Revision history of "Team:Heidelberg/Tyrocidine week21 ov"

From 2013.igem.org

Diff selection: mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.

Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.
  • (cur | prev) 17:16, 4 October 2013 TaniaChristiansen (Talk | contribs) (1,668 bytes) (Created page with " ==Primers ordered for Border Variation== {|class="wikitable" |- ! Identifier !! Order date !! Note !! Sequence |- |AR01|| 2013-09-17 || sTycC4dC_fw || ATG AAGCACTTGCTGCCGCTCGTC ...")
Retrieved from "http://2013.igem.org/Team:Heidelberg/Tyrocidine_week21_ov"