"
Team:UChicago/Plan
From 2013.igem.org
| Line 30: | Line 30: | ||
<html> | <html> | ||
| + | == '''Construct pUB110 BioBrick''' == | ||
| - | |||
-Digest pUB110 w/ NdeI and AflII--> gel purify-->nanodrop for concentration | -Digest pUB110 w/ NdeI and AflII--> gel purify-->nanodrop for concentration | ||
| + | |||
| + | |||
-Digest pUB110 linker w/ NdeI and AflII | -Digest pUB110 linker w/ NdeI and AflII | ||
| - | + | ||
| + | |||
| + | Linker sequence: | ||
attcgtcttaaggaattcgcggccgcttctagagtactagtagcggccgctgcagcatatgtcatac | attcgtcttaaggaattcgcggccgcttctagagtactagtagcggccgctgcagcatatgtcatac | ||
| - | |||
-Set up overnight ligation of digested, gel purified pUB110 and digested pUB110 linker = generates pUB110 BioBrick | -Set up overnight ligation of digested, gel purified pUB110 and digested pUB110 linker = generates pUB110 BioBrick | ||
| + | |||
| + | |||
-Transform into B. subtilis to amplify | -Transform into B. subtilis to amplify | ||
| + | |||
| + | |||
-Set up O. N. cultures | -Set up O. N. cultures | ||
| + | |||
| + | |||
-Do B. subtilis miniprep | -Do B. subtilis miniprep | ||
| + | |||
| + | |||
-Digest our pUB110 BioBrick | -Digest our pUB110 BioBrick | ||
| + | |||
| + | |||
To test pUB110 Biobrick (kanamycin resistant) construction (send for sequencing) | To test pUB110 Biobrick (kanamycin resistant) construction (send for sequencing) | ||
| - | -Put a promoter/upstream BioBrick (in vector with chloramphenicol resistance) + RFP BioBrick from amp resistant vector => do 3 step assembly | + | |
| + | |||
| + | -Put a promoter/upstream BioBrick (in vector with chloramphenicol resistance) + RFP BioBrick from amp resistant vector => do 3 step assembly | ||
| + | |||
| + | |||
-Do transformation in B. subtilis | -Do transformation in B. subtilis | ||
| + | |||
| + | |||
-Choose transformants--> if transformants express RFP, we could conclude our pUB110 BioBrick works--> submit pUB110 BioBrick | -Choose transformants--> if transformants express RFP, we could conclude our pUB110 BioBrick works--> submit pUB110 BioBrick | ||
| - | kerA BioBrick | + | == "Construct kerA BioBrick" == |
| + | |||
| + | -Do Gibson assembly to put together the two kerA gBlocks from IDT | ||
| + | |||
-Put our kerA biobrick into an empty vector w/ amp resistance (so we can use the 3 step assembly) and transform into DH5-a | -Put our kerA biobrick into an empty vector w/ amp resistance (so we can use the 3 step assembly) and transform into DH5-a | ||
| + | |||
| + | |||
-Since promoter/upstream biobrick will be in chloramphenicol resistant vector | -Since promoter/upstream biobrick will be in chloramphenicol resistant vector | ||
| + | |||
| + | |||
-And our puB110 vector will use kanamycin resistance | -And our puB110 vector will use kanamycin resistance | ||
| + | |||
| + | |||
-So that leaves our kerA biobrick the vector that is amp resistant | -So that leaves our kerA biobrick the vector that is amp resistant | ||
Orange: prefix | Orange: prefix | ||
Green: suffix | Green: suffix | ||
| - | Purple: kerA | + | Purple: kerA signal peptide |
</div> | </div> | ||
Revision as of 19:57, 27 September 2013
== '''Construct pUB110 BioBrick''' ==
-Digest pUB110 w/ NdeI and AflII--> gel purify-->nanodrop for concentration
-Digest pUB110 linker w/ NdeI and AflII
Linker sequence:
attcgtcttaaggaattcgcggccgcttctagagtactagtagcggccgctgcagcatatgtcatac
-Set up overnight ligation of digested, gel purified pUB110 and digested pUB110 linker = generates pUB110 BioBrick
-Transform into B. subtilis to amplify
-Set up O. N. cultures
-Do B. subtilis miniprep
-Digest our pUB110 BioBrick
To test pUB110 Biobrick (kanamycin resistant) construction (send for sequencing)
-Put a promoter/upstream BioBrick (in vector with chloramphenicol resistance) + RFP BioBrick from amp resistant vector => do 3 step assembly
-Do transformation in B. subtilis
-Choose transformants--> if transformants express RFP, we could conclude our pUB110 BioBrick works--> submit pUB110 BioBrick
== "Construct kerA BioBrick" ==
-Do Gibson assembly to put together the two kerA gBlocks from IDT
-Put our kerA biobrick into an empty vector w/ amp resistance (so we can use the 3 step assembly) and transform into DH5-a
-Since promoter/upstream biobrick will be in chloramphenicol resistant vector
-And our puB110 vector will use kanamycin resistance
-So that leaves our kerA biobrick the vector that is amp resistant
Orange: prefix
Green: suffix
Purple: kerA signal peptide
