Team:Heidelberg/Templates/DelH overview7

From 2013.igem.org

(Difference between revisions)
(Created page with "===Primers=== {| class="wikitable" |- ! Identifier !! Order date !! Note !! Sequence |- | DN09:DelH_f1_fw_long || 2013-06-11 || Amplification of DelH F1a from the genome: doesn't...")
 
Line 1: Line 1:
 +
===Primers===
===Primers===
{| class="wikitable"
{| class="wikitable"

Latest revision as of 09:24, 2 October 2013

Primers

Identifier Order date Note Sequence
DN09:DelH_f1_fw_long 2013-06-11 Amplification of DelH F1a from the genome: doesn't work ATGGACCGTGGCCGCCTGCGCCAAATCG
DN10:DelH_f1_fw_short 2013-06-11 Amplification of DelH F1a from the genome: doesn't work ATGGACCGTGGCCGCCTGC
DN11:DelH_f1_fw_short2 2013-06-11 Amplification of DelH F1a from the genome: works!!!! GCCGCCTGCGCCAAATCG
DN12:DelH_f1_PacI_fw_short 2013-06-11 Amplification of DelH F1a from the genome: doesn't work ttttttaattaatcacacaggaaagtactagATGGACCGTGGCCGCCTGC