http://2013.igem.org/wiki/index.php?title=Team:Heidelberg/Templates/DelH_week1&feed=atom&action=history
Team:Heidelberg/Templates/DelH week1 - Revision history
2024-03-28T16:26:53Z
Revision history for this page on the wiki
MediaWiki 1.16.5
http://2013.igem.org/wiki/index.php?title=Team:Heidelberg/Templates/DelH_week1&diff=325361&oldid=prev
Anja R at 11:21, 23 October 2013
2013-10-23T11:21:08Z
<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 11:21, 23 October 2013</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 41:</td>
<td colspan="2" class="diff-lineno">Line 41:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>! Identifier !! Order date !! Note !! Sequence</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>! Identifier !! Order date !! Note !! Sequence</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>|-</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>|-</div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>| DN01:DelH_f1_PacI_fw || 03-05-2013 || Amplification of DelH F1, with RBS and adding PacI restriction site || <del class="diffchange diffchange-inline">tttt ttaattaa </del> <del class="diffchange diffchange-inline">tcacacaggaaagtactag </del> ATGGACCGTGGCCGCCTGC GCCAAATCG</div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>| DN01:DelH_f1_PacI_fw || 03-05-2013 || Amplification of DelH F1, with RBS and adding PacI restriction site || <ins class="diffchange diffchange-inline">TTTT TTAATTAA </ins> <ins class="diffchange diffchange-inline">TCACACAGGAAAGTACTAG </ins> ATGGACCGTGGCCGCCTGC GCCAAATCG</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>|-</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>|-</div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>| DN02:DelH_f1_SalI_rev || 03-05-2013 || Amplification of DelH F1 until SalI restriction site || <del class="diffchange diffchange-inline">tttt </del>GTCGACCAACACCTGTGCCTGC</div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>| DN02:DelH_f1_SalI_rev || 03-05-2013 || Amplification of DelH F1 until SalI restriction site || <ins class="diffchange diffchange-inline">TTTT </ins>GTCGACCAACACCTGTGCCTGC</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>|-</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>|-</div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>| DN03:DelH_f2_SalI_fw || 03-05-2013 || Amplification of DelH F2 starting at SalI restriction site|| <del class="diffchange diffchange-inline">tttt </del>GTCGACTGGATGGAGCCTGGTGAAAG</div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>| DN03:DelH_f2_SalI_fw || 03-05-2013 || Amplification of DelH F2 starting at SalI restriction site|| <ins class="diffchange diffchange-inline">TTTT </ins>GTCGACTGGATGGAGCCTGGTGAAAG</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>|-</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>|-</div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>| DN04:DelH_f2_KpnI_rev || 03-05-2013 || Amplification of DelH F2, adding KpnII restriction site || <del class="diffchange diffchange-inline">tttt ggtacc </del>TCAGTCCAGCGCGTACTCCAG</div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>| DN04:DelH_f2_KpnI_rev || 03-05-2013 || Amplification of DelH F2, adding KpnII restriction site || <ins class="diffchange diffchange-inline">TTTT GGTACC </ins>TCAGTCCAGCGCGTACTCCAG</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>|-</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>|-</div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>| DN05:AraCbb_KpnI_fw || 03-05-2013 || Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site || <del class="diffchange diffchange-inline">tttt </del> <del class="diffchange diffchange-inline">ggtacc </del> <del class="diffchange diffchange-inline">aaagaggagaaatactagatgaccatg</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>| DN05:AraCbb_KpnI_fw || 03-05-2013 || Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site || <ins class="diffchange diffchange-inline">TTTT </ins> <ins class="diffchange diffchange-inline">GGTACC </ins> <ins class="diffchange diffchange-inline">AAAGAGGAGAAATACTAGATGACCATG</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>|-</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>|-</div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>| DN08:AraCbb_PacI_rev || 03-05-2013 || Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site || <del class="diffchange diffchange-inline">tttt </del> <del class="diffchange diffchange-inline">ttaattaa </del> <del class="diffchange diffchange-inline">gctagcccaaaaaaacgggtatg</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>| DN08:AraCbb_PacI_rev || 03-05-2013 || Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site || <ins class="diffchange diffchange-inline">TTTT </ins> <ins class="diffchange diffchange-inline">TTAATTAA </ins> <ins class="diffchange diffchange-inline">GCTAGCCCAAAAAAACGGGTATG</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>|}</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>|}</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br/></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br/></div></td></tr>
</table>
Anja R
http://2013.igem.org/wiki/index.php?title=Team:Heidelberg/Templates/DelH_week1&diff=262538&oldid=prev
Nils.kurzawa: Created page with " == 29-04 - 05-05-13 == ===Generation of Plasmid Backbones=== ====Transformation of Biobricks==== {| class="wikitable" |- ! Part of the registry !! Plate of 2012 !! Well !! Res..."
2013-10-01T19:34:28Z
<p>Created page with " == 29-04 - 05-05-13 == ===Generation of Plasmid Backbones=== ====Transformation of Biobricks==== {| class="wikitable" |- ! Part of the registry !! Plate of 2012 !! Well !! Res..."</p>
<p><b>New page</b></p><div><br />
== 29-04 - 05-05-13 ==<br />
===Generation of Plasmid Backbones=== <br />
====Transformation of Biobricks==== <br />
{| class="wikitable"<br />
|-<br />
! Part of the registry !! Plate of 2012 !! Well !! Resistance<br />
|-<br />
| pSB4K5 (insert=J04450) || 1|| 5G || Kanamycin<br />
|-<br />
| pSB6A1 (insert=J04450) || 1 || 1K || Ampicillin<br />
|-<br />
| lacZ (I732019) in pSB1AK3 || 4 || 12G || Kanamycin, Ampicillin<br />
|-<br />
| AraC (I0500) in pSB2K3 || 1 || 14N || Kanamycin<br />
|-<br />
| pSB1C3 (insert=J04450) || 1 || 3A || Chloramphenicol<br />
|}<br />
* Added 10 µl H<sub>2</sub>O to each well <br />
* Incubated for 10 min at RT<br />
* Thawed 5x chemical competent ''E.coli'' Top10 <br />
* 3 µl of plasmid DNA were added <br />
* Incubated for 10 min on ice<br />
* Heat shock for 40 s at 42.2°C<br />
* Incubated for 10 min on ice<br />
* Added 500 µl LB Medium <br />
* Incubated at 37°C for 40 min<br />
* Centrifuged 120 at 5,000 rpm, supernatant discarded<br />
* Pellet resuspended in remaining medium <br />
* Plated on plates with the corresponding antibiotics (as shown in the table above, section: resistances)<br />
* Incubated for 2 days at RT<br />
* One colony was picked from each plate and incubated over night at 37°C in LB medium with the antibiotic listed above<br />
====Result====<br />
All 5 parts from the Registry Distribution 2012 were successfully transformed in ''E.coli'' Top10 except for the one containing the AraC promotor.<br />
<br/><br />
<br/><br />
===Amplification of DelH Fragments=== <br />
====Design of Primers====<br />
{| class="wikitable"<br />
|-<br />
! Identifier !! Order date !! Note !! Sequence<br />
|-<br />
| DN01:DelH_f1_PacI_fw || 03-05-2013 || Amplification of DelH F1, with RBS and adding PacI restriction site || tttt ttaattaa tcacacaggaaagtactag ATGGACCGTGGCCGCCTGC GCCAAATCG<br />
|-<br />
| DN02:DelH_f1_SalI_rev || 03-05-2013 || Amplification of DelH F1 until SalI restriction site || tttt GTCGACCAACACCTGTGCCTGC<br />
|-<br />
| DN03:DelH_f2_SalI_fw || 03-05-2013 || Amplification of DelH F2 starting at SalI restriction site|| tttt GTCGACTGGATGGAGCCTGGTGAAAG<br />
|-<br />
| DN04:DelH_f2_KpnI_rev || 03-05-2013 || Amplification of DelH F2, adding KpnII restriction site || tttt ggtacc TCAGTCCAGCGCGTACTCCAG<br />
|-<br />
| DN05:AraCbb_KpnI_fw || 03-05-2013 || Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site || tttt ggtacc aaagaggagaaatactagatgaccatg<br />
|-<br />
| DN08:AraCbb_PacI_rev || 03-05-2013 || Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site || tttt ttaattaa gctagcccaaaaaaacgggtatg<br />
|}<br />
<br/></div>
Nils.kurzawa