Team:Heidelberg/Templates/DelH overview7

From 2013.igem.org

Revision as of 22:51, 1 October 2013 by Fanny (Talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Primers

Identifier Order date Note Sequence
DN09:DelH_f1_fw_long 2013-06-11 Amplification of DelH F1a from the genome: doesn't work ATGGACCGTGGCCGCCTGCGCCAAATCG
DN10:DelH_f1_fw_short 2013-06-11 Amplification of DelH F1a from the genome: doesn't work ATGGACCGTGGCCGCCTGC
DN11:DelH_f1_fw_short2 2013-06-11 Amplification of DelH F1a from the genome: works!!!! GCCGCCTGCGCCAAATCG
DN12:DelH_f1_PacI_fw_short 2013-06-11 Amplification of DelH F1a from the genome: doesn't work ttttttaattaatcacacaggaaagtactagATGGACCGTGGCCGCCTGC