http://2013.igem.org/wiki/index.php?title=Special:Contributions/Henry54809&feed=atom&limit=50&target=Henry54809&year=&month=2013.igem.org - User contributions [en]2024-03-29T06:01:48ZFrom 2013.igem.orgMediaWiki 1.16.5http://2013.igem.org/Team:GeorgiaTech/templateTeam:GeorgiaTech/template2013-10-27T02:42:19Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<title>Georgia Tech iGEM</title><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:Cornell/stylesheets/app?action=raw&ctype=text/css" type ="text/javascript"></script><br />
<br />
<script><br />
$(document).ready(function() {<br />
<br />
<br />
$("#logo").load(function() {<br />
<br />
$("#logo").sidr();<br />
$('#return').click(function() {<br />
$.sidr('close');<br />
});<br />
});<br />
<br />
$("#logo").hover(function() {<br />
$(this).animate({scale: 1.5, rotate: "+=25"});<br />
}, function() {<br />
$(this).animate({scale: 1, rotate: "-=45"});<br />
$(this).animate({scale: 1, rotate: "+=20"});<br />
});<br />
});<br />
<br />
</script><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<style type="text/css"><br />
body {<br />
padding-top: 0px;<br />
padding-left:100px;<br />
padding-right:18%;<br />
padding-bottom:50px;<br />
background: #f2f2f2;<br />
font-family: 'Droid Sans', Helvetica, sans-serif;<br />
font-size: 14px;<br />
line-height: 27px;<br />
}<br />
<br />
table#toc {<br />
display:none;<br />
}<br />
table{<br />
font-size:14px;<br />
padding-left:100px<br />
}<br />
/*<br />
#footer-box {<br />
display:none;<br />
} */<br />
.logo{<br />
position:fixed;<br />
display: block;<br />
left:85%;<br />
margin-right:auto;<br />
padding-top:5%;<br />
width:15%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
</style><br />
</head><br />
<body> <br />
<a href ="#sidr"><br />
<img id ="logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"/> </a></div><br />
<a href = "https://2013.igem.org"><br />
<h4 style = "position:fixed; top:20px; right: 3%">Main Page</h4></a><br />
<a href="https://2013.igem.org"><br />
<img id = "igem" src = "https://static.igem.org/mediawiki/2013/4/46/Igem_qgem_logo.png" style = "width: 10%; position: fixed; top: 1px; right:10%" alt = "igem logo"></img></a><br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Protocol" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTech/templateTeam:GeorgiaTech/template2013-10-27T02:41:40Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<title>Georgia Tech iGEM</title><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:Cornell/stylesheets/app?action=raw&ctype=text/css" type ="text/javascript"></script><br />
<br />
<script><br />
$(document).ready(function() {<br />
<br />
<br />
$("#logo").load(function() {<br />
<br />
$("#logo").sidr();<br />
$('#return').click(function() {<br />
$.sidr('close');<br />
});<br />
});<br />
<br />
$("#logo").hover(function() {<br />
$(this).animate({scale: 1.5, rotate: "+=25"});<br />
}, function() {<br />
$(this).animate({scale: 1, rotate: "-=45"});<br />
$(this).animate({scale: 1, rotate: "+=20"});<br />
});<br />
});<br />
<br />
</script><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<style type="text/css"><br />
body {<br />
padding-top: 0px;<br />
padding-left:100px;<br />
padding-right:18%;<br />
padding-bottom:50px;<br />
background: #f2f2f2;<br />
font-family: 'Droid Sans', Helvetica, sans-serif;<br />
font-size: 14px;<br />
line-height: 27px;<br />
}<br />
<br />
table#toc {<br />
display:none;<br />
}<br />
table{<br />
font-size:14px;<br />
padding-left:100px<br />
}<br />
/*<br />
#footer-box {<br />
display:none;<br />
} */<br />
.logo{<br />
position:fixed;<br />
display: block;<br />
left:85%;<br />
margin-right:auto;<br />
padding-top:5%;<br />
width:15%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
</style><br />
</head><br />
<body> <br />
<a href ="#sidr"><br />
<img id ="logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"/> </a></div><br />
<h4 style = "position:fixed; top:20px; right: 3%">Main Page</h4></a><br />
<a href="https://2013.igem.org"><br />
<img id = "igem" src = "https://static.igem.org/mediawiki/2013/4/46/Igem_qgem_logo.png" style = "width: 10%; position: fixed; top: 1px; right:10%" alt = "igem logo"></img></a><br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Protocol" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTech/templateTeam:GeorgiaTech/template2013-10-27T02:40:36Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<title>Georgia Tech iGEM</title><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:Cornell/stylesheets/app?action=raw&ctype=text/css" type ="text/javascript"></script><br />
<br />
<script><br />
$(document).ready(function() {<br />
<br />
<br />
$("#logo").load(function() {<br />
<br />
$("#logo").sidr();<br />
$('#return').click(function() {<br />
$.sidr('close');<br />
});<br />
});<br />
<br />
$("#logo").hover(function() {<br />
$(this).animate({scale: 1.5, rotate: "+=25"});<br />
}, function() {<br />
$(this).animate({scale: 1, rotate: "-=45"});<br />
$(this).animate({scale: 1, rotate: "+=20"});<br />
});<br />
});<br />
<br />
</script><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<style type="text/css"><br />
body {<br />
padding-top: 0px;<br />
padding-left:100px;<br />
padding-right:18%;<br />
padding-bottom:50px;<br />
background: #f2f2f2;<br />
font-family: 'Droid Sans', Helvetica, sans-serif;<br />
font-size: 14px;<br />
line-height: 27px;<br />
}<br />
<br />
table#toc {<br />
display:none;<br />
}<br />
table{<br />
font-size:14px;<br />
padding-left:100px<br />
}<br />
/*<br />
#footer-box {<br />
display:none;<br />
} */<br />
.logo{<br />
position:fixed;<br />
display: block;<br />
left:85%;<br />
margin-right:auto;<br />
padding-top:5%;<br />
width:15%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
</style><br />
</head><br />
<body> <br />
<a href ="#sidr"><br />
<img id ="logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"/> </a></div><br />
<h4 style = "position:fixed; top:20px; right: 1%">iGEM Main Page</h4></a><br />
<a href="https://2013.igem.org"><br />
<img id = "igem" src = "https://static.igem.org/mediawiki/2013/4/46/Igem_qgem_logo.png" style = "width: 10%; position: fixed; top: 1px; right:12%" alt = "igem logo"></img></a><br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Protocol" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTech/templateTeam:GeorgiaTech/template2013-10-27T02:39:35Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<title>Georgia Tech iGEM</title><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:Cornell/stylesheets/app?action=raw&ctype=text/css" type ="text/javascript"></script><br />
<br />
<script><br />
$(document).ready(function() {<br />
<br />
<br />
$("#logo").load(function() {<br />
<br />
$("#logo").sidr();<br />
$('#return').click(function() {<br />
$.sidr('close');<br />
});<br />
});<br />
<br />
$("#logo").hover(function() {<br />
$(this).animate({scale: 1.5, rotate: "+=25"});<br />
}, function() {<br />
$(this).animate({scale: 1, rotate: "-=45"});<br />
$(this).animate({scale: 1, rotate: "+=20"});<br />
});<br />
});<br />
<br />
</script><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<style type="text/css"><br />
body {<br />
padding-top: 0px;<br />
padding-left:100px;<br />
padding-right:18%;<br />
padding-bottom:50px;<br />
background: #f2f2f2;<br />
font-family: 'Droid Sans', Helvetica, sans-serif;<br />
font-size: 14px;<br />
line-height: 27px;<br />
}<br />
<br />
table#toc {<br />
display:none;<br />
}<br />
table{<br />
font-size:14px;<br />
padding-left:100px<br />
}<br />
/*<br />
#footer-box {<br />
display:none;<br />
} */<br />
.logo{<br />
position:fixed;<br />
display: block;<br />
left:85%;<br />
margin-right:auto;<br />
padding-top:5%;<br />
width:15%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
</style><br />
</head><br />
<body> <br />
<a href ="#sidr"><br />
<img id ="logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"/> </a></div><br />
<h3 style = "position:fixed; top:20px; right: 1%">iGEM Main Page</h3></a><br />
<a href="https://2013.igem.org"><br />
<img id = "igem" src = "https://static.igem.org/mediawiki/2013/4/46/Igem_qgem_logo.png" style = "width: 10%; position: fixed; top: 10px; right:10%" alt = "igem logo"></img></a><br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Protocol" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTech/templateTeam:GeorgiaTech/template2013-10-27T02:37:46Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<title>Georgia Tech iGEM</title><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:Cornell/stylesheets/app?action=raw&ctype=text/css" type ="text/javascript"></script><br />
<br />
<script><br />
$(document).ready(function() {<br />
<br />
<br />
$("#logo").load(function() {<br />
<br />
$("#logo").sidr();<br />
$('#return').click(function() {<br />
$.sidr('close');<br />
});<br />
});<br />
<br />
$("#logo").hover(function() {<br />
$(this).animate({scale: 1.5, rotate: "+=25"});<br />
}, function() {<br />
$(this).animate({scale: 1, rotate: "-=45"});<br />
$(this).animate({scale: 1, rotate: "+=20"});<br />
});<br />
});<br />
<br />
</script><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<style type="text/css"><br />
body {<br />
padding-top: 0px;<br />
padding-left:100px;<br />
padding-right:18%;<br />
padding-bottom:50px;<br />
background: #f2f2f2;<br />
font-family: 'Droid Sans', Helvetica, sans-serif;<br />
font-size: 14px;<br />
line-height: 27px;<br />
}<br />
<br />
table#toc {<br />
display:none;<br />
}<br />
table{<br />
font-size:14px;<br />
padding-left:100px<br />
}<br />
/*<br />
#footer-box {<br />
display:none;<br />
} */<br />
.logo{<br />
position:fixed;<br />
display: block;<br />
left:85%;<br />
margin-right:auto;<br />
padding-top:5%;<br />
width:15%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
</style><br />
</head><br />
<body> <br />
<a href ="#sidr"><br />
<img id ="logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"/> </a></div><br />
<h2 style = "position:fixed; top:40px; right: 20%">iGEM Main Page</h2></a><br />
<a href="https://2013.igem.org"><br />
<img id = "igem" src = "https://static.igem.org/mediawiki/2013/4/46/Igem_qgem_logo.png" style = "width: 10%; position: fixed; top: 20px; right:10%" alt = "igem logo"></img></a><br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Protocol" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTechTeam:GeorgiaTech2013-10-27T02:35:03Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:GeorgiaTech/mainPage?action=raw&ctype=text/javascript" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<script>$(document).delay(2000); <br />
</script><br />
<style type="text/css"><br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
<br />
#footer-box {<br />
display:none;<br />
}<br />
</style><br />
<style type="text/css"><br />
.logo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
padding-top:100px;<br />
width:40%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
#box<br />
{<br />
margin-left:25%;<br />
top:10%;<br />
background: #FFF;<br />
border: 5px;<br />
text-align: center;<br />
position: absolute;<br />
display: none;<br />
}<br />
<br />
#screen<br />
{<br />
position: absolute;<br />
left: 0;<br />
top: 0;<br />
background: #696969;<br />
}<br />
</style><br />
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /><br />
<title>Georgia Tech iGEM</title><br />
</head><br />
<br />
<body style="text-align: left"><br />
<img id = "logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"></img><br />
<img id = "gtLogo" src = "https://static.igem.org/mediawiki/2013/e/e5/LogoGT%280.01degree%29.png" style = "display:none" alt ="GT logo"></img><br />
<a href="https://2013.igem.org"><br />
<h2 style = "position:fixed; top:40px; right: 20%">iGEM Main Page</h2></a><br />
<a href="https://2013.igem.org"><br />
<img id = "igem" src = "https://static.igem.org/mediawiki/2013/4/46/Igem_qgem_logo.png" style = "width: 10%; position: fixed; top: 20px; right:10%" alt = "igem logo"></img></a><br />
<img id ="bigCellRest" src =" https://static.igem.org/mediawiki/2013/4/45/BigCellRest.png" style ="display:none"></img><br />
<img id ="bigCell" src =" https://static.igem.org/mediawiki/2013/3/37/BigCell.png" style ="display:none"></img><br />
<div id = "logoMask" style = " background: transparent"><a href ="#sidr"></a></div><br />
<div id = "bigCellMask" style =" background: transparent"></div><br />
<div id ="bigCellText" style ="background: transparent; display: none"><p class ="textLarge">Our Video</p></div><br />
<br />
<div style ="display:block"><br />
<br />
</div><br />
<div id ="menu" style ="display:none; position:absolute" ><p class =" textLarge">Menu</p></div><br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Protocol" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
<div id='screen' style="cursor: pointer"><br />
</div><br />
<iframe id="box" width="630" height="473" src="//www.youtube.com/embed/fVT7BjmMHDQ" frameborder="0" style="display:none"></iframe><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTechTeam:GeorgiaTech2013-10-27T02:34:31Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:GeorgiaTech/mainPage?action=raw&ctype=text/javascript" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<script>$(document).delay(2000); <br />
</script><br />
<style type="text/css"><br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
<br />
#footer-box {<br />
display:none;<br />
}<br />
</style><br />
<style type="text/css"><br />
.logo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
padding-top:100px;<br />
width:40%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
#box<br />
{<br />
margin-left:25%;<br />
top:10%;<br />
background: #FFF;<br />
border: 5px;<br />
text-align: center;<br />
position: absolute;<br />
display: none;<br />
}<br />
<br />
#screen<br />
{<br />
position: absolute;<br />
left: 0;<br />
top: 0;<br />
background: #696969;<br />
}<br />
</style><br />
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /><br />
<title>Georgia Tech iGEM</title><br />
</head><br />
<br />
<body style="text-align: left"><br />
<img id = "logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"></img><br />
<img id = "gtLogo" src = "https://static.igem.org/mediawiki/2013/e/e5/LogoGT%280.01degree%29.png" style = "display:none" alt ="GT logo"></img><br />
<h2 style = "position:fixed; top:40px; right: 20%">iGEM Main Page</h2><br />
<a href="https://2013.igem.org"><br />
<img id = "igem" src = "https://static.igem.org/mediawiki/2013/4/46/Igem_qgem_logo.png" style = "width: 10%; position: fixed; top: 20px; right:10%" alt = "igem logo"></img></a><br />
<img id ="bigCellRest" src =" https://static.igem.org/mediawiki/2013/4/45/BigCellRest.png" style ="display:none"></img><br />
<img id ="bigCell" src =" https://static.igem.org/mediawiki/2013/3/37/BigCell.png" style ="display:none"></img><br />
<div id = "logoMask" style = " background: transparent"><a href ="#sidr"></a></div><br />
<div id = "bigCellMask" style =" background: transparent"></div><br />
<div id ="bigCellText" style ="background: transparent; display: none"><p class ="textLarge">Our Video</p></div><br />
<br />
<div style ="display:block"><br />
<br />
</div><br />
<div id ="menu" style ="display:none; position:absolute" ><p class =" textLarge">Menu</p></div><br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Protocol" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
<div id='screen' style="cursor: pointer"><br />
</div><br />
<iframe id="box" width="630" height="473" src="//www.youtube.com/embed/fVT7BjmMHDQ" frameborder="0" style="display:none"></iframe><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTechTeam:GeorgiaTech2013-10-27T02:34:09Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:GeorgiaTech/mainPage?action=raw&ctype=text/javascript" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<script>$(document).delay(2000); <br />
</script><br />
<style type="text/css"><br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
<br />
#footer-box {<br />
display:none;<br />
}<br />
</style><br />
<style type="text/css"><br />
.logo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
padding-top:100px;<br />
width:40%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
#box<br />
{<br />
margin-left:25%;<br />
top:10%;<br />
background: #FFF;<br />
border: 5px;<br />
text-align: center;<br />
position: absolute;<br />
display: none;<br />
}<br />
<br />
#screen<br />
{<br />
position: absolute;<br />
left: 0;<br />
top: 0;<br />
background: #696969;<br />
}<br />
</style><br />
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /><br />
<title>Georgia Tech iGEM</title><br />
</head><br />
<br />
<body style="text-align: left"><br />
<img id = "logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"></img><br />
<img id = "gtLogo" src = "https://static.igem.org/mediawiki/2013/e/e5/LogoGT%280.01degree%29.png" style = "display:none" alt ="GT logo"></img><br />
<h1 style = "position:fixed; top:40px; right: 20%">iGEM Main Page</h1><br />
<a href="https://2013.igem.org"><br />
<img id = "igem" src = "https://static.igem.org/mediawiki/2013/4/46/Igem_qgem_logo.png" style = "width: 10%; position: fixed; top: 20px; right:10%" alt = "igem logo"></img></a><br />
<img id ="bigCellRest" src =" https://static.igem.org/mediawiki/2013/4/45/BigCellRest.png" style ="display:none"></img><br />
<img id ="bigCell" src =" https://static.igem.org/mediawiki/2013/3/37/BigCell.png" style ="display:none"></img><br />
<div id = "logoMask" style = " background: transparent"><a href ="#sidr"></a></div><br />
<div id = "bigCellMask" style =" background: transparent"></div><br />
<div id ="bigCellText" style ="background: transparent; display: none"><p class ="textLarge">Our Video</p></div><br />
<br />
<div style ="display:block"><br />
<br />
</div><br />
<div id ="menu" style ="display:none; position:absolute" ><p class =" textLarge">Menu</p></div><br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Protocol" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
<div id='screen' style="cursor: pointer"><br />
</div><br />
<iframe id="box" width="630" height="473" src="//www.youtube.com/embed/fVT7BjmMHDQ" frameborder="0" style="display:none"></iframe><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTechTeam:GeorgiaTech2013-10-27T02:32:48Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:GeorgiaTech/mainPage?action=raw&ctype=text/javascript" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<script>$(document).delay(2000);</script><br />
<style type="text/css"><br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
<br />
#footer-box {<br />
display:none;<br />
}<br />
</style><br />
<style type="text/css"><br />
.logo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
padding-top:100px;<br />
width:40%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
#box<br />
{<br />
margin-left:25%;<br />
top:10%;<br />
background: #FFF;<br />
border: 5px;<br />
text-align: center;<br />
position: absolute;<br />
display: none;<br />
}<br />
<br />
#screen<br />
{<br />
position: absolute;<br />
left: 0;<br />
top: 0;<br />
background: #696969;<br />
}<br />
</style><br />
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /><br />
<title>Georgia Tech iGEM</title><br />
</head><br />
<br />
<body style="text-align: left"><br />
<img id = "logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"></img><br />
<img id = "gtLogo" src = "https://static.igem.org/mediawiki/2013/e/e5/LogoGT%280.01degree%29.png" style = "display:none" alt ="GT logo"></img><br />
<h1 style = "position:fixed; top:40px; right: 20%">iGEM Main Page</h1><br />
<a href="https://2013.igem.org"><br />
<img id = "igem" src = "https://static.igem.org/mediawiki/2013/4/46/Igem_qgem_logo.png" style = "width: 10%; position: fixed; top: 20px; right:10%" alt = "igem logo"></img></a><br />
<img id ="bigCellRest" src =" https://static.igem.org/mediawiki/2013/4/45/BigCellRest.png" style ="display:none"></img><br />
<img id ="bigCell" src =" https://static.igem.org/mediawiki/2013/3/37/BigCell.png" style ="display:none"></img><br />
<div id = "logoMask" style = " background: transparent"><a href ="#sidr"></a></div><br />
<div id = "bigCellMask" style =" background: transparent"></div><br />
<div id ="bigCellText" style ="background: transparent; display: none"><p class ="textLarge">Our Video</p></div><br />
<br />
<div style ="display:block"><br />
<br />
</div><br />
<div id ="menu" style ="display:none; position:absolute" ><p class =" textLarge">Menu</p></div><br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Protocol" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
<div id='screen' style="cursor: pointer"><br />
</div><br />
<iframe id="box" width="630" height="473" src="//www.youtube.com/embed/fVT7BjmMHDQ" frameborder="0" style="display:none"></iframe><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTechTeam:GeorgiaTech2013-10-27T02:32:02Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:GeorgiaTech/mainPage?action=raw&ctype=text/javascript" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<script>$(document).delay(2000);</script><br />
<style type="text/css"><br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
<br />
#footer-box {<br />
display:none;<br />
}<br />
</style><br />
<style type="text/css"><br />
.logo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
padding-top:100px;<br />
width:40%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
#box<br />
{<br />
margin-left:25%;<br />
top:10%;<br />
background: #FFF;<br />
border: 5px;<br />
text-align: center;<br />
position: absolute;<br />
display: none;<br />
}<br />
<br />
#screen<br />
{<br />
position: absolute;<br />
left: 0;<br />
top: 0;<br />
background: #696969;<br />
}<br />
</style><br />
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /><br />
<title>Georgia Tech iGEM</title><br />
</head><br />
<br />
<body style="text-align: left"><br />
<img id = "logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"></img><br />
<img id = "gtLogo" src = "https://static.igem.org/mediawiki/2013/e/e5/LogoGT%280.01degree%29.png" style = "display:none" alt ="GT logo"></img><br />
<h1 style = "position:fixed; top:20px; right: 20%">iGEM Main Page</h1><br />
<a href="https://2013.igem.org"><br />
<img id = "igem" src = "https://static.igem.org/mediawiki/2013/4/46/Igem_qgem_logo.png" style = "width: 10%; position: fixed; top: 20px; right:10%" alt = "igem logo"></img></a><br />
<img id ="bigCellRest" src =" https://static.igem.org/mediawiki/2013/4/45/BigCellRest.png" style ="display:none"></img><br />
<img id ="bigCell" src =" https://static.igem.org/mediawiki/2013/3/37/BigCell.png" style ="display:none"></img><br />
<div id = "logoMask" style = " background: transparent"><a href ="#sidr"></a></div><br />
<div id = "bigCellMask" style =" background: transparent"></div><br />
<div id ="bigCellText" style ="background: transparent; display: none"><p class ="textLarge">Our Video</p></div><br />
<br />
<div style ="display:block"><br />
<br />
</div><br />
<div id ="menu" style ="display:none; position:absolute" ><p class =" textLarge">Menu</p></div><br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Protocol" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
<div id='screen' style="cursor: pointer"><br />
</div><br />
<iframe id="box" width="630" height="473" src="//www.youtube.com/embed/fVT7BjmMHDQ" frameborder="0" style="display:none"></iframe><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTechTeam:GeorgiaTech2013-10-27T02:31:33Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:GeorgiaTech/mainPage?action=raw&ctype=text/javascript" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<script>$(document).delay(2000);</script><br />
<style type="text/css"><br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
<br />
#footer-box {<br />
display:none;<br />
}<br />
</style><br />
<style type="text/css"><br />
.logo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
padding-top:100px;<br />
width:40%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
#box<br />
{<br />
margin-left:25%;<br />
top:10%;<br />
background: #FFF;<br />
border: 5px;<br />
text-align: center;<br />
position: absolute;<br />
display: none;<br />
}<br />
<br />
#screen<br />
{<br />
position: absolute;<br />
left: 0;<br />
top: 0;<br />
background: #696969;<br />
}<br />
</style><br />
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /><br />
<title>Georgia Tech iGEM</title><br />
</head><br />
<br />
<body style="text-align: left"><br />
<img id = "logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"></img><br />
<img id = "gtLogo" src = "https://static.igem.org/mediawiki/2013/e/e5/LogoGT%280.01degree%29.png" style = "display:none" alt ="GT logo"></img><br />
<h1 style = "position:fixed; top:20px; right: 15%">iGEM Main Page</h1><br />
<a href="https://2013.igem.org"><br />
<img id = "igem" src = "https://static.igem.org/mediawiki/2013/4/46/Igem_qgem_logo.png" style = "width: 10%; position: fixed; top: 20px; right:10%" alt = "igem logo"></img></a><br />
<img id ="bigCellRest" src =" https://static.igem.org/mediawiki/2013/4/45/BigCellRest.png" style ="display:none"></img><br />
<img id ="bigCell" src =" https://static.igem.org/mediawiki/2013/3/37/BigCell.png" style ="display:none"></img><br />
<div id = "logoMask" style = " background: transparent"><a href ="#sidr"></a></div><br />
<div id = "bigCellMask" style =" background: transparent"></div><br />
<div id ="bigCellText" style ="background: transparent; display: none"><p class ="textLarge">Our Video</p></div><br />
<br />
<div style ="display:block"><br />
<br />
</div><br />
<div id ="menu" style ="display:none; position:absolute" ><p class =" textLarge">Menu</p></div><br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Protocol" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
<div id='screen' style="cursor: pointer"><br />
</div><br />
<iframe id="box" width="630" height="473" src="//www.youtube.com/embed/fVT7BjmMHDQ" frameborder="0" style="display:none"></iframe><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTechTeam:GeorgiaTech2013-10-27T02:30:17Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:GeorgiaTech/mainPage?action=raw&ctype=text/javascript" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<script>$(document).delay(2000);</script><br />
<style type="text/css"><br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
<br />
#footer-box {<br />
display:none;<br />
}<br />
</style><br />
<style type="text/css"><br />
.logo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
padding-top:100px;<br />
width:40%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
#box<br />
{<br />
margin-left:25%;<br />
top:10%;<br />
background: #FFF;<br />
border: 5px;<br />
text-align: center;<br />
position: absolute;<br />
display: none;<br />
}<br />
<br />
#screen<br />
{<br />
position: absolute;<br />
left: 0;<br />
top: 0;<br />
background: #696969;<br />
}<br />
</style><br />
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /><br />
<title>Georgia Tech iGEM</title><br />
</head><br />
<br />
<body style="text-align: left"><br />
<img id = "logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"></img><br />
<img id = "gtLogo" src = "https://static.igem.org/mediawiki/2013/e/e5/LogoGT%280.01degree%29.png" style = "display:none" alt ="GT logo"></img><br />
<a href="https://2013.igem.org"><br />
<img id = "igem" src = "https://static.igem.org/mediawiki/2013/4/46/Igem_qgem_logo.png" style = "width: 10%; position: fixed; top: 20px; right:10%" alt = "igem logo"></img></a><br />
<img id ="bigCellRest" src =" https://static.igem.org/mediawiki/2013/4/45/BigCellRest.png" style ="display:none"></img><br />
<img id ="bigCell" src =" https://static.igem.org/mediawiki/2013/3/37/BigCell.png" style ="display:none"></img><br />
<div id = "logoMask" style = " background: transparent"><a href ="#sidr"></a></div><br />
<div id = "bigCellMask" style =" background: transparent"></div><br />
<div id ="bigCellText" style ="background: transparent; display: none"><p class ="textLarge">Our Video</p></div><br />
<br />
<div style ="display:block"><br />
<br />
</div><br />
<div id ="menu" style ="display:none; position:absolute" ><p class =" textLarge">Menu</p></div><br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Protocol" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
<div id='screen' style="cursor: pointer"><br />
</div><br />
<iframe id="box" width="630" height="473" src="//www.youtube.com/embed/fVT7BjmMHDQ" frameborder="0" style="display:none"></iframe><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTechTeam:GeorgiaTech2013-10-27T02:26:27Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:GeorgiaTech/mainPage?action=raw&ctype=text/javascript" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<script>$(document).delay(2000);</script><br />
<style type="text/css"><br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
<br />
#footer-box {<br />
display:none;<br />
}<br />
</style><br />
<style type="text/css"><br />
.logo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
padding-top:100px;<br />
width:40%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
#box<br />
{<br />
margin-left:25%;<br />
top:10%;<br />
background: #FFF;<br />
border: 5px;<br />
text-align: center;<br />
position: absolute;<br />
display: none;<br />
}<br />
<br />
#screen<br />
{<br />
position: absolute;<br />
left: 0;<br />
top: 0;<br />
background: #696969;<br />
}<br />
</style><br />
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /><br />
<title>Georgia Tech iGEM</title><br />
</head><br />
<br />
<body style="text-align: left"><br />
<img id = "logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"></img><br />
<img id = "gtLogo" src = "https://static.igem.org/mediawiki/2013/e/e5/LogoGT%280.01degree%29.png" style = "display:none" alt ="GT logo"></img><br />
<a href="https://2013.igem.org"><br />
<img id = "igem" src = "https://static.igem.org/mediawiki/2013/4/46/Igem_qgem_logo.png" style = "width: 10%; position: fixed; top: 100px" alt = "igem logo"></img></a><br />
<img id ="bigCellRest" src =" https://static.igem.org/mediawiki/2013/4/45/BigCellRest.png" style ="display:none"></img><br />
<img id ="bigCell" src =" https://static.igem.org/mediawiki/2013/3/37/BigCell.png" style ="display:none"></img><br />
<div id = "logoMask" style = " background: transparent"><a href ="#sidr"></a></div><br />
<div id = "bigCellMask" style =" background: transparent"></div><br />
<div id ="bigCellText" style ="background: transparent; display: none"><p class ="textLarge">Our Video</p></div><br />
<br />
<div style ="display:block"><br />
<br />
</div><br />
<div id ="menu" style ="display:none; position:absolute" ><p class =" textLarge">Menu</p></div><br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Protocol" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
<div id='screen' style="cursor: pointer"><br />
</div><br />
<iframe id="box" width="630" height="473" src="//www.youtube.com/embed/fVT7BjmMHDQ" frameborder="0" style="display:none"></iframe><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTechTeam:GeorgiaTech2013-10-27T02:25:01Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:GeorgiaTech/mainPage?action=raw&ctype=text/javascript" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<script>$(document).delay(2000);</script><br />
<style type="text/css"><br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
<br />
#footer-box {<br />
display:none;<br />
}<br />
</style><br />
<style type="text/css"><br />
.logo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
padding-top:100px;<br />
width:40%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
#box<br />
{<br />
margin-left:25%;<br />
top:10%;<br />
background: #FFF;<br />
border: 5px;<br />
text-align: center;<br />
position: absolute;<br />
display: none;<br />
}<br />
<br />
#screen<br />
{<br />
position: absolute;<br />
left: 0;<br />
top: 0;<br />
background: #696969;<br />
}<br />
</style><br />
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /><br />
<title>Georgia Tech iGEM</title><br />
</head><br />
<br />
<body style="text-align: left"><br />
<img id = "logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"></img><br />
<img id = "gtLogo" src = "https://static.igem.org/mediawiki/2013/e/e5/LogoGT%280.01degree%29.png" style = "display:none" alt ="GT logo"></img><br />
<img src = "https://static.igem.org/mediawiki/2013/4/46/Igem_qgem_logo.png" style = "width: 10%; position: fixed; left: 800px; top: 100px" alt = "igem logo"></img><br />
<img id ="bigCellRest" src =" https://static.igem.org/mediawiki/2013/4/45/BigCellRest.png" style ="display:none"></img><br />
<img id ="bigCell" src =" https://static.igem.org/mediawiki/2013/3/37/BigCell.png" style ="display:none"></img><br />
<div id = "logoMask" style = " background: transparent"><a href ="#sidr"></a></div><br />
<div id = "bigCellMask" style =" background: transparent"></div><br />
<div id ="bigCellText" style ="background: transparent; display: none"><p class ="textLarge">Our Video</p></div><br />
<br />
<div style ="display:block"><br />
<br />
</div><br />
<div id ="menu" style ="display:none; position:absolute" ><p class =" textLarge">Menu</p></div><br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Protocol" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
<div id='screen' style="cursor: pointer"><br />
</div><br />
<iframe id="box" width="630" height="473" src="//www.youtube.com/embed/fVT7BjmMHDQ" frameborder="0" style="display:none"></iframe><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTechTeam:GeorgiaTech2013-10-27T02:24:00Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:GeorgiaTech/mainPage?action=raw&ctype=text/javascript" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<script>$(document).delay(2000);</script><br />
<style type="text/css"><br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
<br />
#footer-box {<br />
display:none;<br />
}<br />
</style><br />
<style type="text/css"><br />
.logo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
padding-top:100px;<br />
width:40%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
#box<br />
{<br />
margin-left:25%;<br />
top:10%;<br />
background: #FFF;<br />
border: 5px;<br />
text-align: center;<br />
position: absolute;<br />
display: none;<br />
}<br />
<br />
#screen<br />
{<br />
position: absolute;<br />
left: 0;<br />
top: 0;<br />
background: #696969;<br />
}<br />
</style><br />
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /><br />
<title>Georgia Tech iGEM</title><br />
</head><br />
<br />
<body style="text-align: left"><br />
<img id = "logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"></img><br />
<img id = "gtLogo" src = "https://static.igem.org/mediawiki/2013/e/e5/LogoGT%280.01degree%29.png" style = "display:none" alt ="GT logo"></img><br />
<img src = "https://static.igem.org/mediawiki/2013/4/46/Igem_qgem_logo.png" style = "width: 10%; position: fixed" alt = "igem logo"></img><br />
<img id ="bigCellRest" src =" https://static.igem.org/mediawiki/2013/4/45/BigCellRest.png" style ="display:none"></img><br />
<img id ="bigCell" src =" https://static.igem.org/mediawiki/2013/3/37/BigCell.png" style ="display:none"></img><br />
<div id = "logoMask" style = " background: transparent"><a href ="#sidr"></a></div><br />
<div id = "bigCellMask" style =" background: transparent"></div><br />
<div id ="bigCellText" style ="background: transparent; display: none"><p class ="textLarge">Our Video</p></div><br />
<br />
<div style ="display:block"><br />
<br />
</div><br />
<div id ="menu" style ="display:none; position:absolute" ><p class =" textLarge">Menu</p></div><br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Protocol" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
<div id='screen' style="cursor: pointer"><br />
</div><br />
<iframe id="box" width="630" height="473" src="//www.youtube.com/embed/fVT7BjmMHDQ" frameborder="0" style="display:none"></iframe><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTechTeam:GeorgiaTech2013-10-27T02:23:31Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:GeorgiaTech/mainPage?action=raw&ctype=text/javascript" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<script>$(document).delay(2000);</script><br />
<style type="text/css"><br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
<br />
#footer-box {<br />
display:none;<br />
}<br />
</style><br />
<style type="text/css"><br />
.logo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
padding-top:100px;<br />
width:40%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
#box<br />
{<br />
margin-left:25%;<br />
top:10%;<br />
background: #FFF;<br />
border: 5px;<br />
text-align: center;<br />
position: absolute;<br />
display: none;<br />
}<br />
<br />
#screen<br />
{<br />
position: absolute;<br />
left: 0;<br />
top: 0;<br />
background: #696969;<br />
}<br />
</style><br />
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /><br />
<title>Georgia Tech iGEM</title><br />
</head><br />
<br />
<body style="text-align: left"><br />
<img id = "logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"></img><br />
<img id = "gtLogo" src = "https://static.igem.org/mediawiki/2013/e/e5/LogoGT%280.01degree%29.png" style = "display:none" alt ="GT logo"></img><br />
<img src = "https://static.igem.org/mediawiki/2013/4/46/Igem_qgem_logo.png" style = "width: 10% position: fixed" alt = "igem logo"></img><br />
<img id ="bigCellRest" src =" https://static.igem.org/mediawiki/2013/4/45/BigCellRest.png" style ="display:none"></img><br />
<img id ="bigCell" src =" https://static.igem.org/mediawiki/2013/3/37/BigCell.png" style ="display:none"></img><br />
<div id = "logoMask" style = " background: transparent"><a href ="#sidr"></a></div><br />
<div id = "bigCellMask" style =" background: transparent"></div><br />
<div id ="bigCellText" style ="background: transparent; display: none"><p class ="textLarge">Our Video</p></div><br />
<br />
<div style ="display:block"><br />
<br />
</div><br />
<div id ="menu" style ="display:none; position:absolute" ><p class =" textLarge">Menu</p></div><br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Protocol" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
<div id='screen' style="cursor: pointer"><br />
</div><br />
<iframe id="box" width="630" height="473" src="//www.youtube.com/embed/fVT7BjmMHDQ" frameborder="0" style="display:none"></iframe><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTechTeam:GeorgiaTech2013-10-27T02:22:10Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:GeorgiaTech/mainPage?action=raw&ctype=text/javascript" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<script>$(document).delay(2000);</script><br />
<style type="text/css"><br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
<br />
#footer-box {<br />
display:none;<br />
}<br />
</style><br />
<style type="text/css"><br />
.logo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
padding-top:100px;<br />
width:40%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
#box<br />
{<br />
margin-left:25%;<br />
top:10%;<br />
background: #FFF;<br />
border: 5px;<br />
text-align: center;<br />
position: absolute;<br />
display: none;<br />
}<br />
<br />
#screen<br />
{<br />
position: absolute;<br />
left: 0;<br />
top: 0;<br />
background: #696969;<br />
}<br />
</style><br />
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /><br />
<title>Georgia Tech iGEM</title><br />
</head><br />
<br />
<body style="text-align: left"><br />
<img id = "logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"></img><br />
<img id = "gtLogo" src = "https://static.igem.org/mediawiki/2013/e/e5/LogoGT%280.01degree%29.png" style = "display:none" alt ="GT logo"></img><br />
<img src = "https://static.igem.org/mediawiki/2013/4/46/Igem_qgem_logo.png" style = "width: 10%" alt = "igem logo"></img><br />
<img id ="bigCellRest" src =" https://static.igem.org/mediawiki/2013/4/45/BigCellRest.png" style ="display:none"></img><br />
<img id ="bigCell" src =" https://static.igem.org/mediawiki/2013/3/37/BigCell.png" style ="display:none"></img><br />
<div id = "logoMask" style = " background: transparent"><a href ="#sidr"></a></div><br />
<div id = "bigCellMask" style =" background: transparent"></div><br />
<div id ="bigCellText" style ="background: transparent; display: none"><p class ="textLarge">Our Video</p></div><br />
<br />
<div style ="display:block"><br />
<br />
</div><br />
<div id ="menu" style ="display:none; position:absolute" ><p class =" textLarge">Menu</p></div><br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Protocol" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
<div id='screen' style="cursor: pointer"><br />
</div><br />
<iframe id="box" width="630" height="473" src="//www.youtube.com/embed/fVT7BjmMHDQ" frameborder="0" style="display:none"></iframe><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTech/templateTeam:GeorgiaTech/template2013-09-28T00:26:59Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<title>Georgia Tech iGEM</title><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:Cornell/stylesheets/app?action=raw&ctype=text/css" type ="text/javascript"></script><br />
<br />
<script><br />
$(document).ready(function() {<br />
<br />
<br />
$("#logo").load(function() {<br />
<br />
$("#logo").sidr();<br />
$('#return').click(function() {<br />
$.sidr('close');<br />
});<br />
});<br />
<br />
$("#logo").hover(function() {<br />
$(this).animate({scale: 1.5, rotate: "+=25"});<br />
}, function() {<br />
$(this).animate({scale: 1, rotate: "-=45"});<br />
$(this).animate({scale: 1, rotate: "+=20"});<br />
});<br />
});<br />
<br />
</script><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<style type="text/css"><br />
body {<br />
padding-top: 0px;<br />
padding-left:100px;<br />
padding-right:18%;<br />
padding-bottom:50px;<br />
background: #f2f2f2;<br />
font-family: 'Droid Sans', Helvetica, sans-serif;<br />
font-size: 14px;<br />
line-height: 27px;<br />
}<br />
<br />
table#toc {<br />
display:none;<br />
}<br />
table{<br />
font-size:14px;<br />
padding-left:100px<br />
}<br />
/*<br />
#footer-box {<br />
display:none;<br />
} */<br />
.logo{<br />
position:fixed;<br />
display: block;<br />
left:85%;<br />
margin-right:auto;<br />
padding-top:5%;<br />
width:15%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
</style><br />
</head><br />
<body> <br />
<a href ="#sidr"><br />
<img id ="logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"/> </a></div><br />
<br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Protocol" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTech/Human_PracticesTeam:GeorgiaTech/Human Practices2013-09-28T00:14:15Z<p>Henry54809: </p>
<hr />
<div>{{:Team:GeorgiaTech/template}}<br />
<br />
==Human Practices==<br />
For the duration of the summer, the biggest question our team struggled with was: how can we make our experiments and cloning projects more efficient? Organisms take time to grow; reactions can take hours to complete. When experiments fail, human resources, money and time are utilized. We found a particular challenge in the incorporation of small (~tens of base pairs) fragments, such as the ribosomal binding site (RBS), into existing BioBrick parts. Most BioBrick parts require the addition of a RBS to express the protein. We found the use of standard or 3A assembly extremely inefficient in assembling RBS with BioBrick parts, and this created a significant bottleneck in our projects’ progress. Our goal was to invent a faster, more efficient method of assembling small sequences, including RBS as our trial candidate, into existing parts compatible with the BioBrick registry.<br />
<br />
After brainstorming a bit, we had an idea: what if during a simple PCR amplification, we could add the RBS BioBrick BBa_B0034 with the right primers? By doing so, the time taken to add RBS to any BioBrick would be reduced to half, and consist of 2 hour PCR reactions and a ligating stage onto a backbone. An easy oligo primer, that could be used in PCR extension and then placed into a vector backbone, would save time, resources, and frustration. The RBS primer is a standard primer that can be used for site directed mutagenesis in all linearized backbones available from the iGEM database<br />
<br />
[[File:RBS Primer.jpg|700px]]<br />
<br />
By running the PCR reaction with these primers, our team saw significant amplification of nearly every BioBrick part that fit our qualifications. This is remarkable since the ATG site was a small site to attach to the part after the ribosomal binding site. After the creation of the BioBrick with the RBS, our project and its progress made significant leaps, moving much faster than we had before. It was a great addition not only to our individual project, but to the synthetic biology community as a whole.<br />
<br />
This approach could launch a new era of synthetic biology that would not need restriction enzymes and ligase for every combination of small parts, but rather a simple primer and a PCR amplification reaction. The next step would be to determine whether a promoter region could be added on in a secondary PCR reaction, obtaining a fully functional part, ready for use and testing in any competent E. coli site. This new practice in synthetic biology could reduce the amount of time needed to conduct experiments, and we could make advances in research in a greater amount of time than we ever have before.</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/Human_PracticesTeam:GeorgiaTech/Human Practices2013-09-28T00:13:55Z<p>Henry54809: </p>
<hr />
<div>{{Team:GeorgiaTech/template}}<br />
<br />
==Human Practices==<br />
For the duration of the summer, the biggest question our team struggled with was: how can we make our experiments and cloning projects more efficient? Organisms take time to grow; reactions can take hours to complete. When experiments fail, human resources, money and time are utilized. We found a particular challenge in the incorporation of small (~tens of base pairs) fragments, such as the ribosomal binding site (RBS), into existing BioBrick parts. Most BioBrick parts require the addition of a RBS to express the protein. We found the use of standard or 3A assembly extremely inefficient in assembling RBS with BioBrick parts, and this created a significant bottleneck in our projects’ progress. Our goal was to invent a faster, more efficient method of assembling small sequences, including RBS as our trial candidate, into existing parts compatible with the BioBrick registry.<br />
<br />
After brainstorming a bit, we had an idea: what if during a simple PCR amplification, we could add the RBS BioBrick BBa_B0034 with the right primers? By doing so, the time taken to add RBS to any BioBrick would be reduced to half, and consist of 2 hour PCR reactions and a ligating stage onto a backbone. An easy oligo primer, that could be used in PCR extension and then placed into a vector backbone, would save time, resources, and frustration. The RBS primer is a standard primer that can be used for site directed mutagenesis in all linearized backbones available from the iGEM database<br />
<br />
[[File:RBS Primer.jpg|700px]]<br />
<br />
By running the PCR reaction with these primers, our team saw significant amplification of nearly every BioBrick part that fit our qualifications. This is remarkable since the ATG site was a small site to attach to the part after the ribosomal binding site. After the creation of the BioBrick with the RBS, our project and its progress made significant leaps, moving much faster than we had before. It was a great addition not only to our individual project, but to the synthetic biology community as a whole.<br />
<br />
This approach could launch a new era of synthetic biology that would not need restriction enzymes and ligase for every combination of small parts, but rather a simple primer and a PCR amplification reaction. The next step would be to determine whether a promoter region could be added on in a secondary PCR reaction, obtaining a fully functional part, ready for use and testing in any competent E. coli site. This new practice in synthetic biology could reduce the amount of time needed to conduct experiments, and we could make advances in research in a greater amount of time than we ever have before.</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/Human_PracticesTeam:GeorgiaTech/Human Practices2013-09-28T00:13:18Z<p>Henry54809: </p>
<hr />
<div>{{Team:GeorgiaTech/template}}<br />
<br />
For the duration of the summer, the biggest question our team struggled with was: how can we make our experiments and cloning projects more efficient? Organisms take time to grow; reactions can take hours to complete. When experiments fail, human resources, money and time are utilized. We found a particular challenge in the incorporation of small (~tens of base pairs) fragments, such as the ribosomal binding site (RBS), into existing BioBrick parts. Most BioBrick parts require the addition of a RBS to express the protein. We found the use of standard or 3A assembly extremely inefficient in assembling RBS with BioBrick parts, and this created a significant bottleneck in our projects’ progress. Our goal was to invent a faster, more efficient method of assembling small sequences, including RBS as our trial candidate, into existing parts compatible with the BioBrick registry.<br />
<br />
After brainstorming a bit, we had an idea: what if during a simple PCR amplification, we could add the RBS BioBrick BBa_B0034 with the right primers? By doing so, the time taken to add RBS to any BioBrick would be reduced to half, and consist of 2 hour PCR reactions and a ligating stage onto a backbone. An easy oligo primer, that could be used in PCR extension and then placed into a vector backbone, would save time, resources, and frustration. The RBS primer is a standard primer that can be used for site directed mutagenesis in all linearized backbones available from the iGEM database<br />
<br />
[[File:RBS Primer.jpg|700px]]<br />
<br />
By running the PCR reaction with these primers, our team saw significant amplification of nearly every BioBrick part that fit our qualifications. This is remarkable since the ATG site was a small site to attach to the part after the ribosomal binding site. After the creation of the BioBrick with the RBS, our project and its progress made significant leaps, moving much faster than we had before. It was a great addition not only to our individual project, but to the synthetic biology community as a whole.<br />
<br />
This approach could launch a new era of synthetic biology that would not need restriction enzymes and ligase for every combination of small parts, but rather a simple primer and a PCR amplification reaction. The next step would be to determine whether a promoter region could be added on in a secondary PCR reaction, obtaining a fully functional part, ready for use and testing in any competent E. coli site. This new practice in synthetic biology could reduce the amount of time needed to conduct experiments, and we could make advances in research in a greater amount of time than we ever have before.</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/Human_PracticesTeam:GeorgiaTech/Human Practices2013-09-28T00:12:55Z<p>Henry54809: </p>
<hr />
<div>{{Team:GeorgiaTech/template}}<br />
For the duration of the summer, the biggest question our team struggled with was: how can we make our experiments and cloning projects more efficient? Organisms take time to grow; reactions can take hours to complete. When experiments fail, human resources, money and time are utilized. We found a particular challenge in the incorporation of small (~tens of base pairs) fragments, such as the ribosomal binding site (RBS), into existing BioBrick parts. Most BioBrick parts require the addition of a RBS to express the protein. We found the use of standard or 3A assembly extremely inefficient in assembling RBS with BioBrick parts, and this created a significant bottleneck in our projects’ progress. Our goal was to invent a faster, more efficient method of assembling small sequences, including RBS as our trial candidate, into existing parts compatible with the BioBrick registry.<br />
<br />
After brainstorming a bit, we had an idea: what if during a simple PCR amplification, we could add the RBS BioBrick BBa_B0034 with the right primers? By doing so, the time taken to add RBS to any BioBrick would be reduced to half, and consist of 2 hour PCR reactions and a ligating stage onto a backbone. An easy oligo primer, that could be used in PCR extension and then placed into a vector backbone, would save time, resources, and frustration. The RBS primer is a standard primer that can be used for site directed mutagenesis in all linearized backbones available from the iGEM database<br />
<br />
[[File:RBS Primer.jpg|700px]]<br />
<br />
By running the PCR reaction with these primers, our team saw significant amplification of nearly every BioBrick part that fit our qualifications. This is remarkable since the ATG site was a small site to attach to the part after the ribosomal binding site. After the creation of the BioBrick with the RBS, our project and its progress made significant leaps, moving much faster than we had before. It was a great addition not only to our individual project, but to the synthetic biology community as a whole.<br />
<br />
This approach could launch a new era of synthetic biology that would not need restriction enzymes and ligase for every combination of small parts, but rather a simple primer and a PCR amplification reaction. The next step would be to determine whether a promoter region could be added on in a secondary PCR reaction, obtaining a fully functional part, ready for use and testing in any competent E. coli site. This new practice in synthetic biology could reduce the amount of time needed to conduct experiments, and we could make advances in research in a greater amount of time than we ever have before.</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/TeamTeam:GeorgiaTech/Team2013-09-28T00:11:52Z<p>Henry54809: Replaced content with "{{:Team:GeorgiaTech/template}}"</p>
<hr />
<div>{{:Team:GeorgiaTech/template}}</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/PartsTeam:GeorgiaTech/Parts2013-09-28T00:10:30Z<p>Henry54809: </p>
<hr />
<div>{{:Team:GeorgiaTech/template}}<br />
<br />
<groupparts>iGEM013 GeorgiaTech</groupparts><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/></div>Henry54809http://2013.igem.org/Team:GeorgiaTech/PartsTeam:GeorgiaTech/Parts2013-09-28T00:10:13Z<p>Henry54809: </p>
<hr />
<div>{{:Team:GeorgiaTech/template}}<br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<groupparts>iGEM013 GeorgiaTech</groupparts></div>Henry54809http://2013.igem.org/Team:GeorgiaTech/PartsTeam:GeorgiaTech/Parts2013-09-28T00:09:39Z<p>Henry54809: Replaced content with "{{:Team:GeorgiaTech/template}}
<groupparts>iGEM013 GeorgiaTech</groupparts>"</p>
<hr />
<div>{{:Team:GeorgiaTech/template}}<br />
<groupparts>iGEM013 GeorgiaTech</groupparts></div>Henry54809http://2013.igem.org/Team:GeorgiaTech/ProtocolTeam:GeorgiaTech/Protocol2013-09-28T00:07:18Z<p>Henry54809: </p>
<hr />
<div>{{:Team:GeorgiaTech/template}}<br />
==Protocol==<br />
*[[Agar_Plates_and_Media_Protocol]]<br />
<br />
*[[Colony_PCR_Protocol]]<br />
<br />
*[[COLONPCR_Protocol]]<br />
<br />
*[[Chemically_Competent_Cells_Protocol]]<br />
<br />
*[[Electrocompetent_Cells_Protocol]]<br />
<br />
*[[Gel_Electrophoresis_Protocol]]<br />
<br />
*[[Chemically_Competent_Transformation]]<br />
<br />
*[[Electroporation]]</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/ProtocolTeam:GeorgiaTech/Protocol2013-09-28T00:03:54Z<p>Henry54809: Created page with "{{:Team:GeorgiaTech/template}} ==Protocol=="</p>
<hr />
<div>{{:Team:GeorgiaTech/template}}<br />
==Protocol==</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/templateTeam:GeorgiaTech/template2013-09-28T00:03:27Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<title>Georgia Tech iGEM</title><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:Cornell/stylesheets/app?action=raw&ctype=text/css" type ="text/javascript"></script><br />
<br />
<script><br />
$(document).ready(function() {<br />
<br />
<br />
$("#logo").load(function() {<br />
<br />
$("#logo").sidr();<br />
$('#return').click(function() {<br />
$.sidr('close');<br />
});<br />
});<br />
<br />
$("#logo").hover(function() {<br />
$(this).animate({scale: 1.5, rotate: "+=25"});<br />
}, function() {<br />
$(this).animate({scale: 1, rotate: "-=45"});<br />
$(this).animate({scale: 1, rotate: "+=20"});<br />
});<br />
});<br />
<br />
</script><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<style type="text/css"><br />
body {<br />
padding-top: 0px;<br />
padding-left:100px;<br />
padding-right:18%;<br />
padding-bottom:50px;<br />
background: #f2f2f2;<br />
font-family: 'Droid Sans', Helvetica, sans-serif;<br />
font-size: 14px;<br />
line-height: 27px;<br />
}<br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
/*<br />
#footer-box {<br />
display:none;<br />
} */<br />
.logo{<br />
position:fixed;<br />
display: block;<br />
left:85%;<br />
margin-right:auto;<br />
padding-top:5%;<br />
width:15%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
</style><br />
</head><br />
<body> <br />
<a href ="#sidr"><br />
<img id ="logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"/> </a></div><br />
<br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Protocol" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/PET-mCherryPET-mCherry2013-09-28T00:00:43Z<p>Henry54809: </p>
<hr />
<div>{{:Team:GeorgiaTech/template}}<br />
'''Pet-mCherry''' is a β-barrel autotransporter with a mCherry passenger. <br />
*[http://parts.igem.org/Part:BBa_K1156000# BBa_K1156000]<br />
<br />
==Motivation==<br />
In 2012 the Georgia Tech iGEM team developed a novel biosensor based off of green fluorescent protein. The sensor consisted of two subunits of the protein that separately were inactive but once dimerized expressed fluorescence. From this project, we began thinking about how we could develop more complex sensing technology in bacteria. Taking into consideration how mammalian cells sense and react to their environment, we started asking the question: Can bacteria express human integrins? <br />
<br />
To start answering this question, we needed to find a way to transport large proteins and anchor them to the outside of the cell. Autodisplay technology seemed like one possible solution to this problem.<br />
<br />
==Design==<br />
In a 2012 paper, a research group from the University of Birmingham demonstrated that the β-barrel PET could successfully transport and translocate the RFP, mCherry.[http://www.microbialcellfactories.com/content/11/1/69|] We wanted to use their construct to determine whether or not PET would be a good candidate for integrin transport.<br />
The sequence that was provided in the paper was already optimized for E. coli expression, however we checked it again. There were also a number of compatibility issues that need to be resolved. To comply with BioBrick standard 10, Phe-76 was re-optimized to remove a EcoRI site withing the part. A T7 promoter with a lacI operator was added with the RBS (AGGA) to the PET_mCherry. A standard assembly 10 prefix and suffix was then added. In future work, other autodisplay technologies are hoped to be tested to express a number of proteins.<br />
[http://www.uniprot.org/uniprot/O68900 Uniprot]<br />
<br />
[[File:PET_mCherry_sequence_map.jpg]]<br />
<br />
Because of a generous offer from IDT for discount synthesis we chose to synthesize our protein construct using their '''gBlock''' method which consists of blocks of 500bp. Our construct fit into 6 blocks.<br />
<br />
Below are the primers that we designed to amplify each block. <br />
Primers:<br />
ig12 SP/Pet_mCherry_b1/0 AGTCAGGAATTCGCGGCCGCTTCTAGAGG<br />
ig13 SP/Pet_mCherry_b2/469 CGTATGAAGGCACCCAGACCGCTAAACTGAAA<br />
ig14 ASP/Pet_mCherry_b1/500 TTTCAGTTTAGCGGTCTGGGTGCCTTCATACG<br />
ig15 SP/Pet_mCherry_b3/928 CGGGTGCTTACAACGTGAACATCAAACTGGAC<br />
ig16 ASP/Pet_mCherry_b2/959 GTCCAGTTTGATGTTCACGTTGTAAGCACCCG<br />
ig17 SP/Pet_mCherry_b4/1352 CAAACTGGAAGGTGCGAACAACCTGCTGC<br />
ig18 ASP/Pet_mCherry_b3/1380 GCAGCAGGTTGTTCGCACCTTCCAGTTTG<br />
ig19 SP/Pet_mCherry_b5/1816 TGTTCACCGGTGTTACCATGACCTACACCGAC<br />
ig20 ASP/Pet_mCherry_b4/1847 GTCGGTGTAGGTCATGGTAACACCGGTGAACA<br />
ig21 SP/Pet_mCherry_b6/2265 GGTTACCAGTTCGACCTGTTCGCTAACGGTGA<br />
ig22 ASP/Pet_mCherry_b5/2296 TCACCGTTAGCGAACAGGTCGAACTGGTAACC<br />
ig23 ASP/Pet_mCherry_b6/2516 ACTCTGCAGCGGCCGCTACTAGTATTATTATC<br />
<br />
==Assembly==<br />
The 6 gBlocks that we synthesized using IDT were assembled using overlap extension PCR.<br />
<br />
==Characterization==<br />
The cells for the colonies BEP1 and BEP3 were characterized using flow cytometry. Our goals for this characterization were to show activity of the LacI operator and confirm the expression of mCherry on the outside of the cell. Cells expressing '''H6''', a single strand antibody that favors fibrin, were used as a '''negative control'''. <br />
<br />
----<br />
<br />
'''Flow cytometry data for PET-mCherry and H6 negative control'''<br />
<br />
[[File:Flow_gate.png|center]] <br />
<br />
Data was gated to capture the population of interest for the control and BEP3. The increase in events outside of the gate post-induction withIPTG for the control indicates cell induced death due to over-expression. Increased expression of mCherry after induction does not induce cytotoxicity.<br />
===Is the LacI operator working?===<br />
'''Yes!'''<br />
[[File:Flow_induction_w-wt.PNG ]]<br />
[[File: Flow_induction_w-wt2.PNG ]]<br />
<br />
=== Is mCherry on the outside of the cell?===<br />
[[File:Antibody_stain.png]]<br />
<br />
==References==<br />
[1]Sevastynovich et al."A generalised module for the selective extracellular accumulation of recombinant proteins." Microbial Cell Factories. 2012.</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/ProjectTeam:GeorgiaTech/Project2013-09-28T00:00:11Z<p>Henry54809: </p>
<hr />
<div>{{:Team:GeorgiaTech/template}}<br />
== '''Overall project''' ==<br />
<br />
Tell us more about your project. Give us background. Use this is the abstract of your project. Be descriptive but concise (1-2 paragraphs)<br />
<br />
*[[PET-mCherry]]<br />
*[[Z-domain]]<br />
*[[Helping Lambert High School]]<br />
<br />
== Project Details==<br />
<br />
<br />
<br />
<br />
<br />
=== Part 2 ===<br />
<br />
<br />
<br />
<br />
<br />
=== The Experiments ===<br />
<br />
<br />
<br />
<br />
=== Part 3 ===<br />
<br />
<br />
<br />
<br />
== Results ==<br />
<br />
<br/><br />
<br/><br />
<br/></div>Henry54809http://2013.igem.org/Team:GeorgiaTech/ProjectTeam:GeorgiaTech/Project2013-09-27T23:59:26Z<p>Henry54809: </p>
<hr />
<div>{{:Team:GeorgiaTech/template}}<br />
== '''Overall project''' ==<br />
<br />
Tell us more about your project. Give us background. Use this is the abstract of your project. Be descriptive but concise (1-2 paragraphs)<br />
<br />
[[PET-mCherry]]<br />
[[Z-domain]]<br />
[[Helping Lambert High School]]<br />
<br />
== Project Details==<br />
<br />
<br />
<br />
<br />
<br />
=== Part 2 ===<br />
<br />
<br />
<br />
<br />
<br />
=== The Experiments ===<br />
<br />
<br />
<br />
<br />
=== Part 3 ===<br />
<br />
<br />
<br />
<br />
== Results ==</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/ProjectTeam:GeorgiaTech/Project2013-09-27T23:57:48Z<p>Henry54809: </p>
<hr />
<div><br />
== '''Overall project''' ==<br />
<br />
Tell us more about your project. Give us background. Use this is the abstract of your project. Be descriptive but concise (1-2 paragraphs)<br />
<br />
[[PET-mCherry]]<br />
[[Z-domain]]<br />
[[Helping Lambert High School]]<br />
<br />
== Project Details==<br />
<br />
<br />
<br />
<br />
<br />
=== Part 2 ===<br />
<br />
<br />
<br />
<br />
<br />
=== The Experiments ===<br />
<br />
<br />
<br />
<br />
=== Part 3 ===<br />
<br />
<br />
<br />
<br />
== Results ==</div>Henry54809http://2013.igem.org/Team:GeorgiaTechTeam:GeorgiaTech2013-09-27T23:56:28Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:GeorgiaTech/mainPage?action=raw&ctype=text/javascript" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<script>$(document).delay(2000);</script><br />
<style type="text/css"><br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
<br />
#footer-box {<br />
display:none;<br />
}<br />
</style><br />
<style type="text/css"><br />
.logo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
padding-top:100px;<br />
width:40%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
#box<br />
{<br />
margin-left:25%;<br />
top:10%;<br />
background: #FFF;<br />
border: 5px;<br />
text-align: center;<br />
position: absolute;<br />
display: none;<br />
}<br />
<br />
#screen<br />
{<br />
position: absolute;<br />
left: 0;<br />
top: 0;<br />
background: #696969;<br />
}<br />
</style><br />
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /><br />
<title>Georgia Tech iGEM</title><br />
</head><br />
<br />
<body style="text-align: left"><br />
<img id = "logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"></img><br />
<img id = "gtLogo" src = "https://static.igem.org/mediawiki/2013/e/e5/LogoGT%280.01degree%29.png" style = "display:none" alt ="GT logo"></img><br />
<br />
<img id ="bigCellRest" src =" https://static.igem.org/mediawiki/2013/4/45/BigCellRest.png" style ="display:none"></img><br />
<img id ="bigCell" src =" https://static.igem.org/mediawiki/2013/3/37/BigCell.png" style ="display:none"></img><br />
<div id = "logoMask" style = " background: transparent"><a href ="#sidr"></a></div><br />
<div id = "bigCellMask" style =" background: transparent"></div><br />
<div id ="bigCellText" style ="background: transparent; display: none"><p class ="textLarge">Our Video</p></div><br />
<br />
<div style ="display:block"><br />
<br />
</div><br />
<div id ="menu" style ="display:none; position:absolute" ><p class =" textLarge">Menu</p></div><br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
<div id='screen' style="cursor: pointer"><br />
</div><br />
<iframe id="box" width="630" height="473" src="//www.youtube.com/embed/fVT7BjmMHDQ" frameborder="0" style="display:none"></iframe><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTech/templateTeam:GeorgiaTech/template2013-09-27T23:52:24Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<title>Georgia Tech iGEM</title><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:Cornell/stylesheets/app?action=raw&ctype=text/css" type ="text/javascript"></script><br />
<br />
<script><br />
$(document).ready(function() {<br />
<br />
<br />
$("#logo").load(function() {<br />
<br />
$("#logo").sidr();<br />
$('#return').click(function() {<br />
$.sidr('close');<br />
});<br />
});<br />
<br />
$("#logo").hover(function() {<br />
$(this).animate({scale: 1.5, rotate: "+=25"});<br />
}, function() {<br />
$(this).animate({scale: 1, rotate: "-=45"});<br />
$(this).animate({scale: 1, rotate: "+=20"});<br />
});<br />
});<br />
<br />
</script><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<style type="text/css"><br />
body {<br />
padding-top: 0px;<br />
padding-left:100px;<br />
padding-right:18%;<br />
padding-bottom:50px;<br />
background: #f2f2f2;<br />
font-family: 'Droid Sans', Helvetica, sans-serif;<br />
font-size: 14px;<br />
line-height: 27px;<br />
}<br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
/*<br />
#footer-box {<br />
display:none;<br />
} */<br />
.logo{<br />
position:fixed;<br />
display: block;<br />
left:85%;<br />
margin-right:auto;<br />
padding-top:5%;<br />
width:15%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
</style><br />
</head><br />
<body> <br />
<a href ="#sidr"><br />
<img id ="logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"/> </a></div><br />
<br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Projects</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Human_Practices" style ="padding-top:8px;padding-bottom:8px">Human Practices</a></li><br />
<br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTech/AttributionsTeam:GeorgiaTech/Attributions2013-09-27T23:44:50Z<p>Henry54809: </p>
<hr />
<div>{{:Team:GeorgiaTech/template}}<br />
=Attributions=<br />
<br />
Our team would like to personally thank the following people and companies for providing donations, monetary or other, that have been critical to our team's success over the summer and in this competition. <br />
<br />
[[File:IDT Logo.png|400px]]<br />
<br />
[[File:Vwr logo.jpg|400px]]<br />
<br />
[[File:Macrogen corp usa.gif|400px]]<br />
<br />
[[File:bmelogo.png|400px]]<br />
<br />
=Faculty=<br />
<br />
*Dr. Thomas Barker<br />
<br />
*Dr. M.G. Finn<br />
<br />
*Dr. Brian Hammer<br />
<br />
*Dr. Mark Styczynski<br />
<br />
*Dr. Kirill Lobachev<br />
<br />
*Dr. Gang Bao<br />
<br />
*Dr. Eric Gaucher<br />
<br />
*Dr. Ravi Bellamkonda<br />
<br />
*Dr. Larry McIntyre<br />
<br />
Each team must clearly attribute work done by the team on this page. They must distinguish work done by the team from work done by others, including the host labs, advisors, instructors, graduate students, and postgraduate masters students.</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/AttributionsTeam:GeorgiaTech/Attributions2013-09-27T23:43:55Z<p>Henry54809: </p>
<hr />
<div>{{:Team:GeorgiaTech/template}}<br />
=Attributions=<br />
<br />
Our team would like to personally thank the following people and companies for providing donations, monetary or other, that have been critical to our team's success over the summer and in this competition. <br />
<br />
[[File:IDT Logo.png|400px]]<br />
<br />
[[File:Vwr logo.jpg|400px]]<br />
<br />
[[File:Macrogen corp usa.gif|400px]]<br />
<br />
[[File:bmelogo.png|400px]]<br />
<br />
=Faculty=<br />
<br />
Dr. Thomas Barker<br />
<br />
Dr. M.G. Finn<br />
<br />
Dr. Brian Hammer<br />
<br />
Dr. Mark Styczynski<br />
<br />
Dr. Kirill Lobachev<br />
<br />
Dr. Gang Bao<br />
<br />
Dr. Eric Gaucher<br />
<br />
Dr. Ravi Bellamkonda<br />
<br />
Dr. Larry McIntyre<br />
<br />
<br />
<br />
<br />
{| style="color:#1b2c8a;background-color:#0c6;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="62%" align="center"<br />
!align="center"|[[Team:GeorgiaTech|Home]]<br />
!align="center"|[[Team:GeorgiaTech/Team|Team]]<br />
!align="center"|[https://igem.org/Team.cgi?year=2013&team_name=GeorgiaTech Official Team Profile]<br />
!align="center"|[[Team:GeorgiaTech/Project|Project]]<br />
!align="center"|[[Team:GeorgiaTech/Parts|Parts Submitted to the Registry]]<br />
!align="center"|[[Team:GeorgiaTech/Modeling|Modeling]]<br />
!align="center"|[[Team:GeorgiaTech/Notebook|Notebook]]<br />
!align="center"|[[Team:GeorgiaTech/Safety|Safety]]<br />
!align="center"|[[Team:GeorgiaTech/Attributions|Attributions]]<br />
|}<br />
<br />
<br />
Each team must clearly attribute work done by the team on this page. They must distinguish work done by the team from work done by others, including the host labs, advisors, instructors, graduate students, and postgraduate masters students.</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/AttributionsTeam:GeorgiaTech/Attributions2013-09-27T23:43:15Z<p>Henry54809: </p>
<hr />
<div>{{:Team:GeorgiaTech:template}}<br />
=Attributions=<br />
<br />
Our team would like to personally thank the following people and companies for providing donations, monetary or other, that have been critical to our team's success over the summer and in this competition. <br />
<br />
[[File:IDT Logo.png|400px]]<br />
<br />
[[File:Vwr logo.jpg|400px]]<br />
<br />
[[File:Macrogen corp usa.gif|400px]]<br />
<br />
[[File:bmelogo.png|400px]]<br />
<br />
=Faculty=<br />
<br />
Dr. Thomas Barker<br />
<br />
Dr. M.G. Finn<br />
<br />
Dr. Brian Hammer<br />
<br />
Dr. Mark Styczynski<br />
<br />
Dr. Kirill Lobachev<br />
<br />
Dr. Gang Bao<br />
<br />
Dr. Eric Gaucher<br />
<br />
Dr. Ravi Bellamkonda<br />
<br />
Dr. Larry McIntyre<br />
<br />
<br />
<br />
<br />
{| style="color:#1b2c8a;background-color:#0c6;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="62%" align="center"<br />
!align="center"|[[Team:GeorgiaTech|Home]]<br />
!align="center"|[[Team:GeorgiaTech/Team|Team]]<br />
!align="center"|[https://igem.org/Team.cgi?year=2013&team_name=GeorgiaTech Official Team Profile]<br />
!align="center"|[[Team:GeorgiaTech/Project|Project]]<br />
!align="center"|[[Team:GeorgiaTech/Parts|Parts Submitted to the Registry]]<br />
!align="center"|[[Team:GeorgiaTech/Modeling|Modeling]]<br />
!align="center"|[[Team:GeorgiaTech/Notebook|Notebook]]<br />
!align="center"|[[Team:GeorgiaTech/Safety|Safety]]<br />
!align="center"|[[Team:GeorgiaTech/Attributions|Attributions]]<br />
|}<br />
<br />
<br />
Each team must clearly attribute work done by the team on this page. They must distinguish work done by the team from work done by others, including the host labs, advisors, instructors, graduate students, and postgraduate masters students.</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/ObjectiveTeam:GeorgiaTech/Objective2013-09-27T23:40:10Z<p>Henry54809: </p>
<hr />
<div>{{:Team:GeorgiaTech/template}}<br />
==Objective==<br />
The objective for our project is ultimately to express human integrins on the surface of E.Coli cells. By expressing human integrins on bacteria cells, we can manipulate the cells to respond to specific stimuli in their environment. The specific integrin we are trying to express on the E.Coli cell has the ability to bind to fibrinogen. If it is successfully placed on the cell, the cell will be able to bind to fibrinogen, effectively coagulating or clotting blood. This has applications in the medical field, where the integrin-containing E.Coli (BioBots, as we like to call them) can be administered as a topical solution and prevent excessive bleeding on major surface wounds. A bacteria’s ability to express integrins has other applications as well. Since the bacteria will be able to send and receive signals to its environment, the bacteria can theoretically detect and locate cancer cells, as well as any other specific cell or structure of concern. These novel bacterial robots will represent the first prokaryotic use of heterodimeric integrins for a sensory function and will represent a platform that will enable future “design” of integrins sensory function through molecular evolution techniques.<br />
<br />
==Background== <br />
===problem statement, previous work, and/or description of need===<br />
<br />
Cells perform their intended functions not individually but collectively by forming temporally evolving, three dimensional structures comprised of clusters of cells, and through active or passive cell-cell and cell-extracellular matrix (ECM) interactions. Thus the development of engineered, integrative cellular systems that self-heal and adapt their microstructure to a variety of stimuli in the surrounding microenvironment will revolutionize the way bioengineers design. The goals of EBICS is to address the grand challenge of engineering multi-cellular biological machines that have desired functionalities and can perform prescribed tasks.These machines consist of sensing, information processing, actuation, protein expression, and transport elements that can be effectively combined to create functional units. Fortunately, nature provides plenty of inspiration through similarly functioning organisms and systems. It is therefore feasible to assume that artificial materials and organisms of the future will incorporate such naturally inspired designs. The imitation of the aforementioned functions will require development of systems similar to specialized cells in the various human tissues. The GT iGEM team will work toward the lofty goal of developing of cells and/or extracellular vesicles (e.g. platelets) that display designer sensory-response behaviors. In particular, small ‘smart’ biobots are an interesting avenue to duplicate the function of cells responsible for repair and adaptation. One of the tools that eukaryotic cells have at their disposal to detect their surroundings are heterodimeric sensor molecules present on the cell surface, known as integrins. Not only do integrins receive and facilitate cellular integration of extracellular cues, but they also support inside-out signaling and thus can dynamically impact their microenvironment. As a consequence of integrin’s critical role in this cell-ECM “dynamic reciprocity”, they represent the ideal sensor to build into a biobot. Synthetic biology applications are traditionally performed in the bacterial systems due to their availability, convenience, and speed. In order to complete our goal of expressing human integrins on the surface of bacterial cells, we will need a variety of lab and research materials necessary to experiment with the cells and eventually incorporate the integrins onto them. We will then need a way to test the effectiveness of the integrins on the cells. All funds given to us will<br />
help cover our lab material expenses.</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/ObjectiveTeam:GeorgiaTech/Objective2013-09-27T23:39:34Z<p>Henry54809: </p>
<hr />
<div>{{:template}}<br />
==Objective==<br />
The objective for our project is ultimately to express human integrins on the surface of E.Coli cells. By expressing human integrins on bacteria cells, we can manipulate the cells to respond to specific stimuli in their environment. The specific integrin we are trying to express on the E.Coli cell has the ability to bind to fibrinogen. If it is successfully placed on the cell, the cell will be able to bind to fibrinogen, effectively coagulating or clotting blood. This has applications in the medical field, where the integrin-containing E.Coli (BioBots, as we like to call them) can be administered as a topical solution and prevent excessive bleeding on major surface wounds. A bacteria’s ability to express integrins has other applications as well. Since the bacteria will be able to send and receive signals to its environment, the bacteria can theoretically detect and locate cancer cells, as well as any other specific cell or structure of concern. These novel bacterial robots will represent the first prokaryotic use of heterodimeric integrins for a sensory function and will represent a platform that will enable future “design” of integrins sensory function through molecular evolution techniques.<br />
<br />
==Background== <br />
===problem statement, previous work, and/or description of need===<br />
<br />
Cells perform their intended functions not individually but collectively by forming temporally evolving, three dimensional structures comprised of clusters of cells, and through active or passive cell-cell and cell-extracellular matrix (ECM) interactions. Thus the development of engineered, integrative cellular systems that self-heal and adapt their microstructure to a variety of stimuli in the surrounding microenvironment will revolutionize the way bioengineers design. The goals of EBICS is to address the grand challenge of engineering multi-cellular biological machines that have desired functionalities and can perform prescribed tasks.These machines consist of sensing, information processing, actuation, protein expression, and transport elements that can be effectively combined to create functional units. Fortunately, nature provides plenty of inspiration through similarly functioning organisms and systems. It is therefore feasible to assume that artificial materials and organisms of the future will incorporate such naturally inspired designs. The imitation of the aforementioned functions will require development of systems similar to specialized cells in the various human tissues. The GT iGEM team will work toward the lofty goal of developing of cells and/or extracellular vesicles (e.g. platelets) that display designer sensory-response behaviors. In particular, small ‘smart’ biobots are an interesting avenue to duplicate the function of cells responsible for repair and adaptation. One of the tools that eukaryotic cells have at their disposal to detect their surroundings are heterodimeric sensor molecules present on the cell surface, known as integrins. Not only do integrins receive and facilitate cellular integration of extracellular cues, but they also support inside-out signaling and thus can dynamically impact their microenvironment. As a consequence of integrin’s critical role in this cell-ECM “dynamic reciprocity”, they represent the ideal sensor to build into a biobot. Synthetic biology applications are traditionally performed in the bacterial systems due to their availability, convenience, and speed. In order to complete our goal of expressing human integrins on the surface of bacterial cells, we will need a variety of lab and research materials necessary to experiment with the cells and eventually incorporate the integrins onto them. We will then need a way to test the effectiveness of the integrins on the cells. All funds given to us will<br />
help cover our lab material expenses.</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/templateTeam:GeorgiaTech/template2013-09-27T23:38:59Z<p>Henry54809: Created page with "<html xmlns="http://www.w3.org/1999/xhtml"> <head> <title>Georgia Tech iGEM</title> <script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javas..."</p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<title>Georgia Tech iGEM</title><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:Cornell/stylesheets/app?action=raw&ctype=text/css" type ="text/javascript"></script><br />
<br />
<script><br />
$(document).ready(function() {<br />
<br />
<br />
$("#logo").load(function() {<br />
<br />
$("#logo").sidr();<br />
$('#return').click(function() {<br />
$.sidr('close');<br />
});<br />
});<br />
<br />
$("#logo").hover(function() {<br />
$(this).animate({scale: 1.5, rotate: "+=25"});<br />
}, function() {<br />
$(this).animate({scale: 1, rotate: "-=45"});<br />
$(this).animate({scale: 1, rotate: "+=20"});<br />
});<br />
});<br />
<br />
</script><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<style type="text/css"><br />
body {<br />
padding-top: 0px;<br />
padding-left:100px;<br />
padding-right:18%;<br />
padding-bottom:50px;<br />
background: #f2f2f2;<br />
font-family: 'Droid Sans', Helvetica, sans-serif;<br />
font-size: 14px;<br />
line-height: 27px;<br />
}<br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
/*<br />
#footer-box {<br />
display:none;<br />
} */<br />
.logo{<br />
position:fixed;<br />
display: block;<br />
left:85%;<br />
margin-right:auto;<br />
padding-top:5%;<br />
width:15%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
</style><br />
</head><br />
<body> <br />
<a href ="#sidr"><br />
<img id ="logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"/> </a></div><br />
<br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Project</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">High School Project</a></li><br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
</body><br />
</html></div>Henry54809http://2013.igem.org/Team:GeorgiaTech/ObjectiveTeam:GeorgiaTech/Objective2013-09-27T23:36:53Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<title>Georgia Tech iGEM</title><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:Cornell/stylesheets/app?action=raw&ctype=text/css" type ="text/javascript"></script><br />
<br />
<script><br />
$(document).ready(function() {<br />
<br />
<br />
$("#logo").load(function() {<br />
<br />
$("#logo").sidr();<br />
$('#return').click(function() {<br />
$.sidr('close');<br />
});<br />
});<br />
<br />
$("#logo").hover(function() {<br />
$(this).animate({scale: 1.5, rotate: "+=25"});<br />
}, function() {<br />
$(this).animate({scale: 1, rotate: "-=45"});<br />
$(this).animate({scale: 1, rotate: "+=20"});<br />
});<br />
});<br />
<br />
</script><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<style type="text/css"><br />
body {<br />
padding-top: 0px;<br />
padding-left:100px;<br />
padding-right:18%;<br />
padding-bottom:50px;<br />
background: #f2f2f2;<br />
font-family: 'Droid Sans', Helvetica, sans-serif;<br />
font-size: 14px;<br />
line-height: 27px;<br />
}<br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
/*<br />
#footer-box {<br />
display:none;<br />
} */<br />
.logo{<br />
position:fixed;<br />
display: block;<br />
left:85%;<br />
margin-right:auto;<br />
padding-top:5%;<br />
width:15%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
</style><br />
</head><br />
<body> <br />
<a href ="#sidr"><br />
<img id ="logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"/> </a></div><br />
<br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Project</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">High School Project</a></li><br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
</body><br />
</html><br />
==Objective==<br />
The objective for our project is ultimately to express human integrins on the surface of E.Coli cells. By expressing human integrins on bacteria cells, we can manipulate the cells to respond to specific stimuli in their environment. The specific integrin we are trying to express on the E.Coli cell has the ability to bind to fibrinogen. If it is successfully placed on the cell, the cell will be able to bind to fibrinogen, effectively coagulating or clotting blood. This has applications in the medical field, where the integrin-containing E.Coli (BioBots, as we like to call them) can be administered as a topical solution and prevent excessive bleeding on major surface wounds. A bacteria’s ability to express integrins has other applications as well. Since the bacteria will be able to send and receive signals to its environment, the bacteria can theoretically detect and locate cancer cells, as well as any other specific cell or structure of concern. These novel bacterial robots will represent the first prokaryotic use of heterodimeric integrins for a sensory function and will represent a platform that will enable future “design” of integrins sensory function through molecular evolution techniques.<br />
<br />
==Background== <br />
===problem statement, previous work, and/or description of need===<br />
<br />
Cells perform their intended functions not individually but collectively by forming temporally evolving, three dimensional structures comprised of clusters of cells, and through active or passive cell-cell and cell-extracellular matrix (ECM) interactions. Thus the development of engineered, integrative cellular systems that self-heal and adapt their microstructure to a variety of stimuli in the surrounding microenvironment will revolutionize the way bioengineers design. The goals of EBICS is to address the grand challenge of engineering multi-cellular biological machines that have desired functionalities and can perform prescribed tasks.These machines consist of sensing, information processing, actuation, protein expression, and transport elements that can be effectively combined to create functional units. Fortunately, nature provides plenty of inspiration through similarly functioning organisms and systems. It is therefore feasible to assume that artificial materials and organisms of the future will incorporate such naturally inspired designs. The imitation of the aforementioned functions will require development of systems similar to specialized cells in the various human tissues. The GT iGEM team will work toward the lofty goal of developing of cells and/or extracellular vesicles (e.g. platelets) that display designer sensory-response behaviors. In particular, small ‘smart’ biobots are an interesting avenue to duplicate the function of cells responsible for repair and adaptation. One of the tools that eukaryotic cells have at their disposal to detect their surroundings are heterodimeric sensor molecules present on the cell surface, known as integrins. Not only do integrins receive and facilitate cellular integration of extracellular cues, but they also support inside-out signaling and thus can dynamically impact their microenvironment. As a consequence of integrin’s critical role in this cell-ECM “dynamic reciprocity”, they represent the ideal sensor to build into a biobot. Synthetic biology applications are traditionally performed in the bacterial systems due to their availability, convenience, and speed. In order to complete our goal of expressing human integrins on the surface of bacterial cells, we will need a variety of lab and research materials necessary to experiment with the cells and eventually incorporate the integrins onto them. We will then need a way to test the effectiveness of the integrins on the cells. All funds given to us will<br />
help cover our lab material expenses.</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/ObjectiveTeam:GeorgiaTech/Objective2013-09-27T23:34:23Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<title>Georgia Tech iGEM</title><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:Cornell/stylesheets/app?action=raw&ctype=text/css" type ="text/javascript"></script><br />
<br />
<script><br />
$(document).ready(function() {<br />
<br />
<br />
$("#logo").load(function() {<br />
<br />
$("#logo").sidr();<br />
$('#return').click(function() {<br />
$.sidr('close');<br />
});<br />
});<br />
<br />
$("#logo").hover(function() {<br />
$(this).animate({scale: 1.5, rotate: "+=25"});<br />
}, function() {<br />
$(this).animate({scale: 1, rotate: "-=45"});<br />
$(this).animate({scale: 1, rotate: "+=20"});<br />
});<br />
});<br />
<br />
</script><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<style type="text/css"><br />
body {<br />
padding-top: 0px;<br />
padding-left:100px;<br />
padding-right:18%;<br />
padding-bottom:50px;<br />
background: #f2f2f2;<br />
font-family: 'Droid Sans', Helvetica, sans-serif;<br />
font-size: 14px;<br />
line-height: 27px;<br />
}<br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
/*<br />
#footer-box {<br />
display:none;<br />
} */<br />
.logo{<br />
position:fixed;<br />
display: block;<br />
left:85%;<br />
margin-right:auto;<br />
padding-top:5%;<br />
width:15%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
</style><br />
</head><br />
<body> <br />
<a href ="#sidr"><br />
<img id ="logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"/> </a></div><br />
<br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Project</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">High School Project</a></li><br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
</body><br />
</html><br />
==Objective==<br />
The objective for our project is ultimately to express human integrins on the surface of E.Coli cells. By expressing human integrins on bacteria cells, we can manipulate the cells to respond to specific stimuli in their environment. The specific integrin we are trying to express on the E.Coli cell has the ability to bind to fibrinogen. If it is successfully placed on the cell, the cell will be able to bind to fibrinogen, effectively coagulating or clotting blood. This has applications in the medical field, where the integrin-containing E.Coli (BioBots, as we like to call them) can be administered as a topical solution and prevent excessive bleeding on major surface wounds. A bacteria’s ability to express integrins has other applications as well. Since the bacteria will be able to send and receive signals to its environment, the bacteria can theoretically detect and locate cancer cells, as well as any other specific cell or structure of concern. These novel bacterial robots will represent the first prokaryotic use of heterodimeric integrins for a sensory function and will represent a platform that will enable future “design” of integrins sensory function through molecular evolution techniques.<br />
<br />
==Background== <br />
===problem statement, previous work, and/or description of need===<br />
<br />
Cells perform their intended functions not individually but collectively by forming temporally evolving, three dimensional structures <br />
<br />
comprised of clusters of cells, and through active or passive cell-cell and cell-extracellular matrix (ECM) interactions. <br />
<br />
Thus the development of engineered, integrative cellular systems that self-heal and adapt their microstructure to a variety of stimuli <br />
<br />
in the surrounding microenvironment will revolutionize the way bioengineers design. The goals of EBICS is to address the grand challenge <br />
<br />
of engineering multi-cellular biological machines that have desired functionalities and can perform prescribed tasks. <br />
<br />
These machines consist of sensing, information processing, actuation, protein expression, and transport elements that can be <br />
<br />
effectively combined to create functional units. Fortunately, nature provides plenty of inspiration through similarly functioning <br />
<br />
organisms and systems. It is therefore feasible to assume that artificial materials and organisms of the future will incorporate such <br />
<br />
naturally inspired designs. The imitation of the aforementioned functions will require development of systems similar to specialized cells in the <br />
<br />
various human tissues. The GT iGEM team will work toward the lofty goal of developing of cells and/or extracellular vesicles <br />
<br />
(e.g. platelets) that display designer sensory-response behaviors. In particular, small ‘smart’ biobots are an interesting <br />
<br />
avenue to duplicate the function of cells responsible for repair and adaptation. <br />
<br />
One of the tools that eukaryotic cells have at their disposal to detect their surroundings are heterodimeric sensor <br />
<br />
molecules present on the cell surface, known as integrins. Not only do integrins receive and facilitate cellular integration <br />
<br />
of extracellular cues, but they also support inside-out signaling and thus can dynamically impact their microenvironment. <br />
<br />
As a consequence of integrin’s critical role in this cell-ECM “dynamic reciprocity”, they represent the ideal sensor to build <br />
<br />
into a biobot. Synthetic biology applications are traditionally performed in the bacterial systems due to their availability, <br />
<br />
convenience, and speed. In order to complete our goal of expressing human integrins on the surface of bacterial cells, <br />
<br />
we will need a variety of lab and research materials necessary to experiment with the cells and eventually incorporate the <br />
<br />
integrins onto them. We will then need a way to test the effectiveness of the integrins on the cells. All funds given to us will <br />
<br />
help cover our lab material expenses.</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/ObjectiveTeam:GeorgiaTech/Objective2013-09-27T23:33:22Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<title>Georgia Tech iGEM</title><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:Cornell/stylesheets/app?action=raw&ctype=text/css" type ="text/javascript"></script><br />
<br />
<script><br />
$(document).ready(function() {<br />
<br />
<br />
$("#logo").load(function() {<br />
<br />
$("#logo").sidr();<br />
$('#return').click(function() {<br />
$.sidr('close');<br />
});<br />
});<br />
<br />
$("#logo").hover(function() {<br />
$(this).animate({scale: 1.5, rotate: "+=25"});<br />
}, function() {<br />
$(this).animate({scale: 1, rotate: "-=45"});<br />
$(this).animate({scale: 1, rotate: "+=20"});<br />
});<br />
});<br />
<br />
</script><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<style type="text/css"><br />
body {<br />
padding-top: 0px;<br />
padding-left:100px;<br />
padding-right:20%;<br />
padding-bottom:50px;<br />
background: #f2f2f2;<br />
font-family: 'Droid Sans', Helvetica, sans-serif;<br />
font-size: 14px;<br />
line-height: 25px;<br />
}<br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
/*<br />
#footer-box {<br />
display:none;<br />
} */<br />
.logo{<br />
position:fixed;<br />
display: block;<br />
left:85%;<br />
margin-right:auto;<br />
padding-top:5%;<br />
width:15%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
</style><br />
</head><br />
<body> <br />
<a href ="#sidr"><br />
<img id ="logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"/> </a></div><br />
<br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Project</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">High School Project</a></li><br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
</body><br />
</html><br />
==Objective==<br />
The objective for our project is ultimately to express human integrins on the surface of E.Coli cells. By expressing human integrins on bacteria cells, we can manipulate the cells to respond to specific stimuli in their environment. The specific integrin we are trying to express on the E.Coli cell has the ability to bind to fibrinogen. If it is successfully placed on the cell, the cell will be able to bind to fibrinogen, effectively coagulating or clotting blood. This has applications in the medical field, where the integrin-containing E.Coli (BioBots, as we like to call them) can be administered as a topical solution and prevent excessive bleeding on major surface wounds. A bacteria’s ability to express integrins has other applications as well. Since the bacteria will be able to send and receive signals to its environment, the bacteria can theoretically detect and locate cancer cells, as well as any other specific cell or structure of concern. These novel bacterial robots will represent the first prokaryotic use of heterodimeric integrins for a sensory function and will represent a platform that will enable future “design” of integrins sensory function through molecular evolution techniques.<br />
<br />
==Background== <br />
===problem statement, previous work, and/or description of need===<br />
<br />
Cells perform their intended functions not individually but collectively by forming temporally evolving, three dimensional structures <br />
<br />
comprised of clusters of cells, and through active or passive cell-cell and cell-extracellular matrix (ECM) interactions. <br />
<br />
Thus the development of engineered, integrative cellular systems that self-heal and adapt their microstructure to a variety of stimuli <br />
<br />
in the surrounding microenvironment will revolutionize the way bioengineers design. The goals of EBICS is to address the grand challenge <br />
<br />
of engineering multi-cellular biological machines that have desired functionalities and can perform prescribed tasks. <br />
<br />
These machines consist of sensing, information processing, actuation, protein expression, and transport elements that can be <br />
<br />
effectively combined to create functional units. Fortunately, nature provides plenty of inspiration through similarly functioning <br />
<br />
organisms and systems. It is therefore feasible to assume that artificial materials and organisms of the future will incorporate such <br />
<br />
naturally inspired designs. The imitation of the aforementioned functions will require development of systems similar to specialized cells in the <br />
<br />
various human tissues. The GT iGEM team will work toward the lofty goal of developing of cells and/or extracellular vesicles <br />
<br />
(e.g. platelets) that display designer sensory-response behaviors. In particular, small ‘smart’ biobots are an interesting <br />
<br />
avenue to duplicate the function of cells responsible for repair and adaptation. <br />
<br />
One of the tools that eukaryotic cells have at their disposal to detect their surroundings are heterodimeric sensor <br />
<br />
molecules present on the cell surface, known as integrins. Not only do integrins receive and facilitate cellular integration <br />
<br />
of extracellular cues, but they also support inside-out signaling and thus can dynamically impact their microenvironment. <br />
<br />
As a consequence of integrin’s critical role in this cell-ECM “dynamic reciprocity”, they represent the ideal sensor to build <br />
<br />
into a biobot. Synthetic biology applications are traditionally performed in the bacterial systems due to their availability, <br />
<br />
convenience, and speed. In order to complete our goal of expressing human integrins on the surface of bacterial cells, <br />
<br />
we will need a variety of lab and research materials necessary to experiment with the cells and eventually incorporate the <br />
<br />
integrins onto them. We will then need a way to test the effectiveness of the integrins on the cells. All funds given to us will <br />
<br />
help cover our lab material expenses.</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/ObjectiveTeam:GeorgiaTech/Objective2013-09-27T23:32:49Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<title>Georgia Tech iGEM</title><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:Cornell/stylesheets/app?action=raw&ctype=text/css" type ="text/javascript"></script><br />
<br />
<script><br />
$(document).ready(function() {<br />
<br />
<br />
$("#logo").load(function() {<br />
<br />
$("#logo").sidr();<br />
$('#return').click(function() {<br />
$.sidr('close');<br />
});<br />
});<br />
<br />
$("#logo").hover(function() {<br />
$(this).animate({scale: 1.5, rotate: "+=25"});<br />
}, function() {<br />
$(this).animate({scale: 1, rotate: "-=45"});<br />
$(this).animate({scale: 1, rotate: "+=20"});<br />
});<br />
});<br />
<br />
</script><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<style type="text/css"><br />
body {<br />
padding-top: 0px;<br />
padding-left:100px;<br />
padding-right:20%;<br />
padding-bottom:50px;<br />
background: #f2f2f2;<br />
font-family: 'Droid Sans', Helvetica, sans-serif;<br />
font-size: 14px;<br />
line-height: 23px;<br />
}<br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
/*<br />
#footer-box {<br />
display:none;<br />
} */<br />
.logo{<br />
position:fixed;<br />
display: block;<br />
left:85%;<br />
margin-right:auto;<br />
padding-top:5%;<br />
width:15%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
</style><br />
</head><br />
<body> <br />
<a href ="#sidr"><br />
<img id ="logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"/> </a></div><br />
<br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Project</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">High School Project</a></li><br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
</body><br />
</html><br />
==Objective==<br />
The objective for our project is ultimately to express human integrins on the surface of E.Coli cells. By expressing human integrins on bacteria cells, we can manipulate the cells to respond to specific stimuli in their environment. The specific integrin we are trying to express on the E.Coli cell has the ability to bind to fibrinogen. If it is successfully placed on the cell, the cell will be able to bind to fibrinogen, effectively coagulating or clotting blood. This has applications in the medical field, where the integrin-containing E.Coli (BioBots, as we like to call them) can be administered as a topical solution and prevent excessive bleeding on major surface wounds. A bacteria’s ability to express integrins has other applications as well. Since the bacteria will be able to send and receive signals to its environment, the bacteria can theoretically detect and locate cancer cells, as well as any other specific cell or structure of concern. These novel bacterial robots will represent the first prokaryotic use of heterodimeric integrins for a sensory function and will represent a platform that will enable future “design” of integrins sensory function through molecular evolution techniques.<br />
<br />
==Background== <br />
===problem statement, previous work, and/or description of need===<br />
<br />
Cells perform their intended functions not individually but collectively by forming temporally evolving, three dimensional structures <br />
<br />
comprised of clusters of cells, and through active or passive cell-cell and cell-extracellular matrix (ECM) interactions. <br />
<br />
Thus the development of engineered, integrative cellular systems that self-heal and adapt their microstructure to a variety of stimuli <br />
<br />
in the surrounding microenvironment will revolutionize the way bioengineers design. The goals of EBICS is to address the grand challenge <br />
<br />
of engineering multi-cellular biological machines that have desired functionalities and can perform prescribed tasks. <br />
<br />
These machines consist of sensing, information processing, actuation, protein expression, and transport elements that can be <br />
<br />
effectively combined to create functional units. Fortunately, nature provides plenty of inspiration through similarly functioning <br />
<br />
organisms and systems. It is therefore feasible to assume that artificial materials and organisms of the future will incorporate such <br />
<br />
naturally inspired designs. The imitation of the aforementioned functions will require development of systems similar to specialized cells in the <br />
<br />
various human tissues. The GT iGEM team will work toward the lofty goal of developing of cells and/or extracellular vesicles <br />
<br />
(e.g. platelets) that display designer sensory-response behaviors. In particular, small ‘smart’ biobots are an interesting <br />
<br />
avenue to duplicate the function of cells responsible for repair and adaptation. <br />
<br />
One of the tools that eukaryotic cells have at their disposal to detect their surroundings are heterodimeric sensor <br />
<br />
molecules present on the cell surface, known as integrins. Not only do integrins receive and facilitate cellular integration <br />
<br />
of extracellular cues, but they also support inside-out signaling and thus can dynamically impact their microenvironment. <br />
<br />
As a consequence of integrin’s critical role in this cell-ECM “dynamic reciprocity”, they represent the ideal sensor to build <br />
<br />
into a biobot. Synthetic biology applications are traditionally performed in the bacterial systems due to their availability, <br />
<br />
convenience, and speed. In order to complete our goal of expressing human integrins on the surface of bacterial cells, <br />
<br />
we will need a variety of lab and research materials necessary to experiment with the cells and eventually incorporate the <br />
<br />
integrins onto them. We will then need a way to test the effectiveness of the integrins on the cells. All funds given to us will <br />
<br />
help cover our lab material expenses.</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/ObjectiveTeam:GeorgiaTech/Objective2013-09-27T23:32:21Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<title>Georgia Tech iGEM</title><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:Cornell/stylesheets/app?action=raw&ctype=text/css" type ="text/javascript"></script><br />
<br />
<script><br />
$(document).ready(function() {<br />
<br />
<br />
$("#logo").load(function() {<br />
<br />
$("#logo").sidr();<br />
$('#return').click(function() {<br />
$.sidr('close');<br />
});<br />
});<br />
<br />
$("#logo").hover(function() {<br />
$(this).animate({scale: 1.5, rotate: "+=25"});<br />
}, function() {<br />
$(this).animate({scale: 1, rotate: "-=45"});<br />
$(this).animate({scale: 1, rotate: "+=20"});<br />
});<br />
});<br />
<br />
</script><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<style type="text/css"><br />
body {<br />
padding-top: 0px;<br />
padding-left:100px;<br />
padding-right:30%;<br />
padding-bottom:50px;<br />
background: #f2f2f2;<br />
font-family: 'Droid Sans', Helvetica, sans-serif;<br />
font-size: 13px;<br />
line-height: 23px;<br />
}<br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
/*<br />
#footer-box {<br />
display:none;<br />
} */<br />
.logo{<br />
position:fixed;<br />
display: block;<br />
left:85%;<br />
margin-right:auto;<br />
padding-top:5%;<br />
width:15%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
</style><br />
</head><br />
<body> <br />
<a href ="#sidr"><br />
<img id ="logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"/> </a></div><br />
<br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Project</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">High School Project</a></li><br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
</body><br />
</html><br />
==Objective==<br />
The objective for our project is ultimately to express human integrins on the surface of E.Coli cells. By expressing human integrins on bacteria cells, we can manipulate the cells to respond to specific stimuli in their environment. The specific integrin we are trying to express on the E.Coli cell has the ability to bind to fibrinogen. If it is successfully placed on the cell, the cell will be able to bind to fibrinogen, effectively coagulating or clotting blood. This has applications in the medical field, where the integrin-containing E.Coli (BioBots, as we like to call them) can be administered as a topical solution and prevent excessive bleeding on major surface wounds. A bacteria’s ability to express integrins has other applications as well. Since the bacteria will be able to send and receive signals to its environment, the bacteria can theoretically detect and locate cancer cells, as well as any other specific cell or structure of concern. These novel bacterial robots will represent the first prokaryotic use of heterodimeric integrins for a sensory function and will represent a platform that will enable future “design” of integrins sensory function through molecular evolution techniques.<br />
<br />
==Background== <br />
===problem statement, previous work, and/or description of need===<br />
<br />
Cells perform their intended functions not individually but collectively by forming temporally evolving, three dimensional structures <br />
<br />
comprised of clusters of cells, and through active or passive cell-cell and cell-extracellular matrix (ECM) interactions. <br />
<br />
Thus the development of engineered, integrative cellular systems that self-heal and adapt their microstructure to a variety of stimuli <br />
<br />
in the surrounding microenvironment will revolutionize the way bioengineers design. The goals of EBICS is to address the grand challenge <br />
<br />
of engineering multi-cellular biological machines that have desired functionalities and can perform prescribed tasks. <br />
<br />
These machines consist of sensing, information processing, actuation, protein expression, and transport elements that can be <br />
<br />
effectively combined to create functional units. Fortunately, nature provides plenty of inspiration through similarly functioning <br />
<br />
organisms and systems. It is therefore feasible to assume that artificial materials and organisms of the future will incorporate such <br />
<br />
naturally inspired designs. The imitation of the aforementioned functions will require development of systems similar to specialized cells in the <br />
<br />
various human tissues. The GT iGEM team will work toward the lofty goal of developing of cells and/or extracellular vesicles <br />
<br />
(e.g. platelets) that display designer sensory-response behaviors. In particular, small ‘smart’ biobots are an interesting <br />
<br />
avenue to duplicate the function of cells responsible for repair and adaptation. <br />
<br />
One of the tools that eukaryotic cells have at their disposal to detect their surroundings are heterodimeric sensor <br />
<br />
molecules present on the cell surface, known as integrins. Not only do integrins receive and facilitate cellular integration <br />
<br />
of extracellular cues, but they also support inside-out signaling and thus can dynamically impact their microenvironment. <br />
<br />
As a consequence of integrin’s critical role in this cell-ECM “dynamic reciprocity”, they represent the ideal sensor to build <br />
<br />
into a biobot. Synthetic biology applications are traditionally performed in the bacterial systems due to their availability, <br />
<br />
convenience, and speed. In order to complete our goal of expressing human integrins on the surface of bacterial cells, <br />
<br />
we will need a variety of lab and research materials necessary to experiment with the cells and eventually incorporate the <br />
<br />
integrins onto them. We will then need a way to test the effectiveness of the integrins on the cells. All funds given to us will <br />
<br />
help cover our lab material expenses.</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/ObjectiveTeam:GeorgiaTech/Objective2013-09-27T23:30:46Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<title>Georgia Tech iGEM</title><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:Cornell/stylesheets/app?action=raw&ctype=text/css" type ="text/javascript"></script><br />
<br />
<script><br />
$(document).ready(function() {<br />
<br />
<br />
$("#logo").load(function() {<br />
<br />
$("#logo").sidr();<br />
$('#return').click(function() {<br />
$.sidr('close');<br />
});<br />
});<br />
<br />
$("#logo").hover(function() {<br />
$(this).animate({scale: 1.5, rotate: "+=25"});<br />
}, function() {<br />
$(this).animate({scale: 1, rotate: "-=45"});<br />
$(this).animate({scale: 1, rotate: "+=20"});<br />
});<br />
});<br />
<br />
</script><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<style type="text/css"><br />
body {<br />
padding-top: 0px;<br />
padding-left:100px;<br />
padding-right:300px;<br />
padding-bottom:50px;<br />
background: #f2f2f2;<br />
font-family: 'Droid Sans', Helvetica, sans-serif;<br />
font-size: 12px;<br />
line-height: 23px;<br />
}<br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
<br />
#footer-box {<br />
display:none;<br />
}<br />
.logo{<br />
position:fixed;<br />
display: block;<br />
left:85%;<br />
margin-right:auto;<br />
padding-top:5%;<br />
width:15%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
</style><br />
</head><br />
<body> <br />
<a href ="#sidr"><br />
<img id ="logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"/> </a></div><br />
<br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Project</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">High School Project</a></li><br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
</body><br />
</html><br />
==Objective==<br />
The objective for our project is ultimately to express human integrins on the surface of E.Coli cells. By expressing human integrins on bacteria cells, we can manipulate the cells to respond to specific stimuli in their environment. The specific integrin we are trying to express on the E.Coli cell has the ability to bind to fibrinogen. If it is successfully placed on the cell, the cell will be able to bind to fibrinogen, effectively coagulating or clotting blood. This has applications in the medical field, where the integrin-containing E.Coli (BioBots, as we like to call them) can be administered as a topical solution and prevent excessive bleeding on major surface wounds. A bacteria’s ability to express integrins has other applications as well. Since the bacteria will be able to send and receive signals to its environment, the bacteria can theoretically detect and locate cancer cells, as well as any other specific cell or structure of concern. These novel bacterial robots will represent the first prokaryotic use of heterodimeric integrins for a sensory function and will represent a platform that will enable future “design” of integrins sensory function through molecular evolution techniques.<br />
<br />
==Background== <br />
===problem statement, previous work, and/or description of need===<br />
<br />
Cells perform their intended functions not individually but collectively by forming temporally evolving, three dimensional structures <br />
<br />
comprised of clusters of cells, and through active or passive cell-cell and cell-extracellular matrix (ECM) interactions. <br />
<br />
Thus the development of engineered, integrative cellular systems that self-heal and adapt their microstructure to a variety of stimuli <br />
<br />
in the surrounding microenvironment will revolutionize the way bioengineers design. The goals of EBICS is to address the grand challenge <br />
<br />
of engineering multi-cellular biological machines that have desired functionalities and can perform prescribed tasks. <br />
<br />
These machines consist of sensing, information processing, actuation, protein expression, and transport elements that can be <br />
<br />
effectively combined to create functional units. Fortunately, nature provides plenty of inspiration through similarly functioning <br />
<br />
organisms and systems. It is therefore feasible to assume that artificial materials and organisms of the future will incorporate such <br />
<br />
naturally inspired designs. The imitation of the aforementioned functions will require development of systems similar to specialized cells in the <br />
<br />
various human tissues. The GT iGEM team will work toward the lofty goal of developing of cells and/or extracellular vesicles <br />
<br />
(e.g. platelets) that display designer sensory-response behaviors. In particular, small ‘smart’ biobots are an interesting <br />
<br />
avenue to duplicate the function of cells responsible for repair and adaptation. <br />
<br />
One of the tools that eukaryotic cells have at their disposal to detect their surroundings are heterodimeric sensor <br />
<br />
molecules present on the cell surface, known as integrins. Not only do integrins receive and facilitate cellular integration <br />
<br />
of extracellular cues, but they also support inside-out signaling and thus can dynamically impact their microenvironment. <br />
<br />
As a consequence of integrin’s critical role in this cell-ECM “dynamic reciprocity”, they represent the ideal sensor to build <br />
<br />
into a biobot. Synthetic biology applications are traditionally performed in the bacterial systems due to their availability, <br />
<br />
convenience, and speed. In order to complete our goal of expressing human integrins on the surface of bacterial cells, <br />
<br />
we will need a variety of lab and research materials necessary to experiment with the cells and eventually incorporate the <br />
<br />
integrins onto them. We will then need a way to test the effectiveness of the integrins on the cells. All funds given to us will <br />
<br />
help cover our lab material expenses.</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/ObjectiveTeam:GeorgiaTech/Objective2013-09-27T23:29:20Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<title>Georgia Tech iGEM</title><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:Cornell/stylesheets/app?action=raw&ctype=text/css" type ="text/javascript"></script><br />
<br />
<script><br />
$(document).ready(function() {<br />
<br />
<br />
$("#logo").load(function() {<br />
<br />
$("#logo").sidr();<br />
$('#return').click(function() {<br />
$.sidr('close');<br />
});<br />
});<br />
<br />
$("#logo").hover(function() {<br />
$(this).animate({scale: 1.5, rotate: "+=25"});<br />
}, function() {<br />
$(this).animate({scale: 1, rotate: "-=45"});<br />
$(this).animate({scale: 1, rotate: "+=20"});<br />
});<br />
});<br />
<br />
</script><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<style type="text/css"><br />
body {<br />
padding-top: 0px;<br />
padding-left:100px;<br />
padding-right:300px;<br />
padding-bottom:50px;<br />
background: #f2f2f2;<br />
font-family: 'Droid Sans', Helvetica, sans-serif;<br />
font-size: 15px;<br />
line-height: 23px;<br />
}<br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
<br />
#footer-box {<br />
display:none;<br />
}<br />
.logo{<br />
position:fixed;<br />
display: block;<br />
left:85%;<br />
margin-right:auto;<br />
padding-top:5%;<br />
width:15%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
</style><br />
</head><br />
<body> <br />
<a href ="#sidr"><br />
<img id ="logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"/> </a></div><br />
<br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Project</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">High School Project</a></li><br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
</body><br />
</html><br />
==Objective==<br />
The objective for our project is ultimately to express human integrins on the surface of E.Coli cells. By expressing human integrins on bacteria cells, we can manipulate the cells to respond to specific stimuli in their environment. The specific integrin we are trying to express on the E.Coli cell has the ability to bind to fibrinogen. If it is successfully placed on the cell, the cell will be able to bind to fibrinogen, effectively coagulating or clotting blood. This has applications in the medical field, where the integrin-containing E.Coli (BioBots, as we like to call them) can be administered as a topical solution and prevent excessive bleeding on major surface wounds. A bacteria’s ability to express integrins has other applications as well. Since the bacteria will be able to send and receive signals to its environment, the bacteria can theoretically detect and locate cancer cells, as well as any other specific cell or structure of concern. These novel bacterial robots will represent the first prokaryotic use of heterodimeric integrins for a sensory function and will represent a platform that will enable future “design” of integrins sensory function through molecular evolution techniques.<br />
<br />
==Background== <br />
===problem statement, previous work, and/or description of need===<br />
<br />
Cells perform their intended functions not individually but collectively by forming temporally evolving, three dimensional structures <br />
<br />
comprised of clusters of cells, and through active or passive cell-cell and cell-extracellular matrix (ECM) interactions. <br />
<br />
Thus the development of engineered, integrative cellular systems that self-heal and adapt their microstructure to a variety of stimuli <br />
<br />
in the surrounding microenvironment will revolutionize the way bioengineers design. The goals of EBICS is to address the grand challenge <br />
<br />
of engineering multi-cellular biological machines that have desired functionalities and can perform prescribed tasks. <br />
<br />
These machines consist of sensing, information processing, actuation, protein expression, and transport elements that can be <br />
<br />
effectively combined to create functional units. Fortunately, nature provides plenty of inspiration through similarly functioning <br />
<br />
organisms and systems. It is therefore feasible to assume that artificial materials and organisms of the future will incorporate such <br />
<br />
naturally inspired designs. The imitation of the aforementioned functions will require development of systems similar to specialized cells in the <br />
<br />
various human tissues. The GT iGEM team will work toward the lofty goal of developing of cells and/or extracellular vesicles <br />
<br />
(e.g. platelets) that display designer sensory-response behaviors. In particular, small ‘smart’ biobots are an interesting <br />
<br />
avenue to duplicate the function of cells responsible for repair and adaptation. <br />
<br />
One of the tools that eukaryotic cells have at their disposal to detect their surroundings are heterodimeric sensor <br />
<br />
molecules present on the cell surface, known as integrins. Not only do integrins receive and facilitate cellular integration <br />
<br />
of extracellular cues, but they also support inside-out signaling and thus can dynamically impact their microenvironment. <br />
<br />
As a consequence of integrin’s critical role in this cell-ECM “dynamic reciprocity”, they represent the ideal sensor to build <br />
<br />
into a biobot. Synthetic biology applications are traditionally performed in the bacterial systems due to their availability, <br />
<br />
convenience, and speed. In order to complete our goal of expressing human integrins on the surface of bacterial cells, <br />
<br />
we will need a variety of lab and research materials necessary to experiment with the cells and eventually incorporate the <br />
<br />
integrins onto them. We will then need a way to test the effectiveness of the integrins on the cells. All funds given to us will <br />
<br />
help cover our lab material expenses.</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/ObjectiveTeam:GeorgiaTech/Objective2013-09-27T23:28:19Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<title>Georgia Tech iGEM</title><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:Cornell/stylesheets/app?action=raw&ctype=text/css" type ="text/javascript"></script><br />
<br />
<script><br />
$(document).ready(function() {<br />
<br />
<br />
$("#logo").load(function() {<br />
<br />
$("#logo").sidr();<br />
$('#return').click(function() {<br />
$.sidr('close');<br />
});<br />
});<br />
<br />
$("#logo").hover(function() {<br />
$(this).animate({scale: 1.5, rotate: "+=25"});<br />
}, function() {<br />
$(this).animate({scale: 1, rotate: "-=45"});<br />
$(this).animate({scale: 1, rotate: "+=20"});<br />
});<br />
});<br />
<br />
</script><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<style type="text/css"><br />
body {<br />
padding-top: 0px;<br />
padding-left:200px;<br />
padding-right:200px;<br />
padding-bottom:50px;<br />
background: #f2f2f2;<br />
font-family: 'Droid Sans', Helvetica, sans-serif;<br />
font-size: 15px;<br />
line-height: 23px;<br />
}<br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
<br />
#footer-box {<br />
display:none;<br />
}<br />
.logo{<br />
position:fixed;<br />
display: block;<br />
left:85%;<br />
margin-right:auto;<br />
padding-top:5%;<br />
width:15%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
</style><br />
</head><br />
<body> <br />
<a href ="#sidr"><br />
<img id ="logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"/> </a></div><br />
<br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Project</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">High School Project</a></li><br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
</body><br />
</html><br />
==Objective==<br />
The objective for our project is ultimately to express human integrins on the surface of E.Coli cells. By expressing human integrins on bacteria cells, we can manipulate the cells to respond to specific stimuli in their environment. The specific integrin we are trying to express on the E.Coli cell has the ability to bind to fibrinogen. If it is successfully placed on the cell, the cell will be able to bind to fibrinogen, effectively coagulating or clotting blood. This has applications in the medical field, where the integrin-containing E.Coli (BioBots, as we like to call them) can be administered as a topical solution and prevent excessive bleeding on major surface wounds. A bacteria’s ability to express integrins has other applications as well. Since the bacteria will be able to send and receive signals to its environment, the bacteria can theoretically detect and locate cancer cells, as well as any other specific cell or structure of concern. These novel bacterial robots will represent the first prokaryotic use of heterodimeric integrins for a sensory function and will represent a platform that will enable future “design” of integrins sensory function through molecular evolution techniques.<br />
<br />
==Background== <br />
===problem statement, previous work, and/or description of need===<br />
<br />
Cells perform their intended functions not individually but collectively by forming temporally evolving, three dimensional structures <br />
<br />
comprised of clusters of cells, and through active or passive cell-cell and cell-extracellular matrix (ECM) interactions. <br />
<br />
Thus the development of engineered, integrative cellular systems that self-heal and adapt their microstructure to a variety of stimuli <br />
<br />
in the surrounding microenvironment will revolutionize the way bioengineers design. The goals of EBICS is to address the grand challenge <br />
<br />
of engineering multi-cellular biological machines that have desired functionalities and can perform prescribed tasks. <br />
<br />
These machines consist of sensing, information processing, actuation, protein expression, and transport elements that can be <br />
<br />
effectively combined to create functional units. Fortunately, nature provides plenty of inspiration through similarly functioning <br />
<br />
organisms and systems. It is therefore feasible to assume that artificial materials and organisms of the future will incorporate such <br />
<br />
naturally inspired designs. The imitation of the aforementioned functions will require development of systems similar to specialized cells in the <br />
<br />
various human tissues. The GT iGEM team will work toward the lofty goal of developing of cells and/or extracellular vesicles <br />
<br />
(e.g. platelets) that display designer sensory-response behaviors. In particular, small ‘smart’ biobots are an interesting <br />
<br />
avenue to duplicate the function of cells responsible for repair and adaptation. <br />
<br />
One of the tools that eukaryotic cells have at their disposal to detect their surroundings are heterodimeric sensor <br />
<br />
molecules present on the cell surface, known as integrins. Not only do integrins receive and facilitate cellular integration <br />
<br />
of extracellular cues, but they also support inside-out signaling and thus can dynamically impact their microenvironment. <br />
<br />
As a consequence of integrin’s critical role in this cell-ECM “dynamic reciprocity”, they represent the ideal sensor to build <br />
<br />
into a biobot. Synthetic biology applications are traditionally performed in the bacterial systems due to their availability, <br />
<br />
convenience, and speed. In order to complete our goal of expressing human integrins on the surface of bacterial cells, <br />
<br />
we will need a variety of lab and research materials necessary to experiment with the cells and eventually incorporate the <br />
<br />
integrins onto them. We will then need a way to test the effectiveness of the integrins on the cells. All funds given to us will <br />
<br />
help cover our lab material expenses.</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/ObjectiveTeam:GeorgiaTech/Objective2013-09-27T23:27:10Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<title>Georgia Tech iGEM</title><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:Cornell/stylesheets/app?action=raw&ctype=text/css" type ="text/javascript"></script><br />
<br />
<script><br />
$(document).ready(function() {<br />
<br />
<br />
$("#logo").load(function() {<br />
<br />
$("#logo").sidr();<br />
$('#return').click(function() {<br />
$.sidr('close');<br />
});<br />
});<br />
<br />
$("#logo").hover(function() {<br />
$(this).animate({scale: 1.5, rotate: "+=25"});<br />
}, function() {<br />
$(this).animate({scale: 1, rotate: "-=45"});<br />
$(this).animate({scale: 1, rotate: "+=20"});<br />
});<br />
});<br />
<br />
</script><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<style type="text/css"><br />
body {<br />
padding-top: 0px;<br />
padding-left:200px;<br />
padding-right:200px;<br />
padding-bottom:50px;<br />
background: #f2f2f2;<br />
font-family: 'Droid Sans', Helvetica, sans-serif;<br />
font-size: 15px;<br />
line-height: 23px;<br />
}<br />
<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
<br />
#footer-box {<br />
display:none;<br />
}<br />
.logo{<br />
position:fixed;<br />
display: block;<br />
left:85%;<br />
margin-right:auto;<br />
padding-top:5%;<br />
width:15%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
</style><br />
</head><br />
<body> <br />
<a href ="#sidr"><br />
<img id ="logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"/> </a></div><br />
<br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Project</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">High School Project</a></li><br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
</body><br />
</html><br />
==Objective==<br />
The objective for our project is ultimately to express human integrins on the surface of E.Coli cells. By expressing human integrins on bacteria cells, we can manipulate the cells to respond to specific stimuli in their environment. The specific integrin we are trying to express on the E.Coli cell has the ability to bind to fibrinogen. If it is successfully placed on the cell, the cell will be able to bind to fibrinogen, effectively coagulating or clotting blood. This has applications in the <br />
<br />
medical field, where the integrin-containing E.Coli (BioBots, as we like to call them) can be administered as a topical solution <br />
<br />
and prevent excessive bleeding on major surface wounds. A bacteria’s ability to express integrins has other applications as <br />
<br />
well. Since the bacteria will be able to send and receive signals to its environment, the bacteria can theoretically detect and <br />
<br />
locate cancer cells, as well as any other specific cell or structure of concern. These novel bacterial robots will represent the <br />
<br />
first prokaryotic use of heterodimeric integrins for a sensory function and will represent a platform that will enable future <br />
<br />
“design” of integrins sensory function through molecular evolution techniques.<br />
<br />
==Background== <br />
===problem statement, previous work, and/or description of need===<br />
<br />
Cells perform their intended functions not individually but collectively by forming temporally evolving, three dimensional structures <br />
<br />
comprised of clusters of cells, and through active or passive cell-cell and cell-extracellular matrix (ECM) interactions. <br />
<br />
Thus the development of engineered, integrative cellular systems that self-heal and adapt their microstructure to a variety of stimuli <br />
<br />
in the surrounding microenvironment will revolutionize the way bioengineers design. The goals of EBICS is to address the grand challenge <br />
<br />
of engineering multi-cellular biological machines that have desired functionalities and can perform prescribed tasks. <br />
<br />
These machines consist of sensing, information processing, actuation, protein expression, and transport elements that can be <br />
<br />
effectively combined to create functional units. Fortunately, nature provides plenty of inspiration through similarly functioning <br />
<br />
organisms and systems. It is therefore feasible to assume that artificial materials and organisms of the future will incorporate such <br />
<br />
naturally inspired designs. The imitation of the aforementioned functions will require development of systems similar to specialized cells in the <br />
<br />
various human tissues. The GT iGEM team will work toward the lofty goal of developing of cells and/or extracellular vesicles <br />
<br />
(e.g. platelets) that display designer sensory-response behaviors. In particular, small ‘smart’ biobots are an interesting <br />
<br />
avenue to duplicate the function of cells responsible for repair and adaptation. <br />
<br />
One of the tools that eukaryotic cells have at their disposal to detect their surroundings are heterodimeric sensor <br />
<br />
molecules present on the cell surface, known as integrins. Not only do integrins receive and facilitate cellular integration <br />
<br />
of extracellular cues, but they also support inside-out signaling and thus can dynamically impact their microenvironment. <br />
<br />
As a consequence of integrin’s critical role in this cell-ECM “dynamic reciprocity”, they represent the ideal sensor to build <br />
<br />
into a biobot. Synthetic biology applications are traditionally performed in the bacterial systems due to their availability, <br />
<br />
convenience, and speed. In order to complete our goal of expressing human integrins on the surface of bacterial cells, <br />
<br />
we will need a variety of lab and research materials necessary to experiment with the cells and eventually incorporate the <br />
<br />
integrins onto them. We will then need a way to test the effectiveness of the integrins on the cells. All funds given to us will <br />
<br />
help cover our lab material expenses.</div>Henry54809http://2013.igem.org/Team:GeorgiaTech/ObjectiveTeam:GeorgiaTech/Objective2013-09-27T23:25:40Z<p>Henry54809: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<title>Georgia Tech iGEM</title><br />
<script src="http://code.jquery.com/jquery-1.10.1.min.js" type="text/javascript"></script><br />
<script src ="http://ricostacruz.com/jquery.transit/jquery.transit.min.js" type ="text/javascript"></script><br />
<script src="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.min?action=raw&ctype=text/javascript" type ="text/javascript"></script><br />
<script src ="https://2013.igem.org/Team:Cornell/stylesheets/app?action=raw&ctype=text/css" type ="text/javascript"></script><br />
<br />
<script><br />
$(document).ready(function() {<br />
<br />
<br />
$("#logo").load(function() {<br />
<br />
$("#logo").sidr();<br />
$('#return').click(function() {<br />
$.sidr('close');<br />
});<br />
});<br />
<br />
$("#logo").hover(function() {<br />
$(this).animate({scale: 1.5, rotate: "+=25"});<br />
}, function() {<br />
$(this).animate({scale: 1, rotate: "-=45"});<br />
$(this).animate({scale: 1, rotate: "+=20"});<br />
});<br />
});<br />
<br />
</script><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/jquery.sidr.light?action=raw&ctype=text/css"></link><br />
<link rel="stylesheet" type="text/css" href="https://2013.igem.org/Team:GeorgiaTech/reset?action=raw&ctype=text/css"></link><br />
<style type="text/css"><br />
body {<br />
padding: 100px;<br />
background: #f2f2f2;<br />
font-family: 'Droid Sans', Helvetica, sans-serif;<br />
font-size: 15px;<br />
line-height: 23px;<br />
}<br />
<br />
h1, h2, h3, h4, h5, h6 {<br />
font-family: 'Bitter', serif;<br />
font-weight: normal;<br />
color: #000;<br />
border-bottom: none;<br />
margin-bottom: none;<br />
}<br />
<br />
h1.centered, h2.centered, h3.centered, h4.centered, h5.centered, h6.centered {<br />
text-align: center;<br />
}<br />
table#toc {<br />
display:none;<br />
}<br />
<br />
<br />
#footer-box {<br />
display:none;<br />
}<br />
.logo{<br />
position:fixed;<br />
display: block;<br />
left:85%;<br />
margin-right:auto;<br />
padding-top:5%;<br />
width:15%;<br />
}<br />
.smallLogo{<br />
display: block;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:60%;<br />
padding-top:20px;<br />
}<br />
.text{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: large;<br />
padding:20px;<br />
}<br />
<br />
.textLarge{<br />
font-size: xx-large;<br />
font-weight: bold;<br />
}<br />
<br />
.textMenu{<br />
display:block;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size: 23px;<br />
}<br />
</style><br />
</head><br />
<body> <br />
<a href ="#sidr"><br />
<img id ="logo" src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "logo" alt ="GT iGEM logo"/> </a></div><br />
<br />
<div id="sidr"><br />
<!-- Your content --><br />
<ul class =" textMenu" ><br />
<li class="active"><br />
<a href="https://2013.igem.org/Team:GeorgiaTech" style ="font-size:80px; padding-top:8px;padding-bottom:8px"><br />
<img src = "https://static.igem.org/mediawiki/2013/f/f0/GeorgiaTech_team.png" class = "smallLogo" alt ="GT iGEM logo"/>Home<br />
</a><br />
</li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Objective" style ="padding-top:8px;padding-bottom:8px">Objective</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Team" style ="padding-top:8px;padding-bottom:8px">Team</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Project" style ="padding-top:8px;padding-bottom:8px">Project</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Safety" style ="padding-top:8px;padding-bottom:8px">Safety</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Attributions" style ="padding-top:8px;padding-bottom:8px">Attributions</a></li><br />
<li><a href="https://2013.igem.org/Team:GeorgiaTech/Parts" style ="padding-top:8px;padding-bottom:8px">High School Project</a></li><br />
<li><a id ="return" href="#" style ="padding-top:8px;padding-bottom:8px">RETURN</a></li><br />
<br />
</ul><br />
</div><br />
</body><br />
</html><br />
==Objective==<br />
The objective for our project is ultimately to express human integrins on the surface of E.Coli cells. By expressing human integrins on bacteria cells, we can manipulate the cells to respond to specific stimuli in their environment. The specific integrin we are trying to express on the E.Coli cell has the ability to bind to fibrinogen. If it is successfully placed on the cell, the cell will be able to bind to fibrinogen, effectively coagulating or clotting blood. This has applications in the <br />
<br />
medical field, where the integrin-containing E.Coli (BioBots, as we like to call them) can be administered as a topical solution <br />
<br />
and prevent excessive bleeding on major surface wounds. A bacteria’s ability to express integrins has other applications as <br />
<br />
well. Since the bacteria will be able to send and receive signals to its environment, the bacteria can theoretically detect and <br />
<br />
locate cancer cells, as well as any other specific cell or structure of concern. These novel bacterial robots will represent the <br />
<br />
first prokaryotic use of heterodimeric integrins for a sensory function and will represent a platform that will enable future <br />
<br />
“design” of integrins sensory function through molecular evolution techniques.<br />
<br />
==Background== <br />
===problem statement, previous work, and/or description of need===<br />
<br />
Cells perform their intended functions not individually but collectively by forming temporally evolving, three dimensional structures <br />
<br />
comprised of clusters of cells, and through active or passive cell-cell and cell-extracellular matrix (ECM) interactions. <br />
<br />
Thus the development of engineered, integrative cellular systems that self-heal and adapt their microstructure to a variety of stimuli <br />
<br />
in the surrounding microenvironment will revolutionize the way bioengineers design. The goals of EBICS is to address the grand challenge <br />
<br />
of engineering multi-cellular biological machines that have desired functionalities and can perform prescribed tasks. <br />
<br />
These machines consist of sensing, information processing, actuation, protein expression, and transport elements that can be <br />
<br />
effectively combined to create functional units. Fortunately, nature provides plenty of inspiration through similarly functioning <br />
<br />
organisms and systems. It is therefore feasible to assume that artificial materials and organisms of the future will incorporate such <br />
<br />
naturally inspired designs. The imitation of the aforementioned functions will require development of systems similar to specialized cells in the <br />
<br />
various human tissues. The GT iGEM team will work toward the lofty goal of developing of cells and/or extracellular vesicles <br />
<br />
(e.g. platelets) that display designer sensory-response behaviors. In particular, small ‘smart’ biobots are an interesting <br />
<br />
avenue to duplicate the function of cells responsible for repair and adaptation. <br />
<br />
One of the tools that eukaryotic cells have at their disposal to detect their surroundings are heterodimeric sensor <br />
<br />
molecules present on the cell surface, known as integrins. Not only do integrins receive and facilitate cellular integration <br />
<br />
of extracellular cues, but they also support inside-out signaling and thus can dynamically impact their microenvironment. <br />
<br />
As a consequence of integrin’s critical role in this cell-ECM “dynamic reciprocity”, they represent the ideal sensor to build <br />
<br />
into a biobot. Synthetic biology applications are traditionally performed in the bacterial systems due to their availability, <br />
<br />
convenience, and speed. In order to complete our goal of expressing human integrins on the surface of bacterial cells, <br />
<br />
we will need a variety of lab and research materials necessary to experiment with the cells and eventually incorporate the <br />
<br />
integrins onto them. We will then need a way to test the effectiveness of the integrins on the cells. All funds given to us will <br />
<br />
help cover our lab material expenses.</div>Henry54809