Team:UChicago/Notebook

From 2013.igem.org

Revision as of 16:00, 26 September 2013 by Dohs (Talk | contribs)




Protocols

Lab Notebook

Contents

June

Week 3

Tuesday, June 18, 2013


First iGEM Meeting of the Summer!

  • All student members gathered in the lab.
  • We toured the lab, prep room, and incubator room, and we discussed the lab rules.
  • We also split into teams to discuss lab logistics: contacting funding sources, ordering reagents/materials, compiling protocols, recording our electronic lab notebook, and making plates/media.

Week 4

Wednesday, June 26, 2013


Planning Wet Lab Work

  • We split into planning sub-teams to plan out different parts of the project with protocols, timelines, and ordering reagents.
    • Plasmid Design
    • Media and Competent Cells
    • E. coli and B. subtilis Transformation
    • Keratinase Assay and His tagging
    • Running DNA gels, SDS-PAGE gels, and western blots
  • We will also be holding weekly meetings with our graduate student advisers and biweekly meetings with our faculty advisers to provide updates.
  • Wet lab work begins tomorrow!


Friday, June 28, 2013


Researching the Sequence of kerA

  • Planning subteams continued to order reagents and compile protocols.
  • The plasmid design team decided on gibson assembly to produce the kerA biobrick with geneblocks ordered from IDT.
  • kerA sequence was obtained from “Nucleotide Sequence and Expression of kerA, the Gene Encoding a Keratinolytic Protease of Bacillus licheniformis PWD-1” (Lin et al. 1995).

UChicago 2013 kerA plasmid design.png

  • Two putative promoters (red), a possible ribosomal binding site (green), and a transcriptional terminator sequence (light blue, single underline) are indicated. The putative starting residues of the preprotein (pre = blue), proprotein (pro = pink), and mature protein (mature = purple) are indicated.
  • EcoRI (orange) and PstI (blue) sites within the gene are indicated and must be removed to produce the kerA biobrick.

July

Week 1

Wednesday, July 3, 2013


BioBrick Design Presentation and Grad Adviser Meeting

  • Designed a biobrick with:
    • C terminus His-tagged kerA
      • CATCATCATCATCATCAT
    • Prefix: gaattcgcggccgcttctagag
    • Suffix: tactagtagcggccgctgcag
  • Moreover, the bio brick must include
    • Eliminated EcoRI and PstI restriction sites from kerA nucleotide seq
      • EcoRI (gaattc--814) and PstI (ctgcag--978)
      • Conserved aa seq + biobrick prefix + suffix
    • Secretion signal peptide
    • Inducible promoter
  • We also presented a feasible timeline of our project, which included:
    • Assembly of biobrick and transformation into E. coli
    • Transformation of B. subtilis
    • Keratinase isolation and keratinase assays
    • kerA mutagenesis for optimization of the keratinase
  • We also split up basic lab duties!
    • Ivan & Ethan are in charge of the IBC protocol.
      • We can’t start wet lab work until our IBC protocol is finished!
    • Ethan is in charge of minutes.
    • Susan is in charge of ordering invoices.
    • Annie is in charge of emailing advisors and members to plan meetings
    • Chloe is getting the B. subtilis gene that expressing keratinase.

Thursday, July 4, 2013


Milk Agar Plates

  • The purpose of milk agar plates is often to detect protease activity, including the activity of keratinases.
  • A measurement of any baseline protease activity of our parent B. subtilis strain (WB700), which does not endogenously express any keratinases, is desired.
  • Excess protease activity of our parent B. subtilis strain may prevent our use of milk agar plates as an assay for keratinase expression of our future transformants with the kerA gene.
  • Therefore, the parent B. subitilis strain (WB700) was streaked on the milk agar plates to observe baseline protease activity that could prevent us from detecting keratinase expression after transformation.
  • [Milk Agar Plates] (in LB):
    • Total volume of 600 ml (makes 20-25 plates)
    • 20g (30*.6) nonfat dry milk powder
    • 500mL 2X [LB medium]
    • 250mL 2X [agar]
  • Ideally, there should be a minimal zone of clearing around our B. subtilis colonies.
  • Next Steps:
    • Observe the results of our milk agar plates with B. subtilis colonies


Friday, July 5, 2013


Primer Design for kerA biobrick

  • Designed primers for directed mutagenesis of our kerA biobrick using PrimerX:
  1. Primer pair 1 (EcoRI mutation, aat --> aac, asparagine)
    a. Forward: 5' GGTTAAAGTACTGAACTCAAGCGGAAGCGG 3'
    b. Reverse: 5' CCGCTTCCGCTTGAGTTCAGTACTTTAACC 3'
  2. Primer pair 2 (Pst1 mutation, gca-->gcg, alanine)
    a. Forward: 5' GTTGTCGTTGTAGCTGCGGCAGGGAACAGCGGATC 3'
    b. Reverse: 5' GATCCGCTGTTCCCTGCCGCAGCTACAACGACAAC 3'
  • Used APE for checking codons and mutating restriction sites


Saturday, July 6, 2013


Primer Design Part II

  • Designed primers to isolate non-coding and coding sequence of kerA and add prefix and suffix
  • forward primer + xbaI site:
5' TATCTAGAGGTCTATTCATACTTTCGAA 3'
  • reverse primer + speI site (reverse complement):
5' ATTGATCATTGGACAACCTTCATCAG 3'
  • We still need to design additional primers that will include the secretion signal peptide (in case it needs to be secreted out of B. subtilis) and kerA (From start to stop codon).
  • These primers should include igem biobrick prefix and his tag (before stop codon) + suffix.

Week 2

Week 3

Week 4

August

Week 1

Week 2

Week 3

Week 4

September

Week 1

Week 2

Week 3