Team:Heidelberg/Templates/DelH overview7
From 2013.igem.org
(Difference between revisions)
(Created page with "===Primers=== {| class="wikitable" |- ! Identifier !! Order date !! Note !! Sequence |- | DN09:DelH_f1_fw_long || 2013-06-11 || Amplification of DelH F1a from the genome: doesn't...") |
|||
Line 1: | Line 1: | ||
+ | |||
===Primers=== | ===Primers=== | ||
{| class="wikitable" | {| class="wikitable" |
Latest revision as of 09:24, 2 October 2013
Primers
Identifier | Order date | Note | Sequence |
---|---|---|---|
DN09:DelH_f1_fw_long | 2013-06-11 | Amplification of DelH F1a from the genome: doesn't work | ATGGACCGTGGCCGCCTGCGCCAAATCG |
DN10:DelH_f1_fw_short | 2013-06-11 | Amplification of DelH F1a from the genome: doesn't work | ATGGACCGTGGCCGCCTGC |
DN11:DelH_f1_fw_short2 | 2013-06-11 | Amplification of DelH F1a from the genome: works!!!! | GCCGCCTGCGCCAAATCG |
DN12:DelH_f1_PacI_fw_short | 2013-06-11 | Amplification of DelH F1a from the genome: doesn't work | ttttttaattaatcacacaggaaagtactagATGGACCGTGGCCGCCTGC |