px solid #d0d0d0;<br />
float: left;<br />
margin: 0 20px 0 0;<br />
padding: 4px 15px 4px 35px;<br />
font-size: 11px;<br />
color: #666;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
text-shadow: 0 1px 0 #fff;<br />
-webkit-transition: all .2s ease-out;<br />
-moz-transition: all .2s ease-out;<br />
transition: all .2s ease-out;<br />
}<br />
.addthis_toolbox {<br />
display: none;<br />
padding: 0 20px 20px;<br />
}<br />
.short-url:hover, .share:hover {<br />
background-color: #ddd;<br />
border-top: 1px solid #aaa;<br />
}<br />
<br />
#blog article.quote {<br />
max-width: 940px;<br />
}<br />
#blog article.quote .quote-content {<br />
background: #676767;<br />
padding: 30px;<br />
border-radius: 3px;<br />
border-top: #111 1px solid;<br />
border-bottom: #fff 1px solid;<br />
margin: 0 0 15px;<br />
}<br />
#blog article.quote .quote-content p {<br />
font-size: 26px;<br />
line-height: 32px;<br />
color: #eee;<br />
font-weight: 300;<br />
}<br />
#blog article.quote p.ref {<br />
color: #fff;<br />
padding: 0;<br />
margin: 0;<br />
}<br />
#blog article.quote .quote-content a {<br />
color: #fff;<br />
text-decoration: underline;<br />
}<br />
#blog-pagination {<br />
display: block;<br />
text-align: center;<br />
margin: 35px 0;<br />
}<br />
.wp-paginate {<br />
display: inline-block;<br />
padding: 0;<br />
box-shadow: 0 1px 1px 0 rgba(0, 0, 0, .4);<br />
border-radius: 3px;<br />
}<br />
.wp-paginate li {<br />
padding: 0!important;<br />
display: inline-block;<br />
background-image: none!important;<br />
background-color: #fff;<br />
margin: 0;<br />
float: left;<br />
}<br />
.wp-paginate a, .wp-paginate .page.current {<br />
color: #333;<br />
padding: 10px 13px;<br />
display: inline-block;<br />
margin-bottom: 0!important;<br />
min-width: 10px;<br />
border-right: 1px solid #eee;<br />
font-size: 12px;<br />
font-weight: 600;<br />
text-transform: uppercase;<br />
-webkit-transition: all .1s ease-in-out;<br />
-moz-transition: all .1s ease-in-out;<br />
transition: all .1s ease-in-out;<br />
}<br />
.wp-paginate span {<br />
margin-bottom: 0!important;<br />
}<br />
.wp-paginate a.next {<br />
border-left: 0;<br />
}<br />
.wp-paginate .page {<br />
margin: 0;<br />
}<br />
.wp-paginate .page.current {<br />
background-color: #fafafa;<br />
color: #888;<br />
}<br />
.wp-paginate a:hover {<br />
background: #555;<br />
color: #fff;<br />
border-right: 1px solid #555;<br />
}<br />
#disqus_thread {<br />
margin: 10px auto 35px!important;<br />
max-width: 660px;<br />
position: relative;<br />
background: #eaeaea;<br />
border-radius: 2px;<br />
border-bottom: 1px solid #fff;<br />
border-top: 1px solid #d0d0d0;<br />
color: #1a1a1a;<br />
padding: 20px;<br />
font-size: 12px;<br />
}<br />
#disqus_thread h3 {<br />
font-size: 14px;<br />
text-transform: uppercase;<br />
text-shadow: 0 1px 0 #fff;<br />
font-weight: 600;<br />
}<br />
#contact {<br />
position: relative;<br />
height: 940px;<br />
}<br />
#location-map {<br />
width: 100%;<br />
height: 940px;<br />
display: block;<br />
position: absolute;<br />
top: 0;<br />
}<br />
#contact .container {<br />
padding-top: 60px;<br />
}<br />
#contact #contact-details, #contact #message {<br />
background: #262626;<br />
float: none;<br />
display: block;<br />
margin: 0 0 35px;<br />
box-shadow: 0 0 25px 0 rgba(0, 0, 0, .25);<br />
}<br />
#phone-address, #work-planner {<br />
padding: 30px 40px;<br />
}<br />
#phone-address {<br />
border-bottom: 1px solid #565656;<br />
}<br />
#phone-address p, #work-planner h2, #message h2 {<br />
text-transform: uppercase;<br />
color: #fff;<br />
font-weight: 600;<br />
font-size: 14px;<br />
}<br />
#phone-address p {<br />
padding-left: 35px;<br />
}<br />
#phone-address p#phone {<br />
background: url(art/phone.png) no-repeat 2px 2px;<br />
}<br />
#phone-address p#address {<br />
background: url(art/map.png) no-repeat 2px 2px;<br />
margin: 0;<br />
}<br />
#work-planner h2, #message h2 {<br />
margin: 0 0 10px;<br />
line-height: normal;<br />
}<br />
#work-planner p {<br />
color: #9c9c9c;<br />
font-size: 13px;<br />
font-weight: 600;<br />
}<br />
#work-planner a {<br />
padding: 12px 40px 12px 12px;<br />
color: #fff;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
font-size: 12px;<br />
background: #ce462b url(art/get-started-arrow.png) no-repeat right center;<br />
margin: 0 0 10px;<br />
display: block;<br />
width: 128px;<br />
-webkit-transition: background-color .2s ease-in-out;<br />
-moz-transition: background-color .2s ease-in-out;<br />
transition: background-color .2s ease-in-out;<br />
}<br />
#work-planner a:hover {<br />
background-color: #4ea9a2;<br />
}<br />
#contact #message .wrapper {<br />
padding: 30px 40px;<br />
}<br />
#contact #message .field {<br />
display: block;<br />
position: relative;<br />
margin: 0 0 15px;<br />
}<br />
#contact #message label {<br />
position: absolute;<br />
top: 9px;<br />
left: 11px;<br />
color: #aaa;<br />
font-size: 13px;<br />
font-weight: 500;<br />
}<br />
#contact #message input, #contact #message textarea {<br />
width: 300px;<br />
max-width: 300px;<br />
background: #000;<br />
border: 0;<br />
border-bottom: 1px solid #373737;<br />
width: 100%;<br />
color: #ddd;<br />
font-size: 13px;<br />
font-weight: 500;<br />
padding: 8px 10px;<br />
}<br />
#contact #message textarea {<br />
height: 80px;<br />
}<br />
#contact #message input:focus, #contact #message textarea:focus {<br />
background: #111;<br />
outline: 0;<br />
}<br />
#contact #message button {<br />
padding: 14px 40px 14px 12px;<br />
color: #fff;<br />
text-transform: uppercase;<br />
font-weight: 700;<br />
text-align: left;<br />
font-size: 12px;<br />
background: #343434 url(art/message-arrow.png) no-repeat right center;<br />
display: block;<br />
margin: 0;<br />
width: 180px;<br />
-webkit-transition: background-color .2s ease-in-out;<br />
-moz-transition: background-color .2s ease-in-out;<br />
transition: background-color .2s ease-in-out;<br />
font-family: "proxima-nova", "HelveticaNeue", "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
}<br />
#contact #message button:hover {<br />
background-color: #666;<br />
}<br />
.contact footer {<br />
margin: 0;<br />
}<br />
footer {<br />
padding: 35px 0 20px;<br />
background: #101010;<br />
height: 190px;<br />
box-shadow: 4px 3px 25px #000;<br />
}<br />
footer h3 {<br />
font-size: 13px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
color: #fff;<br />
text-transform: uppercase;<br />
margin: 0 0 20px;<br />
}<br />
footer p {<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
line-height: 20px;<br />
font-weight: 600;<br />
}<br />
footer p a, footer p a:visited, footer p span {<br />
color: #dedede;<br />
}<br />
footer p a:hover {<br />
color: #fff;<br />
}<br />
#footer-contact p {<br />
margin-right: 40px;<br />
float: left;<br />
}<br />
#footer-project p {<br />
max-width: 180px;<br />
}<br />
#footer-newsletter {<br />
position: relative;<br />
}<br />
#footer-newsletter p {<br />
position: absolute;<br />
font-size: 11px;<br />
top: 0;<br />
right: 0;<br />
color: #7c7c7c;<br />
}<br />
#footer-newsletter input {<br />
width: 220px;<br />
height: 19px;<br />
background: #202020;<br />
border: 0;<br />
margin: 0;<br />
padding: 10px;<br />
color: #fff;<br />
font-size: 12px;<br />
-webkit-transition: background .3s ease-in-out;<br />
-moz-transition: background .3s ease-in-out;<br />
transition: background .3s ease-in-out;<br />
float: left;<br />
border-radius: 0;<br />
}<br />
#footer-newsletter input:focus {<br />
outline: 0;<br />
background: #333;<br />
}<br />
#footer-newsletter label {<br />
position: absolute;<br />
top: 49px;<br />
left: 10px;<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
}<br />
#footer-newsletter button {<br />
width: 39px;<br />
height: 39px;<br />
text-indent: -99999em;<br />
background: #202020 url(art/btn-arrow.svg) no-repeat center center;<br />
float: right;<br />
-webkit-transition: background .3s ease-in-out;<br />
-moz-transition: background .3s ease-in-out;<br />
transition: background .3s ease-in-out;<br />
}<br />
#footer-newsletter button:hover {<br />
background-color: #333;<br />
}<br />
#footer-final {<br />
margin: 15px auto;<br />
padding-top: 35px;<br />
border-top: 1px solid #313131;<br />
position: relative;<br />
}<br />
#footer-final a, #footer-final a:visited {<br />
color: #aaa;<br />
}<br />
#footer-final a:hover {<br />
color: #fff;<br />
}<br />
#footer-final p {<br />
font-weight: 600;<br />
font-size: 12px;<br />
display: block;<br />
margin: 0;<br />
}<br />
#footer-nav {<br />
text-align: center;<br />
}<br />
#footer-nav a {<br />
margin: 0 8px;<br />
}<br />
#footer-final p#footer-social {<br />
text-align: right;<br />
margin-left: 40px;<br />
}<br />
#footer-social a, #footer-social a:visited {<br />
margin: 0 0 0 16px;<br />
}<br />
.left {<br />
float: left;<br />
}<br />
.right {<br />
float: right;<br />
}<br />
span.error {<br />
color: red;<br />
font-size: 12px;<br />
}<br />
p.success {<br />
background: #009b00;<br />
padding: 5px;<br />
color: #fff;<br />
text-align: center;<br />
font-weight: 600;<br />
border-radius: 3px;<br />
}<br />
p.fail {<br />
background: red;<br />
padding: 5px;<br />
color: #fff;<br />
text-align: center;<br />
font-weight: 600;<br />
border-radius: 3px;<br />
}<br />
.success {<br />
color: #a5a5a5;<br />
font-size: 12px;<br />
}<br />
.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.aligncenter, div.aligncenter {<br />
display: block;<br />
margin: 5px auto 5px auto;<br />
}<br />
.alignright {<br />
float: right;<br />
margin: 5px 0 20px 20px;<br />
}<br />
.alignleft {<br />
float: left;<br />
margin: 5px 20px 20px 0;<br />
}<br />
.aligncenter {<br />
display: block;<br />
margin: 5px auto 5px auto;<br />
}<br />
a img.alignright {<br />
float: right;<br />
margin: 5px 0 20px 20px;<br />
}<br />
a img.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
a img.alignleft {<br />
float: left;<br />
margin: 5px 20px 20px 0;<br />
}<br />
a img.aligncenter {<br />
display: block;<br />
margin-left: auto;<br />
margin-right: auto;<br />
}<br />
.wp-caption {<br />
background: #fff;<br />
border: 1px solid #f0f0f0;<br />
max-width: 96%;<br />
padding: 5px 3px 10px;<br />
text-align: center;<br />
}<br />
.wp-caption.alignnone {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.wp-caption.alignleft {<br />
margin: 5px 20px 20px 0;<br />
}<br />
.wp-caption.alignright {<br />
margin: 5px 0 20px 20px;<br />
}<br />
.wp-caption img {<br />
border: 0 none;<br />
height: auto;<br />
margin: 0;<br />
max-width: 98.5%;<br />
padding: 0;<br />
width: auto;<br />
}<br />
.wp-caption p.wp-caption-text {<br />
font-size: 11px;<br />
line-height: 17px;<br />
margin: 0;<br />
padding: 0 4px 5px;<br />
}<br />
.cols_2_left, .cols_2_right, .cols_3_left, .cols_3_middle, .cols_3_right {<br />
margin: 0 0 1.5em;<br />
}<br />
.cols_2_left {<br />
float: left;<br />
width: 47%}<br />
.cols_2_right {<br />
float: right;<br />
width: 47%}<br />
.cols_3_left {<br />
float: left;<br />
width: 30%}<br />
.cols_3_middle {<br />
float: left;<br />
width: 30%;<br />
margin-left: 5%}<br />
.cols_3_right {<br />
float: right;<br />
width: 30%}<br />
.container {<br />
position: relative;<br />
width: 1000px;<br />
margin: 0 auto;<br />
padding: 0;<br />
}<br />
.container.short {<br />
width: 940px;<br />
}<br />
.container .column, .container .columns {<br />
float: left;<br />
display: inline;<br />
margin-left: 10px;<br />
margin-right: 10px;<br />
}<br />
.row {<br />
margin-bottom: 20px;<br />
}<br />
.column.alpha, .columns.alpha {<br />
margin-left: 0;<br />
}<br />
.column.omega, .columns.omega {<br />
margin-right: 0;<br />
}<br />
.container .one.column, .container .one.columns {<br />
width: 40px;<br />
}<br />
.container .two.columns {<br />
width: 100px;<br />
}<br />
.container .three.columns {<br />
width: 160px;<br />
}<br />
.container .four.columns {<br />
width: 220px;<br />
}<br />
.container .five.columns {<br />
width: 180px;<br />
}<br />
.container .six.columns {<br />
width: 340px;<br />
}<br />
.container .seven.columns {<br />
width: 400px;<br />
}<br />
.container .eight.columns {<br />
width: 460px;<br />
}<br />
.container .nine.columns {<br />
width: 520px;<br />
}<br />
.container .ten.columns {<br />
width: 580px;<br />
}<br />
.container .eleven.columns {<br />
width: 640px;<br />
}<br />
.container .twelve.columns {<br />
width: 700px;<br />
}<br />
.container .thirteen.columns {<br />
width: 760px;<br />
}<br />
.container .fourteen.columns {<br />
width: 820px;<br />
}<br />
.container .fifteen.columns {<br />
width: 880px;<br />
}<br />
.container .sixteen.columns {<br />
width: 940px;<br />
}<br />
.container .one-third.column {<br />
width: 290px;<br />
}<br />
.container .two-thirds.column {<br />
width: 615px;<br />
}<br />
.container .offset-by-one {<br />
padding-left: 60px;<br />
}<br />
.container .offset-by-two {<br />
padding-left: 120px;<br />
}<br />
.container .offset-by-three {<br />
padding-left: 180px;<br />
}<br />
.container .offset-by-four {<br />
padding-left: 240px;<br />
}<br />
.container .offset-by-five {<br />
padding-left: 300px;<br />
}<br />
.container .offset-by-six {<br />
padding-left: 360px;<br />
}<br />
.container .offset-by-seven {<br />
padding-left: 420px;<br />
}<br />
.container .offset-by-eight {<br />
padding-left: 480px;<br />
}<br />
.container .offset-by-nine {<br />
padding-left: 540px;<br />
}<br />
.container .offset-by-ten {<br />
padding-left: 600px;<br />
}<br />
.container .offset-by-eleven {<br />
padding-left: 660px;<br />
}<br />
.container .offset-by-twelve {<br />
padding-left: 720px;<br />
}<br />
.container .offset-by-thirteen {<br />
padding-left: 780px;<br />
}<br />
.container .offset-by-fourteen {<br />
padding-left: 840px;<br />
}<br />
.container .offset-by-fifteen {<br />
padding-left: 900px;<br />
}<br />
@media only screen and (max-width:1049px) {<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images.two img {<br />
width: 450px;<br />
}<br />
}@media only screen and (min-width:960px) {<br />
#logo {<br />
-webkit-transform-style: preserve-3d;<br />
}<br />
#logo1 {<br />
-webkit-transform-style: preserve-3d;<br />
}<br />
.sticky #logo {<br />
-webkit-transform: scale(.75);<br />
-moz-transform: scale(.75);<br />
-ms-transform: scale(.75);<br />
-o-transform: scale(.75);<br />
transform: scale(.75);<br />
top: 0;<br />
left: -10px;<br />
}<br />
.sticky #logo1 {<br />
-webkit-transform: scale(.75);<br />
-moz-transform: scale(.75);<br />
-ms-transform: scale(.75);<br />
-o-transform: scale(.75);<br />
transform: scale(.75);<br />
top: 0;<br />
right: -1px;<br />
}<br />
<br />
}@media only screen and (min-device-width :768px) and (max-device-width:1024px) and (orientation:landscape) {<br />
#logo {<br />
-webkit-transform-style: flat;<br />
}<br />
#logo1 {<br />
-webkit-transform-style: flat;<br />
}<br />
.sticky #logo {<br />
-webkit-transform: none;<br />
-moz-transform: none;<br />
-ms-transform: none;<br />
-o-transform: none;<br />
transform: none;<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
-webkit-transform: none;<br />
-moz-transform: none;<br />
-ms-transform: none;<br />
-o-transform: none;<br />
transform: none;<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
}@media only screen and (min-width:768px) and (max-width:959px) {<br />
.container {<br />
width: 768px;<br />
}<br />
.container.short {<br />
width: 748px;<br />
}<br />
.container .column, .container .columns {<br />
margin-left: 10px;<br />
margin-right: 10px;<br />
}<br />
.column.alpha, .columns.alpha {<br />
margin-left: 0;<br />
margin-right: 10px;<br />
}<br />
.column.omega, .columns.omega {<br />
margin-right: 0;<br />
margin-left: 10px;<br />
}<br />
.alpha.omega {<br />
margin-left: 0;<br />
margin-right: 0;<br />
}<br />
.container .one.column, .container .one.columns {<br />
width: 28px;<br />
}<br />
.container .two.columns {<br />
width: 76px;<br />
}<br />
.container .three.columns {<br />
width: 124px;<br />
}<br />
.container .four.columns {<br />
width: 172px;<br />
}<br />
.container .five.columns {<br />
width: 220px;<br />
}<br />
.container .six.columns {<br />
width: 268px;<br />
}<br />
.container .seven.columns {<br />
width: 316px;<br />
}<br />
.container .eight.columns {<br />
width: 364px;<br />
}<br />
.container .nine.columns {<br />
width: 412px;<br />
}<br />
.container .ten.columns {<br />
width: 460px;<br />
}<br />
.container .eleven.columns {<br />
width: 508px;<br />
}<br />
.container .twelve.columns {<br />
width: 556px;<br />
}<br />
.container .thirteen.columns {<br />
width: 604px;<br />
}<br />
.container .fourteen.columns {<br />
width: 652px;<br />
}<br />
.container .fifteen.columns {<br />
width: 700px;<br />
}<br />
.container .sixteen.columns {<br />
width: 748px;<br />
}<br />
.container .one-third.column {<br />
width: 236px;<br />
}<br />
.container .two-thirds.column {<br />
width: 492px;<br />
}<br />
.container .offset-by-one {<br />
padding-left: 48px;<br />
}<br />
.container .offset-by-two {<br />
padding-left: 96px;<br />
}<br />
.container .offset-by-three {<br />
padding-left: 144px;<br />
}<br />
.container .offset-by-four {<br />
padding-left: 192px;<br />
}<br />
.container .offset-by-five {<br />
padding-left: 240px;<br />
}<br />
.container .offset-by-six {<br />
padding-left: 288px;<br />
}<br />
.container .offset-by-seven {<br />
padding-left: 336px;<br />
}<br />
.container .offset-by-eight {<br />
padding-left: 384px;<br />
}<br />
.container .offset-by-nine {<br />
padding-left: 432px;<br />
}<br />
.container .offset-by-ten {<br />
padding-left: 480px;<br />
}<br />
.container .offset-by-eleven {<br />
padding-left: 528px;<br />
}<br />
.container .offset-by-twelve {<br />
padding-left: 576px;<br />
}<br />
.container .offset-by-thirteen {<br />
padding-left: 624px;<br />
}<br />
.container .offset-by-fourteen {<br />
padding-left: 672px;<br />
}<br />
.container .offset-by-fifteen {<br />
padding-left: 720px;<br />
}<br />
.sticky #logo {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
nav a {<br />
padding-left: 10px;<br />
padding-right: 10px;<br />
}<br />
#footer-contact {<br />
width: 220px;<br />
}<br />
#footer-newsletter {<br />
float: right;<br />
width: 280px;<br />
}<br />
.mini-post {<br />
width: 236px;<br />
}<br />
.mini-post img {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images img {<br />
width: 100%}<br />
#case-details .images.two img {<br />
width: 350px;<br />
}<br />
#case-details, #meta .container, .single #page-header .container {<br />
padding: 0 10px;<br />
width: 748px;<br />
}<br />
.about .column-text {<br />
padding: 0 15px;<br />
}<br />
#feature h1 {<br />
font-size: 55px;<br />
}<br />
#page-header.case h1 {<br />
font-size: 40px;<br />
line-height: 34px;<br />
}<br />
#page-header.case h2 {<br />
max-width: 40%;<br />
line-height: 24px;<br />
}<br />
#blog-top #categories {<br />
width: 220px;<br />
}<br />
#blog-top form {<br />
width: 340px;<br />
}<br />
#blog-top #rss {<br />
width: 100px;<br />
}<br />
.container .seven.columns {<br />
width: 400px;<br />
}<br />
.single-work #page-header h2, .single-lab #page-header h2 {<br />
font-weight: 500;<br />
font-size: 16px;<br />
line-height: 22px;<br />
}<br />
<br />
footer {<br />
height: auto;<br />
}<br />
#wrap {<br />
margin-bottom: 0;<br />
min-height: 0;<br />
}<br />
.push {<br />
display: none;<br />
}<br />
#copyright, #footer-social {<br />
width: 150px;<br />
margin: 0!important;<br />
}<br />
#location-map {<br />
display: none;<br />
}<br />
#contact {<br />
height: auto;<br />
}<br />
#contact .container {<br />
padding-top: 10px;<br />
}<br />
#contact #contact-details {<br />
float: left;<br />
width: 340px;<br />
}<br />
#contact #message {<br />
float: right;<br />
width: 400px;<br />
}<br />
#footer-nav {<br />
width: 448px;<br />
}<br />
#processes {<br />
margin: 0 30px;<br />
}<br />
.process .text {<br />
padding: 0 15px;<br />
}<br />
.process p {<br />
font-size: 13px;<br />
line-height: 18px;<br />
}<br />
}@media only screen and (max-width:767px) {<br />
.container, .container.short {<br />
width: 300px;<br />
}<br />
.container .columns, .container .column {<br />
margin: 0;<br />
}<br />
.container .one.column, .container .one.columns, .container .two.columns, .container .three.columns, .container .four.columns, .container .five.columns, .container .six.columns, .container .seven.columns, .container .eight.columns, .container .nine.columns, .container .ten.columns, .container .eleven.columns, .container .twelve.columns, .container .thirteen.columns, .container .fourteen.columns, .container .fifteen.columns, .container .sixteen.columns, .container .one-third.column, .container .two-thirds.column {<br />
width: 300px;<br />
}<br />
.container .offset-by-one, .container .offset-by-two, .container .offset-by-three, .container .offset-by-four, .container .offset-by-five, .container .offset-by-six, .container .offset-by-seven, .container .offset-by-eight, .container .offset-by-nine, .container .offset-by-ten, .container .offset-by-eleven, .container .offset-by-twelve, .container .offset-by-thirteen, .container .offset-by-fourteen, .container .offset-by-fifteen {<br />
padding-left: 0;<br />
}<br />
.sticky #logo {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
left: 10px;<br />
}<br />
.sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 8px;<br />
right: 1px;<br />
}<br />
#feature {<br />
height: 250px;<br />
}<br />
#feature article, #feature ul {<br />
display: none!important;<br />
}<br />
#feature h1 {<br />
top: 100px;<br />
font-size: 36px;<br />
line-height: 42px;<br />
}<br />
#home-content, #home-content .column, .mini-post {<br />
width: auto;<br />
float: none!important;<br />
display: block;<br />
}<br />
#home-content .column {<br />
margin: 0 0 40px;<br />
}<br />
.mini-post {<br />
margin: 0 auto 20px;<br />
width: 290px;<br />
}<br />
#tweet {<br />
padding: 40px 0 0 0;<br />
margin: 40px 0;<br />
width: auto;<br />
}<br />
#tweet .text {<br />
padding: 40px 20px 0;<br />
background-position: center top;<br />
}<br />
nav a {<br />
padding-left: 6px;<br />
padding-right: 6px;<br />
font-size: 12px;<br />
}<br />
<br />
#work article {<br />
width: 30%;<br />
margin: 10px;<br />
}<br />
#work article .image, #work article a img, .labs#work article .image {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#case-details .images {<br />
width: auto;<br />
margin-left: 0;<br />
}<br />
#case-details .images img, #case-details .images.two img {<br />
width: 100%;<br />
margin: 0 0 20px!important;<br />
}<br />
#page-header.case h1 {<br />
font-size: 30px;<br />
line-height: 28px;<br />
max-width: 55%}<br />
#page-header.case h2 {<br />
max-width: 50%;<br />
line-height: 24px;<br />
}<br />
.labs #page-header h1 {<br />
font-size: 46px;<br />
}<br />
#meta p {<br />
float: right;<br />
margin: 0;<br />
}<br />
#meta p:first-child {<br />
width: 50%;<br />
float: left;<br />
}<br />
#work-with-us {<br />
font-size: 18px;<br />
}<br />
#blog-top #categories {<br />
margin-bottom: 15px;<br />
}<br />
#blog-top form {<br />
width: 200px;<br />
}<br />
#blog-top input {<br />
width: 170px;<br />
}<br />
#blog-top #rss {<br />
width: 80px;<br />
float: right;<br />
}<br />
#blog article img {<br />
width: 100%;<br />
height: auto;<br />
}<br />
#blog article {<br />
margin-bottom: 30px;<br />
}<br />
#blog article iframe {<br />
height: 270px;<br />
}<br />
#blog article .post h2 {<br />
font-size: 20px;<br />
line-height: 22px;<br />
}<br />
#blog .share {<br />
display: none;<br />
}<br />
.short-url {<br />
margin-bottom: 5px;<br />
}<br />
.categories {<br />
float: left;<br />
}<br />
.content h2 {<br />
font-size: 30px;<br />
line-height: 38px;<br />
}<br />
.content p {<br />
font-size: 14px;<br />
line-height: 22px;<br />
font-weight: 500;<br />
}<br />
<br />
footer {<br />
height: auto;<br />
}<br />
#wrap {<br />
margin-bottom: 0;<br />
min-height: 0;<br />
}<br />
.push {<br />
display: none;<br />
}<br />
#processes {<br />
margin: 0 20px;<br />
}<br />
.process .text {<br />
padding: 0 10px;<br />
}<br />
.process p {<br />
font-size: 12px;<br />
line-height: 16px;<br />
}<br />
}@media only screen and (min-width:480px) and (max-width:767px) {<br />
.container, .container.short {<br />
width: 420px;<br />
}<br />
.container .columns, .container .column {<br />
margin: 0;<br />
}<br />
.container .one.column, .container .one.columns, .container .two.columns, .container .three.columns, .container .four.columns, .container .five.columns, .container .six.columns, .container .seven.columns, .container .eight.columns, .container .nine.columns, .container .ten.columns, .container .eleven.columns, .container .twelve.columns, .container .thirteen.columns, .container .fourteen.columns, .container .fifteen.columns, .container .sixteen.columns, .container .one-third.column, .container .two-thirds.column {<br />
width: 420px;<br />
}<br />
#footer-newsletter input {<br />
width: 360px;<br />
}<br />
#blog-top form {<br />
width: 300px;<br />
}<br />
#blog-top input {<br />
width: 270px;<br />
}<br />
#blog-top #rss {<br />
width: 100px;<br />
float: right;<br />
}<br />
.categories {<br />
float: right;<br />
}<br />
.column-text {<br />
-moz-column-count: 1;<br />
-webkit-column-count: 1;<br />
column-count: 1;<br />
}<br />
}@media only screen and (min-width:320px) and (max-width:580px) {<br />
#logo, .sticky #logo {<br />
background-position: 0 -80px;<br />
top: 10px;<br />
left: 10px;<br />
}<br />
#logo1, .sticky #logo1 {<br />
background-position: 0 -80px;<br />
top: 10px;<br />
right: 1px;<br />
}<br />
header, header.sticky {<br />
height: 100px;<br />
}<br />
.sticky nav, nav {<br />
margin-top: 64px;<br />
}<br />
nav a {<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
}<br />
#feature h1 {<br />
top: 120px;<br />
font-size: 22px;<br />
line-height: 30px;<br />
}<br />
#tweet .text p {<br />
font-size: 20px;<br />
line-height: 24px;<br />
}<br />
#work article {<br />
width: 45%;<br />
margin: 6px;<br />
}<br />
#page-header {<br />
height: 200px;<br />
}<br />
#page-header h1 {<br />
font-size: 34px;<br />
}<br />
.labs #page-header h1 {<br />
font-size: 25px;<br />
}<br />
#page-header.case h2 {<br />
font-size: 16px;<br />
font-weight: 500;<br />
line-height: 20px;<br />
}<br />
#work-with-us {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#work-with-us span {<br />
background-image: none;<br />
}<br />
#contact #message input, #contact #message textarea {<br />
width: 200px;<br />
max-width: 200px;<br />
}<br />
#fresh ul {<br />
display: none;<br />
}<br />
#blog article iframe {<br />
height: 200px;<br />
}<br />
#process {<br />
display: none;<br />
}<br />
}.container:after {<br />
content: "\0020";<br />
display: block;<br />
height: 0;<br />
clear: both;<br />
visibility: hidden;<br />
}</div>
Czh
http://2013.igem.org/File:Atcg.jpg
File:Atcg.jpg
2013-10-20T06:05:28Z
<p>Czh: background jpg</p>
<hr />
<div>background jpg</div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Home
Team:Shenzhen BGIC 0101/Home
2013-10-20T05:35:30Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<!-- lazyload --><br />
<br />
<br />
<br />
<br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style_slider?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/jquery?action=raw&ctype=text/javascript"></script><br />
<br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<br />
<br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<style><br />
h3{<br />
font-family: 'Tangerine', serif;<br />
font-size: 45px;<br />
text-shadow: 4px 4px 4px #aaa;<br />
color: #38f;<br />
letter-spacing: 0.1em;<br />
word-spacing: 0.3em;<br />
font-weight: 700;<br />
line-height: 36px;<br />
margin: 0;<br />
}<br />
<br />
.reference{<br />
clear:both;<br />
top:40px;<br />
left:120px;<br />
<br />
font-size: 16px;<br />
line-height: 19px;<br />
font-family: Trebuchet MS;<br />
font-weight: 600;<br />
position:absolute;<br />
text-align:left;<br />
width:48%;<br />
padding:20px;<br />
background-color:#ffe;<br />
-moz-box-shadow:1px 3px 15px #ddd;<br />
-webkit-box-shadow:1px 3px 15px #ddd;<br />
box-shadow:4px 3px 25px #ddd;<br />
}<br />
<br />
ul.accordion{<br />
list-style:none; <br />
position:absolute;<br />
right:150px;<br />
top:0px;<br />
font-family: Cambria, serif;<br />
font-size: 16px;<br />
font-style: italic;<br />
line-height: 1.5em;<br />
}<br />
ul.accordion li{<br />
float:right;<br />
width:115px;<br />
height:480px;<br />
display:block;<br />
border-right:2px solid #fff;<br />
border-bottom:2px solid #fff;<br />
background-color:#fff;<br />
background-repeat:no-repeat;<br />
background-position:center center;<br />
position:relative;<br />
overflow:hidden;<br />
cursor:pointer;<br />
-moz-box-shadow:1px 3px 15px #555;<br />
-webkit-box-shadow:1px 3px 15px #555;<br />
box-shadow:1px 3px 15px #555;<br />
}<br />
ul.accordion li.bg1{<br />
background-image:url(https://static.igem.org/mediawiki/2013/c/c8/Bki-20101209112236-2125207650.jpg);<br />
}<br />
ul.accordion li.bg2{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bg3{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bg4{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bleft{<br />
border-left:2px solid #fff;<br />
}<br />
ul.accordion li .heading{<br />
background-color:#fff;<br />
padding:10px;<br />
margin-top:60px;<br />
opacity:0.9;<br />
text-transform:uppercase;<br />
font-style:normal;<br />
font-weight:bold;<br />
letter-spacing:1px;<br />
font-size:14px;<br />
color:#444;<br />
text-align:center;<br />
text-shadow:-1px -1px 1px #ccc;<br />
}<br />
ul.accordion li .description{<br />
position:absolute;<br />
width:480px;<br />
height:175px;<br />
bottom:0px;<br />
left:0px;<br />
display:none;<br />
}<br />
ul.accordion li .description h2{<br />
text-transform: uppercase;<br />
font-style: normal;<br />
font-weight: bold;<br />
letter-spacing: 1px;<br />
font-size: 25px;<br />
color: #444;<br />
text-align: left;<br />
margin: -15px 0px 0px 20px;<br />
text-shadow: -1px -1px 1px #ccc;<br />
}<br />
ul.accordion li .description p{<br />
line-height:14px;<br />
margin:10px 22px;<br />
font-family: "Trebuchet MS", sans-serif;<br />
font-size: 12px;<br />
font-style: italic;<br />
font-weight: normal;<br />
text-transform: none;<br />
letter-spacing: normal;<br />
line-height: 1.6em;<br />
}<br />
ul.accordion li .description a{<br />
position:absolute;<br />
bottom:5px;<br />
left:20px;<br />
text-transform:uppercase;<br />
font-style:normal;<br />
font-size:11px;<br />
text-decoration:none;<br />
color:#888;<br />
}<br />
ul.accordion li .description a:hover{<br />
color:#333;<br />
text-decoration:underline;<br />
}<br />
<br />
ul.accordion li .bgDescription{<br />
background:transparent url(https://static.igem.org/mediawiki/igem.org/1/15/BgDescription.png) repeat-x top left;<br />
height:340px;<br />
position:absolute;<br />
bottom:0px;<br />
left:0px;<br />
width:100%;<br />
display:none;<br />
}<br />
<br />
.win {<br />
width: 970px;<br />
margin: 50px auto;<br />
}<br />
.win a {<br />
line-height: 180px;<br />
display: block;<br />
margin: 8px;<br />
text-align: center;<br />
float: left;<br />
opacity: 1;<br />
}<br />
.win8 {<br />
margin: 8px;<br />
display: block;<br />
width : 300px;<br />
<br />
float: left;<br />
color: #015;<br />
font-family: Verdana, 'Times New Roman',serif;<br />
font-weight: 300;<br />
font-size: 13px;<br />
}<br />
h4{<br />
font-weight: 600;<br />
font-size: 17px;<br />
<br />
margin :8px;<br />
}<br />
.win8 img{<br />
width : 150px;<br />
}<br />
<br />
</style><br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/jquery?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
<br />
$(document).ready(function() {<br />
$('.win a').hover(function() {<br />
$(this).stop().animate({<br />
opacity: 0.5<br />
}, 300);<br />
}, function() {<br />
$(this).stop().animate({<br />
opacity: 1<br />
}, 300);<br />
});<br />
});<br />
<br />
</script><br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="wrap" style="font-family: Verdana, Geneva, sans-serif;background-color: #eee;"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav><br />
<a href="https://2013.igem.org/Main_Page" id="logo1">igem</a> <br />
</header><br />
<br />
<br />
<div id="wowslider-container1"><br />
<div class="ws_images"><ul><br />
<li><img src="https://static.igem.org/mediawiki/2013/e/e5/Ggggg.png" alt="1" title="" id="wows1_0" class="lazy" />Genove</li><br />
<li><img src="https://static.igem.org/mediawiki/igem.org/c/c4/Slider2.jpg" alt="2" title="Nucleotide modification" id="wows1_1" class="lazy"/>Nucleotide modification allow users to modify sequence as their wishes by utilizing codon synonomousness.</li><br />
<li><img src="https://static.igem.org/mediawiki/igem.org/9/99/Slider3.jpg" alt="3" title="chromosome" id="wows1_2" class="lazy"/>We can help you creat a new chromosome.</li><br />
<li><img src="https://static.igem.org/mediawiki/2013/0/0a/Slider_4.jpg" alt="4" title="pathway" id="wows1_3" class="lazy"/>Genove can help you design a new pathway.</li><br />
<li><img src="https://static.igem.org/mediawiki/2013/1/1d/Slider_1.jpg" alt="5" title="team" id="wows1_4" class="lazy"/>All members of our team.</li><br />
</ul></div><br />
<div class="ws_bullets"><div><br />
<a href="#" title="1"><img src="https://static.igem.org/mediawiki/2013/b/b2/Little1.jpg" alt="1"/>1</a><br />
<a href="#" title="2"><img src="https://static.igem.org/mediawiki/igem.org/1/17/Little2.jpg" alt="2"/>2</a><br />
<a href="#" title="3"><img src="https://static.igem.org/mediawiki/igem.org/2/2f/Little3.jpg" alt="3"/>3</a><br />
<a href="#" title="4"><img src="https://static.igem.org/mediawiki/2013/c/c0/Little4.jpg" alt="4"/>4</a><br />
<a href="#" title="5"><img src="https://static.igem.org/mediawiki/2013/5/50/Little5.jpg" alt="5"/>5</a><br />
</div></div></div><br />
<br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/wowslider?action=raw&ctype=text/javascript"></script> <br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/script?action=raw&ctype=text/javascript"></script><br />
<br />
<br/><br/><br />
<div class="win"><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/2/21/Lxm_3.png" /></a><h4>Neochr</h4>Construct genome's structure</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/c/c8/NucleoMod.png" /></a><h4>NucleoMod</h4>Modify CDS region</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/b/b2/SegmMan.png" /></a><h4>SegmMan</h4>Split into fragments</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial"><img src="https://static.igem.org/mediawiki/2013/c/ce/X_2.png" /></a><h4>Jbrowse GUI</h4>Operation interface</div><br />
<div class="win8"><a href="http://192.185.29.142/~luxujia/jbrowse_no_git/index.html?data=data/NeoChr/"><img src="https://static.igem.org/mediawiki/2013/4/47/Lxm_2.png" /></a><h4>Web sever</h4>Web version of Genovo</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial"><img src="https://static.igem.org/mediawiki/2013/0/08/Zwz.png" /></a> <h4>Tutorial</h4>Instruction for users</div><br />
</div><br />
<br />
<br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br />
<!-- The JavaScript --><br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1/jquery.min.js"></script><br />
<script type="text/javascript"><br />
$(function() {<br />
$('#accordion > li').hover(<br />
function () {<br />
var $this = $(this);<br />
$this.stop().animate({'width':'480px'},500);<br />
$('.heading',$this).stop(true,true).fadeOut();<br />
$('.bgDescription',$this).stop(true,true).slideDown(500);<br />
$('.description',$this).stop(true,true).fadeIn();<br />
},<br />
function () {<br />
var $this = $(this);<br />
$this.stop().animate({'width':'115px'},1000);<br />
$('.heading',$this).stop(true,true).fadeIn();<br />
$('.description',$this).stop(true,true).fadeOut(500);<br />
$('.bgDescription',$this).stop(true,true).slideUp(700);<br />
}<br />
);<br />
});<br />
</script><br />
<br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<br />
<footer><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.cn">gongjianhui@genomics.cn</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="http://www.humaan.com.au/wp-content/themes/humaan/js/scripts.min.js" type="text/javascript"></script><br />
<br />
<br />
</body><br />
</html><br />
{{Scroll}}</div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Home
Team:Shenzhen BGIC 0101/Home
2013-10-20T05:34:29Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<!-- lazyload --><br />
<br />
<br />
<br />
<br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style_slider?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/jquery?action=raw&ctype=text/javascript"></script><br />
<br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<br />
<br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<style><br />
h3{<br />
font-family: 'Tangerine', serif;<br />
font-size: 45px;<br />
text-shadow: 4px 4px 4px #aaa;<br />
color: #38f;<br />
letter-spacing: 0.1em;<br />
word-spacing: 0.3em;<br />
font-weight: 700;<br />
line-height: 36px;<br />
margin: 0;<br />
}<br />
<br />
.reference{<br />
clear:both;<br />
top:40px;<br />
left:120px;<br />
<br />
font-size: 16px;<br />
line-height: 19px;<br />
font-family: Trebuchet MS;<br />
font-weight: 600;<br />
position:absolute;<br />
text-align:left;<br />
width:48%;<br />
padding:20px;<br />
background-color:#ffe;<br />
-moz-box-shadow:1px 3px 15px #ddd;<br />
-webkit-box-shadow:1px 3px 15px #ddd;<br />
box-shadow:4px 3px 25px #ddd;<br />
}<br />
<br />
ul.accordion{<br />
list-style:none; <br />
position:absolute;<br />
right:150px;<br />
top:0px;<br />
font-family: Cambria, serif;<br />
font-size: 16px;<br />
font-style: italic;<br />
line-height: 1.5em;<br />
}<br />
ul.accordion li{<br />
float:right;<br />
width:115px;<br />
height:480px;<br />
display:block;<br />
border-right:2px solid #fff;<br />
border-bottom:2px solid #fff;<br />
background-color:#fff;<br />
background-repeat:no-repeat;<br />
background-position:center center;<br />
position:relative;<br />
overflow:hidden;<br />
cursor:pointer;<br />
-moz-box-shadow:1px 3px 15px #555;<br />
-webkit-box-shadow:1px 3px 15px #555;<br />
box-shadow:1px 3px 15px #555;<br />
}<br />
ul.accordion li.bg1{<br />
background-image:url(https://static.igem.org/mediawiki/2013/c/c8/Bki-20101209112236-2125207650.jpg);<br />
}<br />
ul.accordion li.bg2{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bg3{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bg4{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bleft{<br />
border-left:2px solid #fff;<br />
}<br />
ul.accordion li .heading{<br />
background-color:#fff;<br />
padding:10px;<br />
margin-top:60px;<br />
opacity:0.9;<br />
text-transform:uppercase;<br />
font-style:normal;<br />
font-weight:bold;<br />
letter-spacing:1px;<br />
font-size:14px;<br />
color:#444;<br />
text-align:center;<br />
text-shadow:-1px -1px 1px #ccc;<br />
}<br />
ul.accordion li .description{<br />
position:absolute;<br />
width:480px;<br />
height:175px;<br />
bottom:0px;<br />
left:0px;<br />
display:none;<br />
}<br />
ul.accordion li .description h2{<br />
text-transform: uppercase;<br />
font-style: normal;<br />
font-weight: bold;<br />
letter-spacing: 1px;<br />
font-size: 25px;<br />
color: #444;<br />
text-align: left;<br />
margin: -15px 0px 0px 20px;<br />
text-shadow: -1px -1px 1px #ccc;<br />
}<br />
ul.accordion li .description p{<br />
line-height:14px;<br />
margin:10px 22px;<br />
font-family: "Trebuchet MS", sans-serif;<br />
font-size: 12px;<br />
font-style: italic;<br />
font-weight: normal;<br />
text-transform: none;<br />
letter-spacing: normal;<br />
line-height: 1.6em;<br />
}<br />
ul.accordion li .description a{<br />
position:absolute;<br />
bottom:5px;<br />
left:20px;<br />
text-transform:uppercase;<br />
font-style:normal;<br />
font-size:11px;<br />
text-decoration:none;<br />
color:#888;<br />
}<br />
ul.accordion li .description a:hover{<br />
color:#333;<br />
text-decoration:underline;<br />
}<br />
<br />
ul.accordion li .bgDescription{<br />
background:transparent url(https://static.igem.org/mediawiki/igem.org/1/15/BgDescription.png) repeat-x top left;<br />
height:340px;<br />
position:absolute;<br />
bottom:0px;<br />
left:0px;<br />
width:100%;<br />
display:none;<br />
}<br />
<br />
.win {<br />
width: 970px;<br />
margin: 50px auto;<br />
}<br />
.win a {<br />
line-height: 180px;<br />
display: block;<br />
margin: 8px;<br />
text-align: center;<br />
float: left;<br />
opacity: 1;<br />
}<br />
.win8 {<br />
margin: 8px;<br />
display: block;<br />
width : 300px;<br />
<br />
float: left;<br />
color: #015;<br />
font-family: Verdana, 'Times New Roman',serif;<br />
font-weight: 300;<br />
font-size: 13px;<br />
}<br />
h4{<br />
font-weight: 600;<br />
font-size: 17px;<br />
<br />
margin :8px;<br />
}<br />
.win8 img{<br />
width : 150px;<br />
}<br />
<br />
</style><br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/jquery?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
<br />
$(document).ready(function() {<br />
$('.win a').hover(function() {<br />
$(this).stop().animate({<br />
opacity: 0.5<br />
}, 300);<br />
}, function() {<br />
$(this).stop().animate({<br />
opacity: 1<br />
}, 300);<br />
});<br />
});<br />
<br />
</script><br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="wrap" style="font-family: Verdana, Geneva, sans-serif;background-color: #eee;"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav><br />
<a href="https://2013.igem.org/Main_Page" id="logo1">igem</a> <br />
</header><br />
<br />
<br />
<div id="wowslider-container1"><br />
<div class="ws_images"><ul><br />
<li><img src="https://static.igem.org/mediawiki/2013/e/e5/Ggggg.png" alt="1" title="team" id="wows1_0" class="lazy" />Genove</li><br />
<li><img src="https://static.igem.org/mediawiki/igem.org/c/c4/Slider2.jpg" alt="2" title="Nucleotide modification" id="wows1_1" class="lazy"/>Nucleotide modification allow users to modify sequence as their wishes by utilizing codon synonomousness.</li><br />
<li><img src="https://static.igem.org/mediawiki/igem.org/9/99/Slider3.jpg" alt="3" title="chromosome" id="wows1_2" class="lazy"/>We can help you creat a new chromosome.</li><br />
<li><img src="https://static.igem.org/mediawiki/2013/0/0a/Slider_4.jpg" alt="4" title="pathway" id="wows1_3" class="lazy"/>Genove can help you design a new pathway.</li><br />
<li><img src="https://static.igem.org/mediawiki/2013/1/1d/Slider_1.jpg" alt="5" title="5" id="wows1_4" class="lazy"/>All members of our team.</li><br />
</ul></div><br />
<div class="ws_bullets"><div><br />
<a href="#" title="1"><img src="https://static.igem.org/mediawiki/2013/b/b2/Little1.jpg" alt="1"/>1</a><br />
<a href="#" title="2"><img src="https://static.igem.org/mediawiki/igem.org/1/17/Little2.jpg" alt="2"/>2</a><br />
<a href="#" title="3"><img src="https://static.igem.org/mediawiki/igem.org/2/2f/Little3.jpg" alt="3"/>3</a><br />
<a href="#" title="4"><img src="https://static.igem.org/mediawiki/2013/c/c0/Little4.jpg" alt="4"/>4</a><br />
<a href="#" title="5"><img src="https://static.igem.org/mediawiki/2013/5/50/Little5.jpg" alt="5"/>5</a><br />
</div></div></div><br />
<br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/wowslider?action=raw&ctype=text/javascript"></script> <br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/script?action=raw&ctype=text/javascript"></script><br />
<br />
<br/><br/><br />
<div class="win"><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/2/21/Lxm_3.png" /></a><h4>Neochr</h4>Construct genome's structure</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/c/c8/NucleoMod.png" /></a><h4>NucleoMod</h4>Modify CDS region</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/b/b2/SegmMan.png" /></a><h4>SegmMan</h4>Split into fragments</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial"><img src="https://static.igem.org/mediawiki/2013/c/ce/X_2.png" /></a><h4>Jbrowse GUI</h4>Operation interface</div><br />
<div class="win8"><a href="http://192.185.29.142/~luxujia/jbrowse_no_git/index.html?data=data/NeoChr/"><img src="https://static.igem.org/mediawiki/2013/4/47/Lxm_2.png" /></a><h4>Web sever</h4>Web version of Genovo</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial"><img src="https://static.igem.org/mediawiki/2013/0/08/Zwz.png" /></a> <h4>Tutorial</h4>Instruction for users</div><br />
</div><br />
<br />
<br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br />
<!-- The JavaScript --><br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1/jquery.min.js"></script><br />
<script type="text/javascript"><br />
$(function() {<br />
$('#accordion > li').hover(<br />
function () {<br />
var $this = $(this);<br />
$this.stop().animate({'width':'480px'},500);<br />
$('.heading',$this).stop(true,true).fadeOut();<br />
$('.bgDescription',$this).stop(true,true).slideDown(500);<br />
$('.description',$this).stop(true,true).fadeIn();<br />
},<br />
function () {<br />
var $this = $(this);<br />
$this.stop().animate({'width':'115px'},1000);<br />
$('.heading',$this).stop(true,true).fadeIn();<br />
$('.description',$this).stop(true,true).fadeOut(500);<br />
$('.bgDescription',$this).stop(true,true).slideUp(700);<br />
}<br />
);<br />
});<br />
</script><br />
<br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<br />
<footer><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.cn">gongjianhui@genomics.cn</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="http://www.humaan.com.au/wp-content/themes/humaan/js/scripts.min.js" type="text/javascript"></script><br />
<br />
<br />
</body><br />
</html><br />
{{Scroll}}</div>
Czh
http://2013.igem.org/Team:Shenzhen_BGIC_0101/Home
Team:Shenzhen BGIC 0101/Home
2013-09-28T04:21:58Z
<p>Czh: </p>
<hr />
<div><html><br />
<head><br />
<!-- iGem wiki hacks --><br />
<!-- Remove all empty <p> tags --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("p").filter( function() {<br />
return $.trim($(this).html()) == '';<br />
}).remove();<br />
});<br />
</script><br />
<br />
<!-- Remove "team" from the menubar --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("menubar > ul > li:last-child").remove();<br />
});<br />
</script><br />
<br />
<!-- Empty heading? - Then remove it.. --><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
if ("" == "</html>{{{1}}}<html>") {<br />
$("#heading").remove();<br />
}<br />
});<br />
</script><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
// document.getElementById("p-logo").style.display= "none";<br />
document.getElementsByClassName("right-menu noprint")[0].style.display= "none";<br />
//document.getElementById("searchform").style.display= "none";<br />
<br />
});<br />
</script><br />
<!-- lazyload --><br />
<br />
<br />
<br />
<br />
<br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/css?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style?action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/style_slider?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/jquery?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
<!--[if lte IE 8]><link rel="stylesheet" href="http://www.humaan.com.au/wp-content/themes/humaan/css/iestyle.css"><![endif]--><br />
<!--[if IE 9]><link rel="stylesheet" href="http://www.humaan.com.au/wp-content/themes/humaan/css/ie9.css"><![endif]--><br />
<br />
<script type="text/javascript" src="//use.typekit.net/jlr8wlp.js"></script><br />
<script type="text/javascript">try{Typekit.load();}catch(e){}</script><br />
<br />
<br />
<!--[if lt IE 9]><script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script><![endif]--><br />
<br />
<br />
<br />
<style type="text/css">.recentcomments a{display:inline !important;padding:0 !important;margin:0 !important;}</style><br />
<style><br />
h3{<br />
font-family: 'Tangerine', serif;<br />
font-size: 45px;<br />
text-shadow: 4px 4px 4px #aaa;<br />
color: #38f;<br />
letter-spacing: 0.1em;<br />
word-spacing: 0.3em;<br />
font-weight: 700;<br />
line-height: 36px;<br />
margin: 0;<br />
}<br />
<br />
.reference{<br />
clear:both;<br />
top:40px;<br />
left:120px;<br />
<br />
font-size: 16px;<br />
line-height: 19px;<br />
font-family: Trebuchet MS;<br />
font-weight: 600;<br />
position:absolute;<br />
text-align:left;<br />
width:48%;<br />
padding:20px;<br />
background-color:#ffe;<br />
-moz-box-shadow:1px 3px 15px #ddd;<br />
-webkit-box-shadow:1px 3px 15px #ddd;<br />
box-shadow:4px 3px 25px #ddd;<br />
}<br />
<br />
ul.accordion{<br />
list-style:none; <br />
position:absolute;<br />
right:150px;<br />
top:0px;<br />
font-family: Cambria, serif;<br />
font-size: 16px;<br />
font-style: italic;<br />
line-height: 1.5em;<br />
}<br />
ul.accordion li{<br />
float:right;<br />
width:115px;<br />
height:480px;<br />
display:block;<br />
border-right:2px solid #fff;<br />
border-bottom:2px solid #fff;<br />
background-color:#fff;<br />
background-repeat:no-repeat;<br />
background-position:center center;<br />
position:relative;<br />
overflow:hidden;<br />
cursor:pointer;<br />
-moz-box-shadow:1px 3px 15px #555;<br />
-webkit-box-shadow:1px 3px 15px #555;<br />
box-shadow:1px 3px 15px #555;<br />
}<br />
ul.accordion li.bg1{<br />
background-image:url(https://static.igem.org/mediawiki/2013/c/c8/Bki-20101209112236-2125207650.jpg);<br />
}<br />
ul.accordion li.bg2{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bg3{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bg4{<br />
background-image:url(https://static.igem.org/mediawiki/2013/d/d2/Cloud.png);<br />
}<br />
ul.accordion li.bleft{<br />
border-left:2px solid #fff;<br />
}<br />
ul.accordion li .heading{<br />
background-color:#fff;<br />
padding:10px;<br />
margin-top:60px;<br />
opacity:0.9;<br />
text-transform:uppercase;<br />
font-style:normal;<br />
font-weight:bold;<br />
letter-spacing:1px;<br />
font-size:14px;<br />
color:#444;<br />
text-align:center;<br />
text-shadow:-1px -1px 1px #ccc;<br />
}<br />
ul.accordion li .description{<br />
position:absolute;<br />
width:480px;<br />
height:175px;<br />
bottom:0px;<br />
left:0px;<br />
display:none;<br />
}<br />
ul.accordion li .description h2{<br />
text-transform: uppercase;<br />
font-style: normal;<br />
font-weight: bold;<br />
letter-spacing: 1px;<br />
font-size: 25px;<br />
color: #444;<br />
text-align: left;<br />
margin: -15px 0px 0px 20px;<br />
text-shadow: -1px -1px 1px #ccc;<br />
}<br />
ul.accordion li .description p{<br />
line-height:14px;<br />
margin:10px 22px;<br />
font-family: "Trebuchet MS", sans-serif;<br />
font-size: 12px;<br />
font-style: italic;<br />
font-weight: normal;<br />
text-transform: none;<br />
letter-spacing: normal;<br />
line-height: 1.6em;<br />
}<br />
ul.accordion li .description a{<br />
position:absolute;<br />
bottom:5px;<br />
left:20px;<br />
text-transform:uppercase;<br />
font-style:normal;<br />
font-size:11px;<br />
text-decoration:none;<br />
color:#888;<br />
}<br />
ul.accordion li .description a:hover{<br />
color:#333;<br />
text-decoration:underline;<br />
}<br />
<br />
ul.accordion li .bgDescription{<br />
background:transparent url(https://static.igem.org/mediawiki/igem.org/1/15/BgDescription.png) repeat-x top left;<br />
height:340px;<br />
position:absolute;<br />
bottom:0px;<br />
left:0px;<br />
width:100%;<br />
display:none;<br />
}<br />
<br />
.win {<br />
width: 970px;<br />
margin: 50px auto;<br />
}<br />
.win a {<br />
line-height: 180px;<br />
display: block;<br />
margin: 8px;<br />
text-align: center;<br />
float: left;<br />
opacity: 1;<br />
}<br />
.win8 {<br />
margin: 8px;<br />
display: block;<br />
width : 300px;<br />
<br />
float: left;<br />
color: #015;<br />
font-family: Verdana, 'Times New Roman',serif;<br />
font-weight: 300;<br />
font-size: 13px;<br />
}<br />
h4{<br />
font-weight: 600;<br />
font-size: 17px;<br />
<br />
margin :8px;<br />
}<br />
.win8 img{<br />
width : 150px;<br />
}<br />
<br />
</style><br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/jquery?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
<br />
$(document).ready(function() {<br />
$('.win a').hover(function() {<br />
$(this).stop().animate({<br />
opacity: 0.5<br />
}, 300);<br />
}, function() {<br />
$(this).stop().animate({<br />
opacity: 1<br />
}, 300);<br />
});<br />
});<br />
<br />
</script><br />
</head><br />
<body class="blog developer-wanted"><br />
<div id="wrap" style="font-family: Verdana, Geneva, sans-serif;background-color: #eee;"><br />
<header class="light"><br />
<a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" id="logo">logo</a><br />
<br />
<nav class="menu-main-navigation-container"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Home" class="menu-item-20 menu-item menu-item-type-post_type menu-item-object-page current-menu-item">Home</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Team" class="menu-item-19 menu-item menu-item-type-post_type menu-item-object-page">Team</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Software" class="menu-item-18 menu-item menu-item-type-post_type menu-item-object-page">Software</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Requirements" class="menu-item-17 menu-item menu-item-type-post_type menu-item-object-page">Requirements</a> <a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Criteria" class="menu-item-15 menu-item menu-item-type-post_type menu-item-object-page">Criteria</a> </nav><br />
<a href="https://2013.igem.org/Main_Page" id="logo1">igem</a> <br />
</header><br />
<br />
<br />
<div id="wowslider-container1"><br />
<div class="ws_images"><ul><br />
<li><img src="https://static.igem.org/mediawiki/2013/1/1d/Slider_1.jpg" alt="1" title="team" id="wows1_0" class="lazy" />All members of our team.</li><br />
<li><img src="https://static.igem.org/mediawiki/igem.org/c/c4/Slider2.jpg" alt="2" title="Nucleotide modification" id="wows1_1" class="lazy"/>Nucleotide modification allow users to modify sequence as their wishes by utilizing codon synonomousness.</li><br />
<li><img src="https://static.igem.org/mediawiki/igem.org/9/99/Slider3.jpg" alt="3" title="chromosome" id="wows1_2" class="lazy"/>We can help you creat a new chromosome.</li><br />
<li><img src="https://static.igem.org/mediawiki/2013/0/0a/Slider_4.jpg" alt="4" title="pathway" id="wows1_3" class="lazy"/>Genove can help you design a new pathway.</li><br />
<li><img src="https://static.igem.org/mediawiki/2013/e/e5/Ggggg.png" alt="5" title="5" id="wows1_4" class="lazy"/>Genove</li><br />
</ul></div><br />
<div class="ws_bullets"><div><br />
<a href="#" title="1"><img src="https://static.igem.org/mediawiki/2013/b/b2/Little1.jpg" alt="1"/>1</a><br />
<a href="#" title="2"><img src="https://static.igem.org/mediawiki/igem.org/1/17/Little2.jpg" alt="2"/>2</a><br />
<a href="#" title="3"><img src="https://static.igem.org/mediawiki/igem.org/2/2f/Little3.jpg" alt="3"/>3</a><br />
<a href="#" title="4"><img src="https://static.igem.org/mediawiki/2013/c/c0/Little4.jpg" alt="4"/>4</a><br />
<a href="#" title="5"><img src="https://static.igem.org/mediawiki/2013/5/50/Little5.jpg" alt="5"/>5</a><br />
</div></div></div><br />
<br />
<br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/wowslider?action=raw&ctype=text/javascript"></script> <br />
<br />
<script src="https://2013.igem.org/Team:Shenzhen_BGIC_0101/script?action=raw&ctype=text/javascript"></script><br />
<br />
<br/><br/><br />
<div class="win"><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/2/21/Lxm_3.png" /></a><h4>Neochr</h4>Construct genome's structure</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/c/c8/NucleoMod.png" /></a><h4>NucleoMod</h4>Modify CDS region</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Modules"><img src="https://static.igem.org/mediawiki/2013/b/b2/SegmMan.png" /></a><h4>SegmMan</h4>Split into fragments</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Web-based_trial"><img src="https://static.igem.org/mediawiki/2013/c/ce/X_2.png" /></a><h4>Jbrowse GUI</h4>Operation interface</div><br />
<div class="win8"><a href="http://192.185.29.142/~luxujia/jbrowse_no_git/index.html?data=data/NeoChr/"><img src="https://static.igem.org/mediawiki/2013/4/47/Lxm_2.png" /></a><h4>Web sever</h4>Web version of Genovo</div><br />
<div class="win8"><a href="https://2013.igem.org/Team:Shenzhen_BGIC_0101/Tutorial"><img src="https://static.igem.org/mediawiki/2013/0/08/Zwz.png" /></a> <h4>Tutorial</h4>Instruction for users</div><br />
</div><br />
<br />
<br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br/><br />
<!-- The JavaScript --><br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1/jquery.min.js"></script><br />
<script type="text/javascript"><br />
$(function() {<br />
$('#accordion > li').hover(<br />
function () {<br />
var $this = $(this);<br />
$this.stop().animate({'width':'480px'},500);<br />
$('.heading',$this).stop(true,true).fadeOut();<br />
$('.bgDescription',$this).stop(true,true).slideDown(500);<br />
$('.description',$this).stop(true,true).fadeIn();<br />
},<br />
function () {<br />
var $this = $(this);<br />
$this.stop().animate({'width':'115px'},1000);<br />
$('.heading',$this).stop(true,true).fadeIn();<br />
$('.description',$this).stop(true,true).fadeOut(500);<br />
$('.bgDescription',$this).stop(true,true).slideUp(700);<br />
}<br />
);<br />
});<br />
</script><br />
<br />
<div class="push"></div><br />
</div><!-- wrapper --><br />
<br />
<footer><br />
<div class="container clearfix"><br />
<div class="seven columns" id="footer-contact"><br />
<h3>contact us</h3><br />
<p>BGI-Shenzhen, Beishan Industrial Zone<br /><br />
Yantian District, Shenzhen, 518083, China</p><br />
<p> <span>email:</span><br /><br />
<a href="mailto:gongjianhui@genomics.com">gongjianhui@genomics.com</a></p><br />
</div><br />
<div class="four columns" id="footer-project"><br />
<h3>sponsor</h3><br />
<p>BGIC<br/></p><br />
</div><br />
<div class="five columns" id="footer-newsletter"><br />
<a href="https://2013.igem.org/Main_Page" ><img width="150" height="120" src="https://static.igem.org/mediawiki/2013/0/02/TB_IGEM_official_logo.png" /></a><br />
</div><br />
</div><br />
</footer><br />
<br />
<br />
<script src="http://www.humaan.com.au/wp-content/themes/humaan/js/scripts.min.js" type="text/javascript"></script><br />
<br />
<br />
</body><br />
</html><br />
{{Scroll}}</div>
Czh
http://2013.igem.org/File:Ggggg.png
File:Ggggg.png
2013-09-28T04:21:08Z
<p>Czh: </p>
<hr />
<div></div>
Czh