</div>
https://2013.igem.org/Team:NTNU-Trondheim/Experiments_and_Results
Contents |
Gram negative (and some gram positive) bacteria produce outer membrane vesicles (OMV) by outward bulging of the outer plasma membrane. These OMV has varies function such as quorum sensing, biofilm development, involvement in pathogensis (some for pathogenic bacteria) and transport of enzymes to distal locations (1).
Whereas OMVs function and contents has been studied for decades, their potential as a drug carrier has not been investigated before. As it is still many obstacles for an effective production method of different drug carriers within the field of nano-medicine, exploiting gram negative bacteria OMV production could be a possibility for drug delivery in the future. Especially vesicles from pathogenic bacteria could be further manipulated as these vesicles naturally can attack human eucaryotic cells (see figure below)
The first fluorescent protein to be discovered was the green fluorescent protein (GFP) isolated from Aequorea victoria. Many other different fluorescent protein (FP) with different colours (red, cyan, yellow and other version of these) has since been created by mutating GFP. The FPs has been crucial in terms of visualising cells and determining intracellular proteins by fusing the FPs to the proteins of interest. Having a variety of FPs gives scientists the opportunity to study different proteins at the same time.
The discovery of green fluorescent protein in the early 1960s eventually published a new era in cell biology by assisting investigators to apply molecular cloning methods, fusing the fluorophore moiety to a wide variety of protein and enzyme targets, in order to monitor cellular processes in living systems using optical microscopy and related methodology.
Fluorescent proteins are in the group of structurally homologous class of proteins that they share the unique property of being self-sufficient to form a visible wavelength chromophore from a sequence of 3 amino acids within their own polypeptide sequence. Biologists introduce a gene (or a gene chimera) encoding an engineered fluorescent protein into living cells and subsequently visualize the location and dynamics of the gene product using fluorescence microscopy.
The presence of a fluorescent component in the bioluminescent organs of Aequorea victoria jellyfish was introduced by Davenport and Nicol in 1955, but it was Osamu Shimomura who was the first to recognize that this fluorophore is actually a protein. He mentioned in one of his papers “A protein giving solutions that look slightly greenish in sunlight though only yellowish under tungsten lights, and exhibiting a very bright, greenish fluorescence in the ultraviolet of a Mineralite has also been isolated from squeezates" (Shimomura et al. 1962). "Squeezate" describing a solution that resulted from the squeezing of the excised bioluminescent tissues of the jellyfish through a cotton bag. After that Shimomura reported the fluorescence emission spectrum of this protein and also he suggested that energy transfer from aequorin to this green fluorescent protein could explain why the in vivo luminescence of Aequorea is greenish and not blue like the luminescence of purified aequorin.
The gene for green fluorescent protein was first cloned in 1992, but the important possibility to be used as a molecular probe was not achieved until several years later when fusion products were used to track gene expression in bacteria and nematodes. Green fluorescent protein has been engineered to produce numbers of various colored mutants, fusion proteins, and biosensors which are broadly referred to as fluorescent proteins. Recently, fluorescent proteins from other species are also identified and isolated, resulting in further expansion of the color palette. With the rapid evolution of fluorescent protein technology, the utility of this genetically encoded fluorophore for a wide spectrum of applications beyond the simple tracking of tagged biomolecules in living cells is now becoming fully appreciated.
A broad range of fluorescent protein genetic variants have been developed that feature fluorescence emission spectral profiles spanning almost the entire visible light spectrum. Mutagenesis efforts in the original Aequorea victoria jellyfish green fluorescent protein have resulted in new fluorescent probes that range in color from blue to yellow, and are some of the most widely used in vivo reporter molecules in biological research. Longer wavelength fluorescent proteins, emitting in the orange and red spectral regions, have been developed from the marine anemone, Discosoma striata, and reef corals belonging to the class Anthozoa. Still other species have been mined to produce similar proteins having cyan, green, yellow, orange, and deep red fluorescence emission. Developmental research efforts are ongoing to improve the brightness and stability of fluorescent proteins, thus improving their overall usefulness.
We want, as a part of our project, to introduce protein G from S.dysgalactiae subsp. equisimilis into Escherichia coli OMV's. Protein G is known to bind to human serum albumin (has) which helps S.dysgalactiae subsp. equisimilis hiding from the immune system. Protein G therefore could be a potential important piece in a drug carrier by masking it from immunological destruction. Introducing protein G into vesicles also demonstrate that it is indeed possible to manipulate the content and therefore the properties of OMV's.
In the second part of our project, we want to create new combinations of FP's. We intend to make this happen by fusing different FPs together into a new construct, namely GFP, red fluorescent protein (RFG), cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP). This will give us new combinations of FPs with new absorption spectrum.
Transport of proteins is an essential part of cellular life. Proteins destined for transmembrane transportation are usually synthesized with amino-terminal signal sequences, signal peptides, that direct the proteins to specific membrane transporter complexes. During the transport/export the signal peptide is cleaved from the protein.
Gram negative bacteria export numerous proteins into the periplasm. This transport across membranes is via
distinct signal peptides with twin-arginine motifs. The twin-arginine translocation pathway (Tat pathway) is
a protein export, or secretion pathway found in plants, bacteria, and archaea. In contrast to the Sec pathway
which transports proteins in an unfolded manner, the Tat pathway serves to actively translocate folded
proteins across a lipid membrane bilayer. The Tat system is able to transport fully folded proteins in bacteria,
and it has been confirmed in in vitro studies (Clark and Theg 1997; Hyndis et al. 1998). Several tat genes
have been identified, and in E. coli the export pathway requires four integral membrane proteins, TatA, TatB,
TatC and TatE. Other componenets cannot be ruled out. Studies show that a twin-arginine signal peptide
is able to direct the export of active green fluorescent protein (GFP) in E.coli and that translocation
almost exclusively occur by the Tat-pathway. As GFP is unable to fold in the periplasm it is assumed that its
translocation must occur in folded conformation.
Taking this information into account we discussed the possibility of transporting different proteins into the preiplasm of bacteria, and what this may be useful for. As all gram negative bacteria produce outer membrane vesicles (OMV's) we looked into the content of these vesicles. Was the sorting of proteins random? Could we direct certain proteins toward them? And what function would that give? Can we use this to our advantage?
Tat targeting signals exhibit a structure, like Sec signal peptides, comprising of three regions. A polar 'n-region', a hydrophobic 'h-region', and a polar 'c-region'. The twin-arginine motif is conserved and always located between the 'n-', and 'h-region'(Berks, 1996). The 'c-region' often contain proline residues, a positive charge and an AA cleavagesite. It is believed that the positive charge prevents mistargeting of Tat signal peptides to the Sec pathway (Bogsch et al., 1997).
A commonly used signal peptide is trimethylamine N-oxide reductase (TorA) from E. coli. The TorA signal peptide is 39 aminoacids long giving this base sequence of 117 nucletides:
5' ATGGCCAATAACGATCTCTTTCAGGCATCACGTCGGCGTTTTCTGGCACAACTCGGCGGC TTAACCGTCGCCGGGATGCTGGGGCCGTCATTGTTAACGCCGCGACGTGCGACTGCGGCG CAAGCG 3'
Primers were designed using??
| Forward Primer | Reverse Primer | Tm |
|---|---|---|
| 5'AGAGAAAGAGGAGAAATACTAGATGGCCAATAACGATCTCTTTCAGGCATCACG 3'(AAC) | 5'GAATTCGCGGCCGCTTCTAGATGGCCAATAACGATCTCTTTCAGGCATCACG 3'(AAC) | 72°C |
The first 22 bases of the forward primer and the first 20 bases of the reverse primer are linker sequences. The forward primer was designed to make an overlap with the backbone plasmid and the reverse overlaps with the linker on GFP.
TorA has successfully been fused with the coding region of GFP's in previous studies. The construct was
further cloned into a vectorplasmid and introduced inE.col. The construct, when expressed will then
have the GFP attatched to TorA signal peptide whitch will direct the protein through the Tat pathway into
the periplasm of the cell. In the periplasm the signal peptide is cleaved of. The GFP is then mainly found
in the cell's periplasm, not in the cytoplasm.
=====Figure X=====: Visualization of GFP in the periplasm of the cell using fluorescence microscopi.
When in the periplasm the GFP may also be included in the vesicles as they budd of. The contents of the vesicles vary, but is believed to be regulated in some way. The proteins that reach the periplasm is transported there by signal peptides for a reason. Knowing this it would be possible to transport other proteins to the periplasm and direct them toward the vesicles. As the vesicles are not a replicative unit like bacteria or viruses it may be a perfect transportvessel for drugs, vaccines or other medical applications. This is the quality that we wish to examine further. Can we introduce surfaceproteins on the vesicles that mask them from the immunesystem? What about a cancercell recognition type of construct? Programme the vesicles to release content only when in contact with harmful cells?
"
