"
Team:UChicago/Plan
From 2013.igem.org
| Line 40: | Line 40: | ||
attcgtcttaaggaattcgcggccgcttctagagtactagtagcggccgctgcagcatatgtcatac | attcgtcttaaggaattcgcggccgcttctagagtactagtagcggccgctgcagcatatgtcatac | ||
| - | -Set up overnight ligation of digested, gel purified pUB110 and digested pUB110 linker = generates pUB110 | + | -Set up overnight ligation of digested, gel purified pUB110 and digested pUB110 linker = generates pUB110 backbone |
| Line 55: | Line 55: | ||
| - | To test pUB110 | + | To test pUB110 backbone, which is kanamycin resistant, send for sequencing |
| - | -Put | + | -Put an upstream BioBrick (in vector with chloramphenicol resistance) + RFP BioBrick in an amp resistant backbone by doing 3 step assembly |
| + | |||
| + | |||
| + | -RFP expression from our modified pUB110 backbone would test if the backbone has all components needed for expression in B. subtilis | ||
| Line 64: | Line 67: | ||
| - | -Choose transformants--> if transformants express RFP, we could conclude our pUB110 | + | -Choose transformants--> if transformants express RFP, we could conclude our modified pUB110 backbone works--> submit pUB110 backbone to iGEM HQ |
| + | |||
== Construct kerA BioBrick == | == Construct kerA BioBrick == | ||
| Line 71: | Line 75: | ||
| - | -Put our kerA biobrick into | + | -Put our kerA biobrick into a backbone w/ amp resistance (so we can use the 3 step assembly) and transform into DH5-a |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | - | + | -Since promoter/upstream biobrick will be in chloramphenicol resistant vector and our puB110 vector will use kanamycin resistance, we will put the kerA biobrick in an amp resistant backbone |
Orange: prefix | Orange: prefix | ||
| Line 86: | Line 84: | ||
Purple: kerA signal peptide | Purple: kerA signal peptide | ||
| + | [[File:kerA variant A.jpg]] | ||
<html> | <html> | ||
Revision as of 20:08, 27 September 2013
Summer Plan
Construct pUB110 BioBrick
-Digest pUB110 w/ NdeI and AflII--> gel purify-->nanodrop for concentration
-Digest pUB110 linker w/ NdeI and AflII
Linker sequence:
attcgtcttaaggaattcgcggccgcttctagagtactagtagcggccgctgcagcatatgtcatac
-Set up overnight ligation of digested, gel purified pUB110 and digested pUB110 linker = generates pUB110 backbone
-Transform into B. subtilis to amplify
-Set up O. N. cultures
-Do B. subtilis miniprep
-Digest our pUB110 BioBrick
To test pUB110 backbone, which is kanamycin resistant, send for sequencing
-Put an upstream BioBrick (in vector with chloramphenicol resistance) + RFP BioBrick in an amp resistant backbone by doing 3 step assembly
-RFP expression from our modified pUB110 backbone would test if the backbone has all components needed for expression in B. subtilis
-Do transformation in B. subtilis
-Choose transformants--> if transformants express RFP, we could conclude our modified pUB110 backbone works--> submit pUB110 backbone to iGEM HQ
Construct kerA BioBrick
-Do Gibson assembly to put together the two kerA gBlocks from IDT
-Put our kerA biobrick into a backbone w/ amp resistance (so we can use the 3 step assembly) and transform into DH5-a
-Since promoter/upstream biobrick will be in chloramphenicol resistant vector and our puB110 vector will use kanamycin resistance, we will put the kerA biobrick in an amp resistant backbone
Orange: prefix Green: suffix Purple: kerA signal peptide
